ID: 1068241381

View in Genome Browser
Species Human (GRCh38)
Location 10:54305892-54305914
Sequence CAGAAAAAAGACCAGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068241377_1068241381 8 Left 1068241377 10:54305861-54305883 CCTCAGCCAAAGAATATGGGATG 0: 1
1: 1
2: 1
3: 12
4: 156
Right 1068241381 10:54305892-54305914 CAGAAAAAAGACCAGGAAGCAGG No data
1068241378_1068241381 2 Left 1068241378 10:54305867-54305889 CCAAAGAATATGGGATGATAAAG 0: 1
1: 0
2: 1
3: 16
4: 221
Right 1068241381 10:54305892-54305914 CAGAAAAAAGACCAGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068241381 Original CRISPR CAGAAAAAAGACCAGGAAGC AGG Intronic
No off target data available for this crispr