ID: 1068243005

View in Genome Browser
Species Human (GRCh38)
Location 10:54329163-54329185
Sequence GGAATTCTAAGGTACACTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 117}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068243005 Original CRISPR GGAATTCTAAGGTACACTAA AGG (reversed) Intronic
906493724 1:46288030-46288052 GGAATTCTGATGTGCACCAAAGG - Intronic
908606800 1:65806772-65806794 GGAAATCTAAGAAACAATAATGG - Intronic
910528026 1:88203231-88203253 GGAATTCAGAGGGACACCAAGGG + Intergenic
913095635 1:115513204-115513226 GGAATTGTAAGGTAAAAAAAGGG + Intergenic
918201930 1:182275791-182275813 GGCACACAAAGGTACACTAAGGG + Intergenic
918683708 1:187388283-187388305 GGACTCCTAAGGTACCCTTATGG - Intergenic
919132388 1:193467701-193467723 GGAAGTCTAAGCTACTCTTAAGG - Intergenic
920118195 1:203636160-203636182 AGAATTCTAAGGGACACTAAAGG - Intronic
1064497654 10:15930665-15930687 GAAATTCTAATGTACAATGAAGG - Intergenic
1064503478 10:16001618-16001640 TGAATTCTAGGGTGCACTCAAGG + Intergenic
1068243005 10:54329163-54329185 GGAATTCTAAGGTACACTAAAGG - Intronic
1072059177 10:91792315-91792337 GAAATTCAAAGGAACATTAAAGG + Intergenic
1073675470 10:105642522-105642544 GAACTTCTAAGGTAAACTTATGG + Intergenic
1074926494 10:118078008-118078030 GGAATACTAAGCTACTCTATAGG + Intergenic
1078373626 11:10773935-10773957 AGAATGCTAAGGTACAGAAAGGG - Intronic
1078630613 11:13000515-13000537 GGGATTCTTATGCACACTAAAGG - Intergenic
1079700208 11:23536832-23536854 GGAATTGTAAGTGACACAAATGG - Intergenic
1086694015 11:89822657-89822679 GGAATGGTGAGTTACACTAATGG + Intergenic
1087471997 11:98587418-98587440 GGAATTTTCAGCTACACAAAAGG - Intergenic
1089157812 11:116415524-116415546 GAAACTCTAAGGGACACAAAAGG - Intergenic
1089738334 11:120564682-120564704 GGAATACTAATGCACCCTAAAGG + Intronic
1096719821 12:53512873-53512895 GTGATTCTAATGCACACTAAAGG - Exonic
1099688502 12:85920927-85920949 GGAATTCTGAGCTAAACTGAGGG - Intergenic
1105990835 13:25619076-25619098 GGGATTCTCAGGTAAACTGAAGG + Intronic
1106596488 13:31144802-31144824 AAAATTCTAATGTACAGTAATGG - Intronic
1107118741 13:36775776-36775798 GGAATTCTGAGGAATACCAAGGG + Intergenic
1107471860 13:40698518-40698540 GTAATTCTAAAGTACTTTAAAGG + Intergenic
1107801011 13:44108005-44108027 GGAATTCTAATGTGTACTTAAGG - Intergenic
1108076467 13:46685010-46685032 GGAATTCTAAAGTGGACGAAGGG - Intronic
1108225147 13:48281855-48281877 GGAATTCTAAAGAACCCTGAAGG + Intergenic
1110295663 13:73861457-73861479 GGCATTCTTATTTACACTAAAGG + Intronic
1111346530 13:86963425-86963447 GTAATTATAAGGCACAGTAATGG + Intergenic
1112169973 13:96961333-96961355 GGAATTCTCAGTTACACAAAAGG + Intergenic
1118054209 14:62062504-62062526 GGAAGTCTAAGGTTCCCCAAAGG - Intronic
1119574522 14:75706954-75706976 GGAATCCTAATTTACAATAAGGG - Intronic
1124648213 15:31455127-31455149 GGAATTGGAAAGTACAATAATGG - Intergenic
1134762922 16:16729893-16729915 GGAATTAAAAGCTTCACTAAAGG - Intergenic
1134983130 16:18629256-18629278 GGAATTAAAAGCTTCACTAAAGG + Intergenic
