ID: 1068246506

View in Genome Browser
Species Human (GRCh38)
Location 10:54378034-54378056
Sequence ACTAATCTGCAGACTGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 735
Summary {0: 1, 1: 0, 2: 0, 3: 38, 4: 696}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068246506 Original CRISPR ACTAATCTGCAGACTGTGGT GGG (reversed) Intronic
900107620 1:991284-991306 GCTACTCTGCAGGCTGAGGTGGG - Intergenic
900507760 1:3038254-3038276 ACTGATGTGCAGACGGAGGTAGG - Intergenic
901681865 1:10917526-10917548 GCTACTCTGGAGACTGAGGTGGG + Intergenic
901708853 1:11098090-11098112 ACTCATCGCCAAACTGTGGTAGG + Exonic
902026602 1:13388793-13388815 GCTACTCTGCAGACAGAGGTGGG - Intergenic
902403488 1:16170931-16170953 ACTACTCGGGAGACTGAGGTGGG - Intergenic
902522694 1:17029843-17029865 ACTACTCAGGAGGCTGTGGTGGG - Intronic
902575726 1:17376084-17376106 GCTAATCTGGAGGCTGAGGTAGG - Intronic
903444915 1:23416601-23416623 ACTACTCTGGAGGCTGAGGTGGG - Intronic
903581566 1:24374734-24374756 GCTATTCTGGAGACTGAGGTGGG - Intronic
903628349 1:24746875-24746897 ACTACTCTGGAGGCTGCGGTGGG + Intronic
903817011 1:26071563-26071585 ACTACTCAGTAGACTGAGGTGGG + Intergenic
904721853 1:32516145-32516167 GCTACTCTGCAGGCTGAGGTGGG + Intronic
905185071 1:36190412-36190434 ACTATTCGGGAGACTGAGGTAGG - Intergenic
905623572 1:39470532-39470554 ACTACTCTGGAGGCTGAGGTGGG + Intronic
906037747 1:42762972-42762994 GCTACTCTGCAGGCTGAGGTGGG + Intronic
906133299 1:43475519-43475541 GCTACTCTGCAGGCTGAGGTGGG + Intergenic
906358095 1:45125954-45125976 GCTACTCTGAAGACTGAGGTGGG + Intronic
906597929 1:47096303-47096325 GCTACTCTGGAGACTGAGGTGGG + Intronic
906615374 1:47229805-47229827 AATAGTCTTCAGACTCTGGTCGG + Intronic
907101476 1:51841417-51841439 GCTACTCTGGAGACTGAGGTGGG - Intronic
907112554 1:51939532-51939554 GCTATTCTGCAGGCTGAGGTGGG - Intronic
908199270 1:61777817-61777839 ACTACTCGGGAGACTGAGGTAGG - Intronic
908629500 1:66086795-66086817 ACTCAACTACACACTGTGGTAGG - Intronic
908695082 1:66830667-66830689 ACTACTCAGGAGACTGAGGTGGG + Intronic
909288003 1:73845302-73845324 ACTAATCAGGAGACTGAGGTAGG + Intergenic
909303531 1:74043792-74043814 ACTATTCTTCAGACTATGGGTGG - Intronic
909691782 1:78416126-78416148 GCTACTCAGGAGACTGTGGTGGG + Intronic
910417982 1:87021624-87021646 ACTACTCAGGAGACTGAGGTGGG - Intronic
910459836 1:87436989-87437011 GCTACTCTGCAGGCTGTGGTGGG + Intergenic
910787431 1:91015623-91015645 ACTCATCTGCTGACAGTGCTGGG + Intronic
910848765 1:91630139-91630161 GCTACTCTGGAGACTGAGGTGGG + Intergenic
910967222 1:92819596-92819618 ACTACTCTGGAGGCTGAGGTGGG + Intergenic
911058002 1:93724112-93724134 ACTGAGCTGCAGCCTGTGCTTGG + Intronic
911172676 1:94785583-94785605 ACTACTCTGGAGGCTGAGGTGGG - Intergenic
912427947 1:109611120-109611142 ACTACTCAGGAGACTGAGGTGGG - Exonic
913361857 1:117989685-117989707 ACTACTCTGGAGACTGAGGTGGG - Intronic
913476715 1:119245088-119245110 ACTACTCAGGAGGCTGTGGTGGG - Intergenic
913505238 1:119510852-119510874 GCTACTCTGCAGACTGAGGTGGG - Intronic
