ID: 1068235718

View in Genome Browser
Species Human (GRCh38)
Location 10:54230324-54230346
Sequence GATCCTTGTGCTACACAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 125}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068235718_1068235720 23 Left 1068235718 10:54230324-54230346 CCCAGTTGTGTAGCACAAGGATC 0: 1
1: 0
2: 0
3: 13
4: 125
Right 1068235720 10:54230370-54230392 AAAAAATAAGAAAACAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068235718 Original CRISPR GATCCTTGTGCTACACAACT GGG (reversed) Intronic
904884684 1:33727154-33727176 GTTAATTGTGTTACACAACTGGG + Intronic
909303156 1:74038487-74038509 GCTCCCTGTGCCACTCAACTGGG + Intronic
910653071 1:89590853-89590875 GAGACTTGTGCTTCTCAACTGGG + Intronic
917295630 1:173516134-173516156 GCTCCCTGTGCCACCCAACTGGG - Intronic
918697257 1:187560118-187560140 GTTCCCTGTGCCACCCAACTGGG - Intergenic
919031745 1:192251619-192251641 GTTCCCTGTGCCACCCAACTGGG - Intergenic
920527912 1:206682192-206682214 GAGCCTGGTGTTACACAAATAGG + Intronic
920765431 1:208828172-208828194 GACCTTTGTGTTATACAACTTGG - Intergenic
923942543 1:238844216-238844238 GCTCCCTGTGCCACCCAACTGGG - Intergenic
1063400544 10:5740309-5740331 GATCCTTGGGCTTCACCACGGGG - Exonic
1065942988 10:30581918-30581940 GATTCTTGTTCTACACCACTTGG + Intergenic
1067207606 10:44233287-44233309 GCTCCCTGTGCCACCCAACTGGG - Intergenic
1067974972 10:51014004-51014026 GACACTTGTGCTCCAAAACTTGG - Intronic
1068235718 10:54230324-54230346 GATCCTTGTGCTACACAACTGGG - Intronic
1082696710 11:56375906-56375928 GATGCATGTGCTACTCAACTGGG + Exonic
1082700062 11:56417928-56417950 CATGCTTGTGCAACCCAACTGGG - Exonic
1086594824 11:88558172-88558194 GATCCTTATGCTTCCCACCTTGG - Intronic
1087316949 11:96614588-96614610 GCTCCCTGTGCCACCCAACTGGG - Intergenic
1089616479 11:119697675-119697697 CACCCTTTAGCTACACAACTTGG - Intronic
1092639850 12:10493909-10493931 GTTCCCTGTGCCACGCAACTGGG + Intergenic
1093808518 12:23464902-23464924 GTTCCCTGTGCCACCCAACTGGG + Intergenic
1094074812 12:26460802-26460824 CTTCCTTCTGATACACAACTTGG - Intronic
1095647852 12:44570279-44570301 GATGCTGGTGCTCCACAATTAGG + Intronic
1095780075 12:46049347-46049369 GCCCTCTGTGCTACACAACTAGG + Intergenic
1098584240 12:72137406-72137428 GATCCTTGTACTACCAGACTGGG + Intronic
1100001811 12:89845719-89845741 GATTCTTGTGCTATACAAACAGG + Intergenic
1100875490 12:98957203-98957225 GCTCCTTGGGCTCCACAAGTGGG + Intronic
1102894393 12:116587055-116587077 GATCCTTGTGCTTGACAACATGG + Intergenic
1107441085 13:40428001-40428023 CATCCTTGTGCTACTCAAAAGGG + Intergenic
1108144729 13:47464257-47464279 GTTCCCTGTGCCACCCAACTGGG + Intergenic
1109307859 13:60661216-60661238 GCTCCCTGTGCCACCCAACTGGG - Intergenic
1110530712 13:76594432-76594454 AACCCCTGTGCTACACAATTTGG - Intergenic
1111092252 13:83462461-83462483 GCTCCTTGTGCCTCCCAACTGGG + Intergenic
1111200401 13:84928157-84928179 GTTCCCTGTGCCACCCAACTGGG + Intergenic
1113033412 13:106019906-106019928 GATCCCTAAGCTACTCAACTAGG - Intergenic
1113380011 13:109795725-109795747 CATACTTGTGCTACAAAATTCGG - Intergenic
1113457044 13:110456762-110456784 GATGCTGGTGCCTCACAACTGGG + Intronic
1113527774 13:110994226-110994248 GTTTCCTGTGCTACCCAACTTGG + Intergenic
1114706033 14:24727181-24727203 GCTCCCTGTGCTACCCAACTGGG + Intergenic
1117447895 14:55822162-55822184 CAGCCTTGTGCTACAGGACTTGG + Intergenic
1118530747 14:66702320-66702342 GTTCCCTGTGCCACCCAACTGGG + Intronic