1135055480 16:19228463-19228485 GTAATTCTAAGGTACAGCCAGGG - Intronic
1137320639 16:47378121-47378143 AGAATTCTAAGAATCACTAAGGG + Intronic
1137339174 16:47582627-47582649 GGAATTCTAATATACAATCAAGG + Intronic
1137906789 16:52331558-52331580 GTAATTCTAAGGTACAAAATTGG - Intergenic
1140464956 16:75174106-75174128 GGAAATGTACGATACACTAAAGG + Intergenic
1141087639 16:81108293-81108315 GTGATTCTAAGGTGCACTCAGGG + Intergenic
1141837204 16:86549636-86549658 GTGATTCTAATGCACACTAAAGG - Intronic
1150919481 17:69468196-69468218 GGAACTCTGAATTACACTAAAGG - Intronic
1152373928 17:79908157-79908179 GGAATTCTAAGAAACATGAACGG - Intergenic
1152374355 17:79911337-79911359 GGAATTCTAAGAAACATGAACGG - Intergenic
1156784183 18:40891174-40891196 TGAATTCTAAGGAACAGTGATGG + Intergenic
1156993000 18:43432743-43432765 GGAATACTAATGAATACTAATGG + Intergenic
1157969821 18:52253582-52253604 GGAATTGTAAAGTACAACAAGGG + Intergenic
1164659787 19:29953792-29953814 GTAAGTCTAAGATACACTACAGG - Intronic
1167059468 19:47134627-47134649 GGGATTCTAAGGTACTGGAAGGG + Intronic
925250163 2:2427180-2427202 GGAAATCTAAGTTAATCTAAAGG + Intergenic
932931645 2:76047276-76047298 GAAATTCTAAGGATCATTAATGG + Intergenic
933061529 2:77742882-77742904 GAAATTCCCAGGTACACAAAAGG - Intergenic
937356496 2:121201198-121201220 TGAATTCTAAGGCTCACTCAAGG - Intergenic
938039407 2:128063384-128063406 GGAATGCTAAGGAAAACCAAGGG - Intergenic
940291309 2:152079938-152079960 GGAATTCTAATGTACAGCCAAGG + Intronic
940795729 2:158076011-158076033 GGAATTCAAAGGATCACTAGTGG + Intronic
942025317 2:171905049-171905071 GGAATTAGAAGGCACAATAAAGG - Intronic
1170942575 20:20861042-20861064 GTAATTCTAAGCAACACTAATGG + Intergenic
949288657 3:2437314-2437336 AGTATTTTAAGGGACACTAATGG - Intronic
949468538 3:4369254-4369276 GCAATTCTCAGGTAGACAAAAGG + Intronic
950640461 3:14345179-14345201 GGGATTCTGAGGTTCACTCAAGG - Intergenic
952445400 3:33376624-33376646 GAAATTCCCAGGTACCCTAAAGG - Intronic
953597537 3:44332517-44332539 AGTATTCCAAGATACACTAAAGG - Intergenic
954973694 3:54673364-54673386 GGAATTTTCAAGCACACTAAAGG - Intronic
955643281 3:61109743-61109765 GAAAGACTAAGGTACACTAATGG - Intronic
958754152 3:98229926-98229948 GGAATCCTAAGGTGCTCTTAGGG + Intergenic
966721689 3:183069455-183069477 GCATTTCTAAGGTACATTGAAGG - Intronic
967266347 3:187695607-187695629 GGAATCTTAAGGAACACGAAGGG - Intergenic
971525893 4:27618286-27618308 AAAATTCTCAGGTACACAAATGG + Intergenic
972332857 4:38079948-38079970 GAAATTCTAATGCACACAAAAGG - Intronic
973132092 4:46660462-46660484 GGAATTTAAAGGTACTCTAATGG + Intergenic
977003849 4:91540598-91540620 GGACTTTTTAGATACACTAAAGG - Intronic
977594881 4:98867508-98867530 ACAATTCTAACCTACACTAAAGG + Intergenic
979500039 4:121429343-121429365 GGCATTCTGAGGTCCACTATAGG - Intergenic
979901592 4:126226649-126226671 AAAATTCTAAGTTACAGTAATGG - Intergenic
981070132 4:140526274-140526296 AGAATTTTAAAGTACACAAATGG + Intronic
981437424 4:144741868-144741890 GGAAGGCTAAGGTATACTATTGG + Exonic
989195732 5:38714398-38714420 GGCATTCTTAGGTACACTGCTGG - Intergenic