914264630 1:146027758-146027780 GCTACTCTGGAGACTGAGGTGGG + Intergenic
914385338 1:147164046-147164068 ACTACTCTGAAGGCTGAGGTGGG - Intronic
915045568 1:153011450-153011472 ACCAATCAGCAGAATGTGGGCGG - Intergenic
915080370 1:153347952-153347974 ACCAATCTGGAGAGTGTGGATGG + Exonic
915414886 1:155734043-155734065 GCTACTCTGGAGACTGAGGTGGG + Intronic
915976473 1:160393864-160393886 ACTACTCGGGAGACTGAGGTGGG + Intergenic
916230145 1:162533655-162533677 ACTACTCAGGAGACTGAGGTGGG + Intergenic
916407128 1:164508721-164508743 ACTACTCAGGAGACTGAGGTGGG - Intergenic
917083611 1:171282727-171282749 ACTACTCAGGAGACTGAGGTAGG - Intronic
917896558 1:179494618-179494640 GCTACTCTGGAGACTGAGGTGGG - Intronic
917992318 1:180394203-180394225 ACTACTCTGGAGGCTGTGGTGGG - Intronic
918841670 1:189549203-189549225 ACTACTCTGGAGGCTGAGGTGGG - Intergenic
918994000 1:191732470-191732492 ACTAATCAGCAGGATGTGGGTGG + Intergenic
919270770 1:195341453-195341475 GCTACTCTGGAGACTGAGGTAGG + Intergenic
920412013 1:205769538-205769560 GCTACTCTGGAGACTGAGGTGGG - Exonic
920715571 1:208337197-208337219 ACTACTCAGCAGACTGAGGTGGG - Intergenic
921185612 1:212667073-212667095 ACTACTCAGAAGACTGAGGTGGG - Intergenic
921382031 1:214533723-214533745 AATAATCTGGAGACTGAGGCGGG + Intronic
921619818 1:217313135-217313157 AATTATCTGCAGACGATGGTAGG - Intergenic
922454061 1:225760176-225760198 ACTACTCTGGAGCCTGAGGTGGG + Intergenic
922571148 1:226635330-226635352 ACTACTCGGGAGGCTGTGGTGGG - Intronic
922713633 1:227853149-227853171 GCTACTCTGGAGGCTGTGGTGGG - Intergenic
922854738 1:228765184-228765206 GCTACTCTGGAGACTGAGGTGGG - Intergenic
923351370 1:233109975-233109997 ACTACTCAGGAGACTGAGGTGGG + Intronic
923600049 1:235394822-235394844 ACTACTCAGGAGACTGAGGTGGG - Intronic
923796044 1:237156693-237156715 AGTAATATGTAGAATGTGGTGGG + Intronic
924002122 1:239566024-239566046 ACTACTCTGGAGGCTGAGGTAGG - Intronic
1063016835 10:2086830-2086852 ACTCAGATGCAGACTGTGGGAGG - Intergenic
1063432471 10:6002692-6002714 ACTACTCAGCAGACTGAGGCAGG - Intergenic
1064049347 10:12046707-12046729 ACTACTCGGGAGACTGAGGTAGG + Intergenic
1064378992 10:14823637-14823659 ACTACTCAGGAGACTGAGGTGGG - Intronic
1064533910 10:16338637-16338659 ACTACTCAGAAGACTGAGGTTGG + Intergenic
1064928087 10:20592464-20592486 GCTACTCTGCAGGCTGAGGTAGG - Intergenic
1065038568 10:21665837-21665859 GCTAATCAGGAGACTGAGGTGGG - Intronic
1065207031 10:23366646-23366668 GCTACTCGGCAGGCTGTGGTGGG - Intergenic
1065349083 10:24779398-24779420 ACTACTCAGGAGACTGAGGTGGG + Intergenic
1065389064 10:25163646-25163668 ACCAATCAGCAGGATGTGGTCGG - Intergenic
1065430185 10:25646081-25646103 ACTATTCAGGAGACTGAGGTGGG - Intergenic
1065590495 10:27257448-27257470 ACCAATCTGCAGGATGTGGGTGG + Intergenic
1065651281 10:27894686-27894708 GCTACTCTGGAGACTGAGGTGGG - Intronic
1065721446 10:28631810-28631832 ACTACTCTGGAGGCTGAGGTGGG + Intergenic
1066261677 10:33735386-33735408 GCTACTCTGGAGACTGAGGTGGG - Intergenic
1066278972 10:33896556-33896578 ACTACTCTGGAGGCTGAGGTGGG - Intergenic