1124867552 15:33507995-33508017 GAGTCCTGTGCTACACAACTAGG + Intronic
1126191220 15:45880923-45880945 GATCCTTGTGTTATACACCTTGG - Intergenic
1130848335 15:87768233-87768255 GCTCCTTGTGCCACCCAACTGGG + Intergenic
1136645335 16:31608860-31608882 GTTCCATGTGCCACCCAACTGGG + Intergenic
1139169634 16:64615311-64615333 GCTCCCTGTGCCACCCAACTGGG - Intergenic
1141752613 16:85969088-85969110 AATCCTTATCCTACACTACTTGG - Intergenic
1147614836 17:41821733-41821755 GGTCCTTGTGCCACACAAACAGG - Exonic
1148342204 17:46879944-46879966 GAAGCTTGGGCTACACCACTGGG + Intronic
1156664636 18:39390442-39390464 GCTCCCTGTGCCACCCAACTGGG + Intergenic
1159249211 18:65851866-65851888 GCTCCTTGTGCTACACCACCAGG - Intronic
1165447007 19:35861909-35861931 GATCTCTGTGCTACACATTTCGG + Exonic
1166117004 19:40662427-40662449 GTTCCTTATGCTCCTCAACTGGG - Intergenic
927320719 2:21742227-21742249 GATTTTTGTGCTACACAAAGTGG + Intergenic
934026814 2:88008069-88008091 GATTTCTGTGCTACACAACATGG + Intergenic
939809034 2:146808537-146808559 GCTCCCTGTGCCACCCAACTGGG + Intergenic
939860573 2:147415392-147415414 GCTCCCTGTGCCACCCAACTGGG - Intergenic
940489274 2:154336849-154336871 GGTCCTTTTGGTACACAACTGGG + Intronic
940519182 2:154721293-154721315 GATCAGTGTGCTACACAGCATGG - Intronic
943801429 2:192063073-192063095 TATCCTTGTGCTACATACTTAGG + Intronic
945439683 2:209864318-209864340 GTTCCTCGTGCCACCCAACTAGG - Intronic
945862898 2:215144178-215144200 GCTCCCTGTGCTACACAAAATGG - Intergenic
1169980660 20:11380188-11380210 GTTCCCTGTGCTACCCAACTGGG + Intergenic
1173411824 20:42818043-42818065 GATCCCCGTGCCACCCAACTGGG + Intronic
1183815870 22:40299693-40299715 GGCCATTGTGCTACACTACTTGG + Intronic
957291406 3:78281952-78281974 GCTCCCTGTGCCACCCAACTGGG + Intergenic
957584271 3:82114349-82114371 GTTCCCTGTGCCACTCAACTTGG - Intergenic
957853206 3:85838421-85838443 GAGCCTTGTGCAACCCACCTTGG + Intronic
959139517 3:102469039-102469061 GATTCTTGTGTTTCACAAATCGG - Exonic
960263760 3:115597323-115597345 GTTCCTTGTAATACACTACTCGG + Intergenic
965199188 3:165634426-165634448 CTTCATTGTGGTACACAACTCGG - Intergenic
965263393 3:166511121-166511143 GCTCCCTGTGCCACCCAACTGGG + Intergenic
969282814 4:6182564-6182586 GATCATGGTGCCAGACAACTTGG - Intronic
970952681 4:21775434-21775456 GCTCCTTGTGCCACTCAGCTGGG - Intronic
971828513 4:31659628-31659650 GGACCTTGTTCTACACAGCTTGG + Intergenic
974271541 4:59656608-59656630 GTTCCCTGTGCCACGCAACTGGG + Intergenic
976541475 4:86281983-86282005 TATCTTTGTGTTTCACAACTGGG + Intronic
977462043 4:97337534-97337556 GCTTCTTGTGCCACCCAACTGGG + Intronic
978206219 4:106083610-106083632 GCTCCCTGTGCCACCCAACTGGG + Intronic
978805765 4:112798717-112798739 CACCCTTGTGCTACACCAGTGGG - Intergenic
979037847 4:115748094-115748116 GATTCTTCTGCTACCGAACTTGG - Intergenic
980211395 4:129792627-129792649 GAAACTTGTGTTACACAATTTGG + Intergenic
980787347 4:137572560-137572582 GTTCCCTGTGCCACCCAACTGGG - Intergenic
981352891 4:143752704-143752726 GCTCCTTGTGCCACCCAACTGGG + Intergenic
982528287 4:156506264-156506286 GATCCCTGTGCCACCCAACTGGG + Intergenic
983114500 4:163796140-163796162 GACCCTTGAACAACACAACTTGG - Intronic
984335072 4:178379629-178379651 GTTCCCTGTGCCACCCAACTGGG + Intergenic
987905659 5:24072733-24072755 TATACTTGTGCTAGACATCTAGG - Intronic
990461247 5:56033258-56033280 GATCCCAGTGCTACACTAATAGG - Intergenic
990620041 5:57549898-57549920 GCTCCCTGTGCCACCCAACTTGG - Intergenic