991058788 5:62349190-62349212 GTAATTCTAATGTACAGTAAAGG - Intronic
992592720 5:78311938-78311960 GAAATTCTAAGATACAATCATGG + Intergenic
997995997 5:138586986-138587008 GGACTTCTGTGGTACACGAAAGG - Intergenic
998091371 5:139372420-139372442 AGAGCTCTAAGGAACACTAAAGG + Intronic
998168738 5:139859641-139859663 GGGATGCTACGGTACACTGAGGG + Intronic
998640225 5:144001856-144001878 GGAATTCTAAGGCAAACTGAAGG + Intergenic
999836926 5:155383765-155383787 CAAATTTTAAGGTACATTAAAGG - Intergenic
1002144151 5:177165451-177165473 TGAATTTTAAAGTAGACTAAGGG - Intronic
1007014529 6:38450846-38450868 GTGATTCTAATGTACACTCAAGG + Intronic
1008294967 6:49764643-49764665 GGAATTCAGAGCTACACTATTGG + Intergenic
1014650320 6:124028086-124028108 GGCATCCTAAGTAACACTAAGGG - Intronic
1017365999 6:153638707-153638729 GGAATTCAAAGAATCACTAATGG - Intergenic
1017885237 6:158593921-158593943 GGAATTCTAATGTAAACTGTGGG - Intronic
1018670856 6:166175981-166176003 AGAATTCCAAGTTACGCTAATGG + Intergenic
1025802050 7:64795522-64795544 GTATTTCAAATGTACACTAAAGG - Intronic
1028718508 7:94002585-94002607 GGGATTCTAATGTACAGTCAGGG + Intronic
1029225755 7:99027286-99027308 AGAATTGTAAGGGAAACTAATGG - Intergenic
1033001145 7:137506573-137506595 TGAATCCTAACGTACACTATGGG + Intronic
1034111974 7:148546067-148546089 GGAATGCTAAAGTACACTTTCGG + Intergenic
1034245980 7:149644727-149644749 GGAATTGTAAGGTGGACTTATGG - Intergenic
1035551066 8:526111-526133 GAAATTCAAAGGCTCACTAAAGG - Intronic
1038136507 8:24791767-24791789 AGAATTCTAACATAAACTAAAGG - Intergenic
1040642650 8:49357523-49357545 TGAATCCTAATGTAAACTAAGGG - Intergenic
1044499152 8:92930634-92930656 GGGATTCTGAGGTTCACAAAGGG + Intronic
1045109910 8:98930338-98930360 GGAATTCAAAGCTACAGTGAAGG - Intronic
1048073696 8:131045349-131045371 GGAAGTCAAAGGTACATCAAGGG - Intergenic
1048402538 8:134085294-134085316 GGAACTCTGAGGTAGACAAAGGG - Intergenic
1051021100 9:12543887-12543909 GGATTTCTATCGTAAACTAAAGG + Intergenic
1052517262 9:29499066-29499088 GGAATCCCAAGATACTCTAAAGG - Intergenic
1054839022 9:69715463-69715485 AGTACACTAAGGTACACTAAAGG + Intronic
1055257689 9:74391552-74391574 GCAATTATTAGGTTCACTAAAGG + Intergenic
1055986083 9:82057359-82057381 GGAAATGTAAGATTCACTAAAGG + Intergenic
1061772829 9:132939923-132939945 GTAATTCTGACGTCCACTAAAGG + Intronic
1187327580 X:18306213-18306235 GAAATTCTAAGGTGCACTTGAGG + Intronic
1188365805 X:29313495-29313517 GGAATTTTAAACTACTCTAATGG - Intronic
1189296036 X:39918504-39918526 GGAATTCCAATGAACACTATTGG - Intergenic
1189460357 X:41237686-41237708 GGGTTTCTAAGTTCCACTAATGG - Intergenic
1191025816 X:55912030-55912052 GTAATTCTAATGTGCAGTAAAGG + Intergenic
1195442398 X:104913559-104913581 GGAATTTTAAGCAACAGTAAAGG + Intronic
1197151539 X:123225419-123225441 GGAATTCCAAGATTCAATAAAGG - Intronic
1198514108 X:137387084-137387106 GGAATTCTCAGAAACACTATAGG + Intergenic
1199292166 X:146117072-146117094 TGAATTCTAACAAACACTAAAGG - Intergenic
1200303589 X:155003044-155003066 GAAATTACAAGGCACACTAAAGG + Intronic