1066590449 10:36988845-36988867 ACTAATCAGCAGGATGTGGGTGG - Intergenic
1066598323 10:37076764-37076786 ACTAATCAGCAGGATGTGGGTGG + Intergenic
1066758332 10:38731765-38731787 GCTACTCTGGAGGCTGTGGTGGG + Intergenic
1067055576 10:43048020-43048042 CCTAATCAGGAGACTGAGGTGGG - Intergenic
1067532232 10:47082491-47082513 ACCAATCAGCAGAATGTGGGTGG + Intergenic
1068246506 10:54378034-54378056 ACTAATCTGCAGACTGTGGTGGG - Intronic
1068952839 10:62794468-62794490 GCTACTCTAGAGACTGTGGTGGG + Intergenic
1069012805 10:63393154-63393176 GCTAATCAGGAGACTGAGGTGGG + Intronic
1069133409 10:64733697-64733719 ACTACTCAGGAGACTGAGGTGGG + Intergenic
1069165848 10:65157704-65157726 ACTACTCTGGAGGCTGAGGTGGG - Intergenic
1069483843 10:68808144-68808166 ACTACTCTGGAGGCTGAGGTGGG - Intergenic
1069485444 10:68819670-68819692 ACTACTCTGGAGGCTGAGGTGGG - Intergenic
1069496694 10:68910512-68910534 ACTACTCAGCAGGCTGAGGTAGG - Intronic
1069534583 10:69243606-69243628 ACTCCTCTGGAGACTGAGGTGGG - Intronic
1070502917 10:77088539-77088561 GCTACTCTGGAGGCTGTGGTGGG - Intronic
1070974333 10:80593919-80593941 ACTACTCAGGAGACTGAGGTAGG - Intronic
1071008802 10:80913615-80913637 GCTACTCTGGAGACTGGGGTAGG + Intergenic
1071026106 10:81115254-81115276 ACTACTCTGGAGGCTGAGGTGGG - Intergenic
1072510917 10:96123961-96123983 GCTACTCTGGAGACTGAGGTGGG + Intergenic
1073118290 10:101105716-101105738 GCTACTCTGGAGACTGAGGTGGG + Intronic
1073570567 10:104577683-104577705 ACTACTCAGTAGACTGAGGTGGG - Intergenic
1073759384 10:106613379-106613401 ACTACTCTGCAGTCTGAGGAAGG + Intronic
1074050693 10:109878762-109878784 ACTAATCGGGAGGCTGAGGTGGG + Intronic
1074170764 10:110933684-110933706 ACTACTCTGGAGGCTGAGGTGGG + Intronic
1074218798 10:111415393-111415415 CACACTCTGCAGACTGTGGTGGG + Intergenic
1075634826 10:124023371-124023393 GCTATTCTGGAGACTGAGGTGGG + Intronic
1076030240 10:127151361-127151383 ATTACTCTGCAGACTGTCCTGGG + Intronic
1077065445 11:639141-639163 GCTACTCTGGAGACTGAGGTGGG + Intronic
1078171815 11:8933782-8933804 AGGAATCTGGAGACTTTGGTTGG + Intergenic
1078418293 11:11184218-11184240 AATAATCTGCAAACTATGGTAGG + Intergenic
1078673705 11:13389537-13389559 GCTACTCTGGAGACTGAGGTGGG - Intronic
1078763718 11:14273449-14273471 GCTACTCTGGAGACTGAGGTGGG - Intergenic
1079053340 11:17182949-17182971 GCTACTCTGGAGACTGAGGTGGG - Intronic
1079389280 11:20007066-20007088 ACTACTCTGGAGGCTGAGGTGGG - Intronic
1079663416 11:23071772-23071794 ACTAAACTGCAGACTTTACTTGG - Intergenic
1079756685 11:24273816-24273838 ACCAATCAGCAGGCTGTGGGTGG - Intergenic
1079913361 11:26338465-26338487 ACCAATCAGCAGAATGTGGGAGG + Intronic
1080141594 11:28927689-28927711 ACTACTCTGGAGACTGAGGCAGG - Intergenic
1080499947 11:32861143-32861165 ACTACTCTGGAGGCTGAGGTGGG + Intergenic
1080521030 11:33068026-33068048 GCTACTCAGGAGACTGTGGTAGG - Intronic
1080522868 11:33082891-33082913 GCTACTCTGCAGGCTGTGGTGGG - Intronic
1081106728 11:39079210-39079232 ACCAATCTGCAGGATGTGGGTGG + Intergenic