990718531 5:58666835-58666857 GAAAGTTGTGCTACAAAACTGGG + Intronic
992988012 5:82253578-82253600 GATCCCTGTCCTAAATAACTTGG - Intronic
993117202 5:83733454-83733476 GCTCCCTGTGCCACCCAACTGGG - Intergenic
993189310 5:84661112-84661134 GCTCCAGGTGCTACACAAATTGG + Intergenic
993807977 5:92436475-92436497 GTTCCTCGTGCCACTCAACTGGG + Intergenic
994815177 5:104576738-104576760 GATCATTGTGAAACATAACTGGG - Intergenic
996287673 5:121813507-121813529 GTTCCCTGTGCCACCCAACTGGG - Intergenic
996527211 5:124492008-124492030 GCTCCCTGTGCCACCCAACTGGG - Intergenic
996613235 5:125409583-125409605 AGTGCTTGTGCTGCACAACTGGG + Intergenic
997097511 5:130929705-130929727 GTTCCCTGTGCCACCCAACTAGG + Intergenic
998788896 5:145744376-145744398 GTTCCCTGTGCCACTCAACTGGG + Intronic
1001355845 5:171022266-171022288 CATCCCTGTGCCACCCAACTGGG - Intronic
1001788886 5:174437457-174437479 GCTCCCTGTGCCACCCAACTGGG + Intergenic
1003248818 6:4406311-4406333 GTTCCCTGTGCCACCCAACTGGG + Intergenic
1003687030 6:8314811-8314833 GTTCCCTGTGCCACCCAACTAGG - Intergenic
1005670338 6:28099288-28099310 GTTCCCTGTGCCACCCAACTGGG + Intergenic
1006382450 6:33707644-33707666 GCACCTTGTGCTACATAAGTGGG + Intronic
1009316647 6:62228973-62228995 GCTCCTCGTGCCACCCAACTGGG - Intronic
1010483151 6:76378940-76378962 GCTCCCTGTGCCACCCAACTGGG - Intergenic
1013119109 6:107125766-107125788 GATCCCTGGGCTAAACAACCAGG + Intergenic
1013379858 6:109557463-109557485 GCTCCCTGTGCCACCCAACTGGG - Intronic
1013461584 6:110379245-110379267 GCTCCCTGTGCTGCCCAACTGGG + Intergenic
1014484699 6:121984696-121984718 GCTCCCTGTGCTACCCAACTGGG - Intergenic
1018767299 6:166944600-166944622 GTTCCTACTGCTACACAACAAGG + Intronic
1018889425 6:167972602-167972624 GATCCATGTGCTGCACAGCAGGG + Intergenic
1021486511 7:21174103-21174125 GATCCTTGTCCTAGACTTCTGGG - Intergenic
1025723701 7:64038427-64038449 GCTGCTTGGGCTACACACCTGGG + Intronic
1029039555 7:97558195-97558217 GTTCCCCGTGCTACCCAACTGGG + Intergenic
1031642303 7:124180289-124180311 CATCTTTCTGCTACATAACTTGG + Intergenic
1032773651 7:135087401-135087423 GTTCCTTGTGTTACATAATTAGG + Intronic
1033879474 7:145862904-145862926 GTTCCCTGTGCCACCCAACTGGG + Intergenic
1033888603 7:145979604-145979626 TATCCTTGTTCTACATAATTTGG + Intergenic
1034850835 7:154491932-154491954 GATCCTTGAGCTACTGAGCTTGG - Intronic
1035599431 8:888849-888871 GCTCCTCGTGCAACCCAACTCGG - Intergenic
1040614131 8:49018020-49018042 GCTCCCTGTGCCACCCAACTGGG - Intergenic
1040959835 8:53019590-53019612 GTTCCCTGTGCCACCCAACTGGG + Intergenic
1044356087 8:91224659-91224681 GCTCCCTGTGCCACCCAACTGGG - Intronic
1050966881 9:11815927-11815949 GATTCTTGTGCTACATAGCAAGG + Intergenic
1050982390 9:12036468-12036490 GTTCCCTGTGCCACCCAACTGGG + Intergenic
1051003572 9:12315004-12315026 GCTCCCTGTGCCACCCAACTGGG - Intergenic
1052225224 9:26077613-26077635 GCTCCCTGTGCCACCCAACTGGG - Intergenic
1055382652 9:75725756-75725778 GATCCTGGAGCTAAACACCTAGG + Intergenic
1193055946 X:77150917-77150939 GGTTCTTTTGCTACCCAACTTGG + Intergenic
1193605848 X:83567158-83567180 GCTCCCTGTGCCACCCAACTAGG - Intergenic
1193780729 X:85698659-85698681 GTTCCTCGTGCCACCCAACTGGG - Intergenic
1196486031 X:116208345-116208367 GATACATGTGCAACACAACGTGG + Intergenic
1197049496 X:122042185-122042207 GTTCCCTGTGCTACCCAAATGGG - Intergenic
1197870926 X:131061617-131061639 GATCCTGCTGCAGCACAACTAGG - Intronic
1201579942 Y:15500671-15500693 GTTCTTTGTGGTACACATCTAGG - Intergenic