ID: 1068224500

View in Genome Browser
Species Human (GRCh38)
Location 10:54089671-54089693
Sequence GACAAGGACATTACTACAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068224500_1068224503 5 Left 1068224500 10:54089671-54089693 CCCTTTGTAGTAATGTCCTTGTC 0: 1
1: 0
2: 1
3: 20
4: 209
Right 1068224503 10:54089699-54089721 CAGTAGCTGACAACATTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068224500 Original CRISPR GACAAGGACATTACTACAAA GGG (reversed) Intronic
901349780 1:8583950-8583972 GACAAGGACAGTACAACAACTGG + Intronic
903706990 1:25293164-25293186 GCCAAGGACTTTGCTATAAAGGG + Intronic
904123955 1:28223054-28223076 AGCAAGGACATTCCCACAAAGGG + Intronic
906193171 1:43912046-43912068 GCCAAGGACAAAATTACAAATGG - Intronic
908889815 1:68833126-68833148 GACAAGGACATTACAAGGAAAGG + Intergenic
910094162 1:83501038-83501060 GACAAGGTAATTACTGCTAAAGG - Intergenic
910630033 1:89344746-89344768 GACAAGGACCTGAGTACCAAGGG + Intergenic
910817456 1:91306649-91306671 GACAAGGACATTAAAAAGAAAGG - Intronic
911014173 1:93314518-93314540 GACAAAGACATAACAAAAAAAGG + Intergenic
912396624 1:109349775-109349797 AACAAGAACATTTCTAGAAAAGG + Intronic
912905518 1:113702111-113702133 GTGAAGGACAATAATACAAAAGG + Intronic
914398241 1:147291145-147291167 GACAAGCACAAAACTACCAAAGG + Intronic
915614307 1:157024663-157024685 GAAAAGGAGATTATTATAAATGG - Intronic
915700498 1:157789199-157789221 GACAAGGACACTACAAGAAAAGG + Intergenic
918622349 1:186620081-186620103 GACCTTGACCTTACTACAAATGG - Intergenic
918629760 1:186702710-186702732 GAAAAGGACATTAGAACACATGG - Intergenic
918993208 1:191725359-191725381 GACAAAGAAGTTACTACAGAAGG + Intergenic
921170776 1:212546891-212546913 GACTAGCAAATCACTACAAAAGG - Intergenic
922990484 1:229905841-229905863 CACAATGACAGTATTACAAAAGG + Intergenic
924892660 1:248300255-248300277 GACCAGCACAATACTAGAAATGG + Intergenic
1065085468 10:22170647-22170669 GACAAAGACACTACAAGAAAAGG + Intergenic
1067857992 10:49813822-49813844 GACAAAGACATTACAGGAAAAGG - Intergenic
1068168099 10:53357602-53357624 GATAAGCACATTACTACAATAGG + Intergenic
1068224500 10:54089671-54089693 GACAAGGACATTACTACAAAGGG - Intronic
1068259464 10:54560120-54560142 GAGAAGGTCATTTCTACAACAGG - Intronic
1068375054 10:56166917-56166939 GAAAAAGACTTTACCACAAAAGG + Intergenic
1069059453 10:63879689-63879711 GACAAGGACACTACAAAAAAAGG - Intergenic
1069846292 10:71374106-71374128 GCCCAGGACAATAATACAAATGG - Intergenic
1071067587 10:81654976-81654998 AAAAAAGACATTCCTACAAATGG - Intergenic
1072610040 10:97011734-97011756 AGCAAGGCCATTACTAGAAAGGG - Intronic
1072967664 10:99988324-99988346 GACAAGGACATTTAAAGAAAAGG - Intronic
1073706688 10:105990983-105991005 GAAAAGGACACAACTAAAAAAGG + Intergenic
1073963508 10:108961380-108961402 CACTAGGAGATTACTACAATAGG - Intergenic