1082816228 11:57511314-57511336 ACTATTCTGGAGGCTGAGGTGGG + Intronic
1082955949 11:58869994-58870016 GCTAATCCGGAGACTGAGGTGGG + Intronic
1082977038 11:59082891-59082913 GCTAATCAGGAGACTGAGGTGGG + Intergenic
1085577880 11:77623480-77623502 GCTAATCGGGAGACTGGGGTGGG + Intronic
1085647337 11:78234192-78234214 GCTACTCAGCAGGCTGTGGTGGG - Intronic
1085854583 11:80161744-80161766 ACTAATATGGTGACTGAGGTTGG - Intergenic
1085975038 11:81642641-81642663 GCTAGTCAGCAGACTGTGGCAGG - Intergenic
1086368492 11:86132728-86132750 GCTACTCTGGAGACTGAGGTGGG + Intergenic
1086440228 11:86822507-86822529 GCTAATCTGGAGGCTGAGGTGGG + Intronic
1086798244 11:91136332-91136354 ACTACTCTGGAGGCTGTGGTGGG + Intergenic
1087319715 11:96643356-96643378 ACCAATCAGCAGAATGTGGGCGG + Intergenic
1087423075 11:97957126-97957148 AGTACTCTGGAGACTGAGGTGGG - Intergenic
1087754535 11:102041053-102041075 GCTATTCTGGAGACTGAGGTGGG - Intergenic
1088571004 11:111222743-111222765 ACTAATCAGCAGGATGTGGGTGG + Intergenic
1088870479 11:113886314-113886336 ACTACTCGGGAGACTGAGGTGGG - Intergenic
1089632034 11:119789847-119789869 ACTGAGCTGGAGACTGTGGTGGG - Intergenic
1089999609 11:122944083-122944105 ACTAATCAGGAGGCTGAGGTGGG + Intronic
1090062787 11:123478125-123478147 GCTACTCGGAAGACTGTGGTGGG - Intergenic
1090573959 11:128080015-128080037 AGTACTCAGCAGACTGAGGTAGG + Intergenic
1091007851 11:131969925-131969947 GCTACTCTGCAGCCTGAGGTGGG - Intronic
1092058619 12:5528393-5528415 ACTACTCAGGAGACTGAGGTTGG + Intergenic
1092187364 12:6490716-6490738 GCTACTCTGCAGGCTGAGGTGGG - Intergenic
1092336799 12:7640585-7640607 ACCAATCAGCAGGATGTGGTTGG + Intergenic
1092616997 12:10224973-10224995 ACCAATCAGCAGGATGTGGTTGG - Intergenic
1092747865 12:11690477-11690499 GCTACTCTGGAGACTGAGGTGGG + Intronic
1092790575 12:12067437-12067459 ACTACTCTGGAGACTGAGGTGGG + Intronic
1093796861 12:23322553-23322575 GCTACTCTGGAGACTGAGGTGGG - Intergenic
1093827276 12:23709211-23709233 ACTACTCTGGAGGCTGAGGTGGG - Intronic
1094448321 12:30557735-30557757 GCTACTTTGGAGACTGTGGTGGG - Intergenic
1094682854 12:32681437-32681459 GCTACTCTGCAGGCTGAGGTGGG + Intronic
1095414285 12:41959094-41959116 GCTACTCAGGAGACTGTGGTAGG + Intergenic
1095469341 12:42519917-42519939 ACTACTCTGGAGGCTGAGGTGGG - Intronic
1095497128 12:42797003-42797025 GCTACTCTGGAGACTGAGGTGGG - Intergenic
1095534105 12:43225210-43225232 ACTAATCAGCAGGATGTGGGTGG + Intergenic
1095750851 12:45709113-45709135 GCTACTCTGGAGACTGAGGTGGG + Intergenic
1096052503 12:48623630-48623652 GCTACTCTGGAGCCTGTGGTGGG - Intergenic
1097095063 12:56540624-56540646 GCTACTCTGAAGACTGAGGTGGG - Intronic
1098304292 12:69086913-69086935 ACTACTCAGGAGACTGAGGTAGG + Intergenic
1098783210 12:74715035-74715057 GCTACTCTGGAGACTGAGGTGGG - Intergenic
1099307927 12:80981587-80981609 ACTGGTCTGCAGCCTGGGGTTGG - Intronic
1099850056 12:88082580-88082602 GCTACTCTGCAGGCTGAGGTGGG + Intronic
1100073189 12:90746758-90746780 ACCAATCAGCAGAATGTGGTTGG + Intergenic
1100347749 12:93748785-93748807 ACTAATCTGCAGTCTCTTCTGGG + Intronic
1100379225 12:94046272-94046294 GCTACTCAGCAGACTGTGGCAGG - Intergenic
1100485015 12:95016920-95016942 ACTAATCAGGAGGCTGAGGTGGG + Intergenic
1100736471 12:97539811-97539833 ACTAATTTGCACACTGAGGTTGG - Intergenic
1100743411 12:97619772-97619794 ACTACTCGGCAGACTGAGGCAGG + Intergenic
1100865046 12:98848668-98848690 GCTACTCTGGAGACTGAGGTAGG - Intronic
1101113992 12:101514092-101514114 GCTACTCTGGAGACTGAGGTGGG - Intergenic
1101465266 12:104942364-104942386 GCTACTCTGGAGACTGAGGTGGG + Intronic
1102051674 12:109866869-109866891 ACTACTCTGGAGGCTGAGGTGGG - Intronic
1102212486 12:111137623-111137645 ACTACTCTGGAGGCTGAGGTGGG - Intronic
1102580823 12:113886242-113886264 ACTACTCTGGAGGCTGAGGTGGG - Intronic
1102982350 12:117251841-117251863 GCTACTCTGGAGACTGAGGTGGG - Intronic
1102994529 12:117338287-117338309 GCTATTCTGGAGACTGAGGTGGG + Intronic
1103372335 12:120429011-120429033 ATTACTCTGCAGACTGTCGTGGG + Intergenic
1103671936 12:122624378-122624400 GCTACTCTGGAGACTGAGGTAGG - Intronic
1103720014 12:122968724-122968746 ACTACTCGGGAGGCTGTGGTGGG - Intronic
1103833706 12:123801581-123801603 ACTGATCTCCAGGCTGTCGTTGG + Intronic
1104260350 12:127176483-127176505 GCTACTCTGCAGGCTGAGGTGGG + Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1105915482 13:24911646-24911668 GCTACTCTGGAGACTGAGGTGGG - Intronic
1106062892 13:26312231-26312253 ACCAATCAGCAGAATGTGGGTGG + Intronic
1106539694 13:30679173-30679195 GCTACTCGGCAGACTGAGGTAGG + Intergenic
1106541170 13:30691255-30691277 GCTACTCAGGAGACTGTGGTGGG - Intergenic
1107099175 13:36570654-36570676 ACTAATCTGCATTCTGTTGATGG - Intergenic
1107517207 13:41141755-41141777 AGTAAAGTGCAGACTATGGTGGG - Intergenic
1107984056 13:45759760-45759782 GCTAATCAGGAGACTGAGGTGGG - Intergenic
1108210891 13:48138844-48138866 GCTACTCTGGAGACTGAGGTGGG - Intergenic
1108359184 13:49653600-49653622 ACTACTCAGGAGGCTGTGGTGGG + Intergenic
1109152015 13:58858608-58858630 ACCAATCAGCAGAATGTGGGTGG - Intergenic
1109321674 13:60818021-60818043 ACTACTCAGCAGACTGAGGCAGG - Intergenic
1110129391 13:71988449-71988471 ACCTATATTCAGACTGTGGTTGG - Intergenic
1110931741 13:81227029-81227051 ACCAATCAGCAGACTGTGGGTGG - Intergenic
1111010831 13:82312233-82312255 ATGAATCTGTAGACTGTGTTTGG - Intergenic
1111082317 13:83327562-83327584 GCTACTCTGCAGGCTGAGGTAGG + Intergenic
1111901620 13:94206739-94206761 GCTACTCAGCAGGCTGTGGTGGG + Intronic
1112030885 13:95455063-95455085 GCTACTCTGGAGACTGAGGTGGG + Intronic
1112104366 13:96224431-96224453 GCTACTCTGCAGGCTGAGGTAGG - Intronic
1112598009 13:100827299-100827321 ACTACTCTGGAGACTGTGGAGGG + Intergenic
1112601731 13:100862404-100862426 ACTACTCAGGAGACTGAGGTGGG - Intergenic
1112660690 13:101503861-101503883 ACTAAACAGCAGCCTGTGATAGG + Intronic
1115207247 14:30922133-30922155 GCTACTCTGGAGACTGAGGTAGG - Intronic
1115607450 14:35017991-35018013 ACTACTCTGGAGACTGAGGCAGG + Intronic
1115609395 14:35036994-35037016 ACTACTCAGGAGACTGAGGTGGG - Intergenic