1075203399 10:120425333-120425355 TACAAGGACATTGCTTAAAAGGG + Intergenic
1076219893 10:128724856-128724878 GATAAGGACATTAGATCAAAGGG + Intergenic
1077748542 11:4936801-4936823 GTCAATTACATTATTACAAAGGG - Intronic
1079936314 11:26620978-26621000 GACAAGTAGATTACTGGAAAAGG + Intronic
1080078155 11:28177072-28177094 GACCAAGAAATTACTACAATGGG - Intronic
1080171383 11:29307309-29307331 ACCAAGGACATTACTCTAAAAGG + Intergenic
1080338819 11:31232695-31232717 GACAAGGACCTTACTGCCATTGG + Intronic
1083106676 11:60365036-60365058 TACAGGGAAATAACTACAAAAGG + Intronic
1085213923 11:74810835-74810857 GCCAAGTAAATTACTAGAAAAGG + Intronic
1085568285 11:77535837-77535859 GACAAAGACATCACAAGAAAAGG + Intronic
1085596786 11:77818828-77818850 GATAATGAAATTACTACAATGGG + Intronic
1085706158 11:78788332-78788354 GCCAAGCACATTACCTCAAAAGG + Intronic
1086185256 11:84005830-84005852 GACAAGGACATGGAGACAAAGGG + Intronic
1088950518 11:114565007-114565029 GACAATGATATCAATACAAATGG - Intergenic
1089086552 11:115823511-115823533 GACAAAAACATTACAAGAAAAGG - Intergenic
1094765063 12:33584923-33584945 GACAAGGGCAGCACTACAGAGGG - Intergenic
1094835832 12:34321627-34321649 GACAACGGCATTACCGCAAAGGG - Intergenic
1095743624 12:45633541-45633563 GAGGAGGAAATTAATACAAAAGG + Intergenic
1096826975 12:54286943-54286965 CACAAGGACGTTCCTGCAAAAGG - Intronic
1098427000 12:70375892-70375914 GACAAAGACATCACAAGAAAAGG - Intronic
1100927452 12:99565729-99565751 GTCAGAGACAATACTACAAAAGG - Intronic
1109521011 13:63511025-63511047 AACTAGAAAATTACTACAAATGG + Intergenic
1110848076 13:80212480-80212502 GGCAAGAACATTACTACAAATGG + Intergenic
1111446930 13:88358588-88358610 GACAAAGACATAACCAAAAAAGG + Intergenic
1112479714 13:99763947-99763969 GAGAAGGACATGACGAAAAAAGG - Intronic
1113120931 13:106923276-106923298 GAAAGGGACATCACTACCAAAGG + Intergenic
1113159914 13:107368254-107368276 GACAAGAAAACTAATACAAAGGG - Intronic
1113648775 13:112018324-112018346 GTCAAGGACAGTATAACAAAAGG - Intergenic
1114243435 14:20890979-20891001 ACCAAGGATATTACTAAAAATGG + Intergenic
1114246413 14:20918898-20918920 ACCAAGGATATTACTAAAAATGG + Intergenic
1115279282 14:31642800-31642822 GAAGAGGACATTTTTACAAAGGG - Intronic
1117034056 14:51708640-51708662 TACAAGAACATTACCACAACAGG + Intronic
1118953263 14:70454499-70454521 GACAAGAACATTAAGAGAAATGG + Intronic
1120182609 14:81360209-81360231 AACAAGGACATTACAAGAAAAGG + Intronic
1120354857 14:83419278-83419300 GACTCAGCCATTACTACAAAGGG + Intergenic
1123781191 15:23630816-23630838 GATAAAGACATTACCAAAAAAGG - Intergenic
1124615103 15:31235928-31235950 GATAAGTACATAATTACAAATGG + Intergenic
1125317734 15:38449540-38449562 AATGAGGACATTACTAAAAAGGG - Intergenic
1126306551 15:47265071-47265093 GACAAAGACATCACAAGAAAAGG - Intronic