1116444644 14:44994528-44994550 ACTAATCGGGAGGCTGAGGTAGG - Intronic
1116883049 14:50191355-50191377 ACTACTCTGAAGGCTGAGGTGGG + Intronic
1117419082 14:55525707-55525729 ACTACTCTGGAGGCTGAGGTGGG - Intergenic
1118414212 14:65516050-65516072 ACTACTCTGGAGGCTGAGGTGGG + Intronic
1118664612 14:68054148-68054170 TCTAGTCTGCAGACTGTATTTGG + Intronic
1118795115 14:69136225-69136247 ACTACTCTGGAGGCTGAGGTAGG - Intronic
1119512933 14:75225984-75226006 GCTACTCAGCAGACTGAGGTGGG + Intergenic
1119938524 14:78615833-78615855 ACTACTCAGGAGACTGAGGTGGG + Intronic
1120282469 14:82456776-82456798 AATAATATGCATACTATGGTGGG + Intergenic
1120429618 14:84398810-84398832 ACCAATCAGCAGAATGTGGGAGG - Intergenic
1120626955 14:86839671-86839693 ACTACTCTGAAGGCTGGGGTAGG + Intergenic
1120868480 14:89316465-89316487 ACTATTCAGGAGACTGAGGTAGG - Intronic
1121341094 14:93105631-93105653 ACTACTCGGCAGGCTGAGGTGGG - Intronic
1121556989 14:94845656-94845678 ACTACTCTTGAGACTGAGGTGGG + Intergenic
1121703039 14:95970600-95970622 GCTAATCTCCAGAGCGTGGTTGG - Intergenic
1122305598 14:100764353-100764375 GCTACTCAGCAGACTGAGGTGGG + Intergenic
1122670304 14:103366637-103366659 GCTACTCTGGAGACTGAGGTGGG + Intergenic
1123904727 15:24910369-24910391 GCTACTCTGCAGGCTGAGGTAGG + Intronic
1124198468 15:27656021-27656043 ACCAATCAGCAGAATGTGGGTGG - Intergenic
1124211380 15:27767742-27767764 ACTAATCAGCAGGATGTGGGTGG + Intronic
1124973093 15:34509362-34509384 ACTACTCTGGAGGCTGAGGTGGG + Intergenic
1125010757 15:34871393-34871415 GCTACTCTGGAGACTGAGGTGGG + Intronic
1125184894 15:36919066-36919088 GCTACTCTGCAGACTGAGGTGGG + Intronic
1125315793 15:38429802-38429824 ACTAATCAGGAGGCTGAGGTGGG + Intergenic
1126144009 15:45460536-45460558 ACTACTCGGGAGACTGAGGTGGG - Intergenic
1127503937 15:59580273-59580295 GCTACTCTGGAGGCTGTGGTTGG - Intergenic
1128963662 15:72035691-72035713 GCTAATCTGGAGGCTGAGGTGGG + Intronic
1129253794 15:74322720-74322742 ACTCAGCTTCAGCCTGTGGTGGG - Intronic
1129404896 15:75309868-75309890 GCTACTCTGGAGACTGAGGTAGG + Intergenic
1129653567 15:77508113-77508135 ACTAATCTGCTCAGTGAGGTTGG + Intergenic
1130110000 15:80956076-80956098 ACTACTCAGCAGGCTGAGGTGGG + Intronic
1130519682 15:84653028-84653050 GCTACTCTGAAGGCTGTGGTGGG - Intronic
1130528537 15:84727601-84727623 GCTACTCTGCAGGCTGAGGTGGG - Intergenic
1130549741 15:84882552-84882574 ACTACTCTGGAGGCTGAGGTGGG + Intergenic
1130864521 15:87920946-87920968 ACTAAACTACAGACTTTGTTTGG - Intronic
1131096528 15:89658336-89658358 ACTACTCTGGAGGCTGAGGTGGG + Intergenic
1131198358 15:90375341-90375363 ACTAATCAGCAGGATGTGGGTGG + Intergenic
1131625825 15:94119533-94119555 AAAAATCTGGAGACTCTGGTAGG + Intergenic
1131767245 15:95691506-95691528 GCTACTCTGGAGACTGCGGTAGG + Intergenic
1131865448 15:96703843-96703865 ACTAATTAGCAGACTGTACTTGG - Intergenic
1132187295 15:99812287-99812309 ACTACTCTGGAGGCTGAGGTGGG - Intergenic
1132428379 15:101740465-101740487 ACTACTCTGGAGGCTGAGGTGGG + Intronic
1132609663 16:809122-809144 GCTACTCTGCAGACTGAGGCAGG - Intronic
1133184819 16:4088401-4088423 ACTACTCTGGAGGCTGAGGTGGG - Intronic
1133191284 16:4135445-4135467 ACTACTCTGCAGGCTGAGGCAGG - Intergenic
1133681650 16:8125607-8125629 GCTACTCGGCAGACTGAGGTGGG - Intergenic
1133964453 16:10520187-10520209 ACTACTCAGCAGGCTGAGGTGGG - Intergenic
1134033980 16:11015576-11015598 GCTCATCTGCTGACTGTGGTGGG + Intronic
1134258337 16:12630105-12630127 ACTACTCCGGAGACTGAGGTAGG + Intergenic
1134321184 16:13165702-13165724 TCTAACCTGCTGACTGTTGTGGG - Intronic
1134393253 16:13839261-13839283 ACTATTTTGCAGACTGGGATGGG - Intergenic
1134409221 16:13989483-13989505 GCTACTCTGGAGACTGAGGTGGG + Intergenic
1134755013 16:16659430-16659452 ACTACTCTGGAGGCTGTGGTGGG - Intergenic
1134991050 16:18699743-18699765 ACTACTCTGGAGGCTGTGGTGGG + Intergenic
1135085422 16:19471200-19471222 ACTACTCAGCAGGCTGAGGTGGG - Intronic
1135338905 16:21629788-21629810 ACCAATCAGCAGGCTGTGGGTGG - Intronic
1135528201 16:23229957-23229979 ACTACTCTGCAGGCTGAGGTGGG - Intergenic
1136125469 16:28176607-28176629 GCTACTCTGGAGGCTGTGGTAGG - Intronic
1136158505 16:28402205-28402227 ACTACTCTGGAGGCTGAGGTGGG - Intronic
1136204582 16:28713078-28713100 ACTACTCTGGAGGCTGAGGTGGG + Intronic
1136719465 16:32309028-32309050 GCTACTCTGGAGACTGAGGTGGG - Intergenic
1136724494 16:32347430-32347452 GCTACTCTGGAGACTGAGGTGGG - Intergenic
1136842821 16:33553470-33553492 GCTACTCTGGAGACTGAGGTGGG - Intergenic
1138564464 16:57822852-57822874 AATAATCTACAGACTGTATTGGG - Intronic
1139174414 16:64670168-64670190 ACTACTCAGGAGACTGAGGTGGG + Intergenic
1139300561 16:65942087-65942109 ACTACTCTGGAGGCTGAGGTGGG + Intergenic
1139662408 16:68430048-68430070 CCAAATCTGCAGAGTGGGGTTGG + Intronic
1139817572 16:69687866-69687888 ACTACTCAGGAGACTGAGGTGGG + Intronic
1139822938 16:69735145-69735167 GCTACTCTGGAGACTGAGGTAGG - Intergenic
1139825172 16:69751417-69751439 ACTAATCAGGAGGCTGAGGTGGG + Intronic
1140240352 16:73194309-73194331 GCTACTCTGGAGGCTGTGGTGGG - Intergenic
1141099431 16:81186223-81186245 GCAAATCTGCAGGATGTGGTTGG + Intergenic
1141211379 16:81983490-81983512 ACGAATCTGCAGACTGCTTTGGG - Intergenic
1203001936 16_KI270728v1_random:170325-170347 GCTACTCTGGAGACTGAGGTGGG + Intergenic
1203006966 16_KI270728v1_random:208741-208763 GCTACTCTGGAGACTGAGGTGGG + Intergenic
1203133540 16_KI270728v1_random:1706731-1706753 GCTACTCTGGAGACTGAGGTGGG + Intergenic
1203152986 16_KI270728v1_random:1853768-1853790 GCTACTCTGGAGACTGAGGTGGG - Intergenic
1143360827 17:6369245-6369267 ACTACTCAGGAGACTGAGGTGGG - Intergenic
1143802405 17:9394962-9394984 ACTACTCGGCAGGCTGAGGTAGG + Intronic
1143815697 17:9512572-9512594 ACTACTCAGGAGACTGAGGTGGG - Intronic
1143817545 17:9529866-9529888 ACTACTCTGGAGACTGAGGTGGG + Intronic
1145838239 17:27971042-27971064 ACTACTCGGAAGACTGAGGTAGG + Intergenic
1146028996 17:29347927-29347949 GCTACTCAGGAGACTGTGGTGGG + Intergenic
1146116285 17:30142435-30142457 ACTACTCTGGAGACTGAGATGGG - Intronic