1127268257 15:57378211-57378233 GACTATCACATTACTAAAAAGGG - Intronic
1127653082 15:61028345-61028367 GCCAAGGAAATTCATACAAACGG + Intronic
1135200312 16:20431484-20431506 GATAAGGAAGCTACTACAAAGGG + Intronic
1135430816 16:22381681-22381703 AGCAAGGACATCACTACAATGGG - Intronic
1137353913 16:47739519-47739541 GACAAAGACATCACAAGAAAAGG - Intergenic
1137552412 16:49448116-49448138 GACAAAGCCATTACAAGAAAAGG - Intergenic
1138354986 16:56370441-56370463 GGGAAGGACATGACTACAAAAGG + Intronic
1138756633 16:59494230-59494252 GACAAGGACACTCCTTCAGAAGG - Intergenic
1139557190 16:67719612-67719634 GACAAGGACATATCTGCAGAAGG + Intergenic
1140993408 16:80236087-80236109 GACAAGGAATATTCTACAAATGG + Intergenic
1143195209 17:5071124-5071146 GACAAGAACATTATTACACGTGG + Intergenic
1144140737 17:12345084-12345106 GACAATAATATTACTAAAAAAGG - Intergenic
1146949723 17:36897529-36897551 GGAGAGGACATTACTTCAAAGGG + Intergenic
1148806599 17:50267032-50267054 GAAAAGGACATTTCTACCCAGGG + Intergenic
1150337342 17:64340403-64340425 GTCCAGGACATTTCTGCAAAGGG - Intronic
1152994174 18:390850-390872 GACAAGGACATTAGGAAAACAGG - Intronic
1153094663 18:1386958-1386980 GACAGGGACATAACAAGAAAAGG + Intergenic
1153841767 18:9014341-9014363 CACAAGGACATTACACCTAAGGG + Intergenic
1155385729 18:25275318-25275340 GCCAAGGACATCACTAAAAGGGG + Intronic
1160484381 18:79275470-79275492 GCTAAGGACATTCCTGCAAATGG - Intronic
1163170632 19:15528527-15528549 GTCAAGGAAATTACCACCAAGGG - Intronic
1166620281 19:44291932-44291954 GACAATGACATTCCAAGAAAAGG + Intronic
1167872338 19:52381678-52381700 AACAAGCAAAATACTACAAAAGG - Intronic
927307591 2:21591184-21591206 GACAAATACATTTCTAAAAAAGG + Intergenic
931149893 2:59561173-59561195 CACAAGGAAACTACTACAGAAGG + Intergenic
931513495 2:63025589-63025611 GGAAAGGACATTACAACACAAGG + Intronic
932084134 2:68743076-68743098 GACAATGACATTTCTACAGCAGG - Intronic
933055952 2:77665454-77665476 GACAAGGACAACATTAAAAAGGG + Intergenic
935729930 2:106056822-106056844 GAGAAGGGAATCACTACAAAGGG + Intergenic
935846162 2:107167806-107167828 GACAAGGAGATTAAAAAAAAAGG - Intergenic
937563309 2:123252160-123252182 GATGAGGAAATGACTACAAATGG - Intergenic
937959594 2:127446012-127446034 GACAAAGACATTACAAGAATGGG - Intronic
939321712 2:140631100-140631122 GACAAGGACATTAGAGGAAATGG + Intronic
939670590 2:145006968-145006990 GAAAAAAACAATACTACAAAAGG - Intergenic
940191575 2:151046288-151046310 GTCATGGACATCATTACAAAAGG + Intronic
940696127 2:156981712-156981734 GACAGGAACATCACTTCAAAAGG - Intergenic
940949660 2:159659006-159659028 GACAAAGACATTACAAGAAAGGG - Intergenic
941317457 2:164011468-164011490 CACAAAGACATTTCTCCAAATGG + Intergenic
941962948 2:171271615-171271637 GACAAGCTCATTAATACTAAAGG + Intergenic
942136035 2:172926308-172926330 GACAGGGTCATTATTCCAAAGGG - Intronic
943918348 2:193667879-193667901 GACAAGAACACTACAAGAAAAGG + Intergenic
944165911 2:196720793-196720815 GACAGTGACATATCTACAAATGG + Intronic
944683884 2:202100921-202100943 GCCAAGGACATCTCTAAAAAAGG - Intronic
944739941 2:202602088-202602110 GAACAGGACATTACTATATAGGG - Intergenic
945309248 2:208291431-208291453 GACAAAGACATGACAAGAAAAGG - Intronic
948232539 2:236361369-236361391 GACAAAGAGAGTACTAAAAATGG + Intronic
1169041412 20:2498535-2498557 TACAAGGGCACTACAACAAAGGG + Intronic
1169720040 20:8666342-8666364 GACAAGCACTTTTCTATAAATGG + Intronic
1170657648 20:18304862-18304884 GACAAGGACATTATGAGCAAAGG - Intronic
1177106445 21:16961888-16961910 AACAAGAACATCACTACAAATGG - Intergenic
1177647210 21:23914533-23914555 AACAAGGACATTGCTAGAGATGG - Intergenic
1179246454 21:39638000-39638022 GGCAAGGACATTATGACAAGTGG - Intronic
1182259657 22:29064256-29064278 GACAAGGACAGGACTAGAACTGG - Intergenic
952911180 3:38188140-38188162 GAAAAGGGGAGTACTACAAAGGG - Intronic
953843654 3:46409904-46409926 CACCAGCACATAACTACAAAAGG + Intronic
954528122 3:51291779-51291801 GACAAAGACACTACAAGAAAAGG + Intronic
954588400 3:51757428-51757450 GACAAAGACATCACAAGAAAAGG - Intergenic
954870270 3:53762470-53762492 GAAAAGGACAGTGTTACAAAAGG - Intronic
956049135 3:65228792-65228814 CAGAAGGACATTACAGCAAAGGG + Intergenic
956102691 3:65784965-65784987 GAGAAGGAAATGACTACTAATGG + Intronic
956263203 3:67368461-67368483 GACAAGGACAATCCAACATAAGG - Intronic
957000619 3:74879274-74879296 AACAAGGACATTAATTGAAAAGG - Intergenic
958130704 3:89417979-89418001 GCCAGCTACATTACTACAAATGG - Intronic
959563909 3:107814966-107814988 AAAAAGGACTTTACTACAGAAGG + Intergenic
961387822 3:126533681-126533703 GACAAAGACATCACAAGAAAAGG - Intronic
961685364 3:128626198-128626220 GACAAGGGCTTTAAAACAAAGGG - Intronic
963514107 3:146287130-146287152 AACAAAGATATTACTAAAAAAGG - Intergenic
964879809 3:161410847-161410869 GACAAGTACATTTCTAAGAATGG + Intergenic
965128338 3:164659875-164659897 CACAAGGACATTATTAGCAAAGG - Intergenic
970028663 4:11652904-11652926 TACTAGAACATTCCTACAAAGGG - Intergenic
970779777 4:19722740-19722762 GACAAGGACTTGACTTCAAATGG + Intergenic
971731763 4:30392992-30393014 GACAAGGAAAATGCTACATACGG + Intergenic
971896504 4:32603899-32603921 TATAAGAACATTACTATAAAAGG - Intergenic
972457639 4:39269938-39269960 TAAAACGACATTACTGCAAAGGG - Intronic
973616719 4:52686180-52686202 GACAAGGATGTTCCAACAAAAGG - Intergenic
974005152 4:56548947-56548969 GAAAAGGACCTTATGACAAAGGG - Intronic
975134371 4:70860264-70860286 AACAAGGACATTAGGAAAAAAGG + Intergenic
976824488 4:89245761-89245783 GACACGAACACAACTACAAATGG + Exonic
980696838 4:136367996-136368018 GGAAAGGACATTTCTACAAAGGG - Intergenic
981760354 4:148187959-148187981 GGAAAGGACATTTCAACAAATGG - Intronic
982132304 4:152240797-152240819 CCTAAGGACTTTACTACAAAAGG + Intergenic
983571670 4:169215405-169215427 GATAAAGACATTACAAGAAAAGG - Intronic
983994421 4:174163993-174164015 GAAAAGTACATTACTACCATTGG - Intergenic
984429756 4:179633804-179633826 GACAAGGATATCACAAGAAAGGG - Intergenic
985862772 5:2487453-2487475 GACAGGGACATTTGTAAAAAAGG + Intergenic
988615848 5:32774131-32774153 GACTAAGACATTATTACTAATGG + Intronic
992376274 5:76190844-76190866 GATAAGGACATTTCTGGAAATGG - Intronic
992941159 5:81763418-81763440 GAGAAGGACATTTGAACAAAGGG + Intergenic
993150624 5:84156988-84157010 GATAAAGACATTACTAGAGAAGG - Intronic
993547066 5:89225682-89225704 GACAAGGACATTATAAGAAAAGG - Intergenic
993570509 5:89532934-89532956 GACAAGGAGATAAAAACAAAAGG - Intergenic
994520705 5:100830722-100830744 GACAAAGATATTATTTCAAATGG + Intronic
999561738 5:152810871-152810893 GAGAAGGACACTTCTTCAAATGG + Intergenic
1003262890 6:4538421-4538443 GCAAAGGACACTACTAAAAAGGG + Intergenic
1003955222 6:11157384-11157406 GTCAAGGAAATTACAAAAAAGGG + Intergenic
1005196422 6:23290609-23290631 GACAAAGACATTATAAGAAAAGG + Intergenic
1005356388 6:24987709-24987731 GGCAAGGACATTTATACATAGGG - Intronic
1006279909 6:33043231-33043253 GAAAAGGACTATACTGCAAAAGG - Intergenic
1008672342 6:53783449-53783471 GACAAGGACACAACAAAAAAAGG + Intergenic
1009736248 6:67679786-67679808 GGCAGTGTCATTACTACAAATGG + Intergenic
1010598589 6:77795937-77795959 GACAAGGACAGTACAAGAAAAGG + Intronic
1012350264 6:98241678-98241700 GACAAGTACACTATAACAAAAGG + Intergenic
1012531711 6:100245600-100245622 CACACGGACATTAGGACAAAGGG + Intergenic
1014269091 6:119315809-119315831 GATAAGGAAATAACTACAAATGG - Intronic
1014982294 6:127959060-127959082 GAAAAGGACTATACTGCAAAAGG + Intergenic
1015640562 6:135327335-135327357 GACAAAGACATTTCTACATCCGG - Intronic
1018074068 6:160194839-160194861 GACAAAGACATTACATAAAAAGG + Intronic
1018292654 6:162308624-162308646 GAAAATTACATTACCACAAATGG - Intronic
1019021404 6:168921475-168921497 GACAAGGAAAATACTCCACATGG - Intergenic
1023470993 7:40519277-40519299 GATAAGGACATTAGTAAAACAGG + Intronic
1023820974 7:43980386-43980408 GCACAGGACATTACTCCAAATGG + Intergenic
1027328324 7:77065188-77065210 GCACAGGACATTACTCCAAATGG - Intergenic
1027818729 7:83014843-83014865 AACAAGGAAAATACTAGAAAAGG + Intronic
1028986230 7:97010705-97010727 GATTAGAACATTGCTACAAAGGG + Exonic
1029749246 7:102533826-102533848 GCACAGGACATTACTCCAAATGG + Intergenic
1029767189 7:102632930-102632952 GCACAGGACATTACTCCAAATGG + Intronic
1031493797 7:122422292-122422314 AACAAGGACATTACGGCCAAAGG + Intronic
1036383589 8:8258144-8258166 GACAACAACATGACTAGAAAAGG - Intergenic
1037004753 8:13763866-13763888 GACAAAGACATCACAAGAAAAGG + Intergenic
1044239523 8:89872513-89872535 AAGAAGGACATTAATAAAAAAGG + Intergenic
1044559068 8:93594885-93594907 GACAATGTCATTACTGCCAATGG - Intergenic
1046352653 8:113035495-113035517 GAGAAGGAAGTAACTACAAAGGG + Intronic
1046545673 8:115647283-115647305 GAAAAGGAAATTAATACAGAGGG + Intronic
1046728818 8:117703483-117703505 GACAAGGCCAGTACTATGAAAGG - Intergenic
1047118782 8:121876527-121876549 GATAAGGACACTTCTAGAAAAGG + Intergenic
1050103301 9:2140834-2140856 GACATGCACATTACCACTAACGG - Intronic
1051435461 9:17026369-17026391 AACAAGGAAATTACTTCAAACGG + Intergenic
1051957300 9:22711963-22711985 GACAATGACATCATTAGAAAAGG - Intergenic
1052231960 9:26164820-26164842 GACAAGGACCCAACTACGAAGGG + Intergenic
1055204815 9:73715896-73715918 GATAAAGACATTACAAGAAAAGG - Intergenic
1055213334 9:73826880-73826902 GAAAAAGACATTAGAACAAATGG - Intergenic
1055459303 9:76502893-76502915 CACAAAGACATTACTAAAACAGG - Exonic
1056849007 9:90065424-90065446 GACAAGGAGATTATTCCAAAGGG + Intergenic
1057571713 9:96208974-96208996 GACAAGGACATTATAAGAAAGGG - Intergenic
1057610253 9:96536334-96536356 CACAAAGGCATCACTACAAAAGG + Intronic
1058609540 9:106760439-106760461 TAGAAATACATTACTACAAAGGG - Intergenic
1061337768 9:129952931-129952953 GACAAGGAAATTAAGACATAAGG + Intronic
1186141198 X:6575943-6575965 GACAAGGAGAAAACTCCAAAAGG + Intergenic
1187823185 X:23309637-23309659 GACATAGTCAATACTACAAAGGG + Intergenic
1187825284 X:23329654-23329676 GACAAGGGCATTCCTTCACAGGG - Intergenic
1188101357 X:26091851-26091873 GCCCAGAACATTAATACAAAAGG + Intergenic
1188213831 X:27454170-27454192 GACAAGGACATTTTTATAAAAGG - Intergenic
1188282287 X:28285025-28285047 GAAAAAGACATTACAAGAAAAGG - Intergenic
1189218479 X:39348298-39348320 GGAAAGGACATAACTAAAAACGG + Intergenic
1189570268 X:42287535-42287557 AACAAGGACCTTGCTATAAATGG - Intergenic
1190379348 X:49824236-49824258 GACAAAGATATTAATAGAAAAGG + Intergenic
1190591288 X:52004327-52004349 GACAAGGACACTACAAGAAAAGG - Intergenic
1191135459 X:57059083-57059105 GACAAGGAGATTCCTTCAGACGG - Intergenic
1192181457 X:68918302-68918324 GACAAGAAGATTAATACACAGGG - Intergenic
1193775690 X:85638693-85638715 GAAAAGGACATAACAAAAAAAGG - Intergenic
1193858301 X:86633638-86633660 GACAAGCACACAACTAAAAAAGG + Intronic
1193987487 X:88262515-88262537 GACAAAGACACTACAAGAAAAGG - Intergenic
1196129629 X:112140925-112140947 GAGAAGGAATTTACTACAAAGGG - Intergenic
1198854210 X:140999226-140999248 AACAAGGACATAACTTTAAATGG + Intergenic
1198877800 X:141245895-141245917 AACAAGGACATAACTTTAAATGG - Intergenic
1198908302 X:141586295-141586317 AACAAGGACATAACTTTAAATGG + Intronic
1201060501 Y:10040005-10040027 GAGAATGACAATACTACACAAGG - Intergenic
1202062090 Y:20898827-20898849 CACATGGACATTGCTTCAAATGG + Intergenic
1202196525 Y:22304049-22304071 GAGAATGACAACACTACAAAAGG + Intergenic