1146319142 17:31832904-31832926 ACCAATCAGCAGAATGTGGGCGG - Intergenic
1146642018 17:34548775-34548797 ACTACTCTGGAGGCTGAGGTGGG + Intergenic
1146883947 17:36458508-36458530 GCTACTCTGGAGGCTGTGGTGGG + Intergenic
1147666399 17:42151323-42151345 ACTACTCTGGAGGCTGAGGTAGG + Intronic
1147752973 17:42748347-42748369 ACTACTCAGGAGACTGAGGTGGG + Intergenic
1147770588 17:42865437-42865459 ACTACTCTGCAGGCTGAGGCAGG + Intergenic
1148520341 17:48268601-48268623 ACTACTCTGGAGGCTGAGGTAGG - Intronic
1148713915 17:49701979-49702001 ACTACTCGGGAGGCTGTGGTGGG + Intronic
1149913175 17:60584728-60584750 ACTACTCAGCAGGCTGAGGTGGG + Intronic
1149933806 17:60783314-60783336 GCTACTCAGCAGACTGAGGTGGG - Intronic
1150058888 17:62046965-62046987 GCTACTCTGAAGACTGAGGTGGG - Intronic
1150297277 17:64019271-64019293 ACTAATCAGGAGGCTGAGGTGGG + Intronic
1151640235 17:75387047-75387069 ACTAATCGGGAGGCTGAGGTAGG + Intronic
1152550006 17:81024647-81024669 ACTACTCAGGAGACTGAGGTGGG + Intergenic
1154484392 18:14861694-14861716 ACTAATCTGCTTACTGCTGTCGG - Intergenic
1154956855 18:21267043-21267065 GCTAGTCAGCAGACTGAGGTAGG - Intronic
1155294806 18:24375201-24375223 ACTACTCTGGAGGCTGAGGTGGG + Intronic
1155403240 18:25461169-25461191 GCTAATCTGTAGGCTGAGGTGGG + Intergenic
1155749835 18:29408110-29408132 ACTACTCAGGAGACTGAGGTGGG - Intergenic
1156079620 18:33317028-33317050 ACTAATCAGCAGGATGTGGATGG + Intronic
1156310215 18:35915389-35915411 ACTATTCTGAAGACTGAGGCAGG + Intergenic
1156576645 18:38324634-38324656 ACTGATCCTAAGACTGTGGTTGG + Intergenic
1156863403 18:41863889-41863911 ACTCATCTGCAGCATGTGGCAGG + Intergenic
1157525445 18:48376941-48376963 AGAAATATGGAGACTGTGGTGGG - Intronic
1157577072 18:48750554-48750576 AGGAACCAGCAGACTGTGGTGGG + Intronic
1158580362 18:58675501-58675523 GCTACTCTGCAGGCTGAGGTGGG + Intronic
1158590893 18:58777990-58778012 ACTAAACTGCAGACTTTATTCGG - Intergenic
1158742228 18:60156089-60156111 GCTAATCTGGAGTCTGAGGTAGG + Intergenic
1159171475 18:64774359-64774381 ACTACACTGAAGACTGAGGTGGG - Intergenic
1159472800 18:68879429-68879451 ACCAATCAGCAGAATGTGGGTGG - Intronic
1161088651 19:2346553-2346575 GCTACTCTGCAGGCTGAGGTGGG + Intronic
1161432277 19:4239727-4239749 GCTAATCAGGAGACTGAGGTGGG + Intergenic
1161918681 19:7250045-7250067 ACTACTCTGGAGGCTGAGGTGGG + Intronic
1162006727 19:7785806-7785828 GCTACTCTGAAGACTGAGGTGGG - Intergenic
1162328893 19:10014860-10014882 ACTAAGGTGCAGACTGTGAAAGG + Intronic
1163341950 19:16714232-16714254 ACTACTCTGGAGGCTGAGGTGGG + Intergenic
1163626819 19:18394965-18394987 ACTACTCTGGAGACTGAGGCAGG + Intronic
1163684517 19:18703353-18703375 ACTAGACTCCAGACTGTGTTTGG + Intronic
1164310600 19:24042319-24042341 ACCAATCTGCAGGATGTGGGTGG + Intronic
1165720637 19:38077115-38077137 ACTCATCTGCTGCCTCTGGTTGG - Intronic
1166056275 19:40291302-40291324 ACTACTCTGGAGTCTGAGGTGGG - Intergenic
1166170099 19:41022221-41022243 ACTAATCAGGAGGCTGAGGTGGG - Intergenic
1167084934 19:47302958-47302980 GCTACTCTGGAGACTGAGGTGGG - Intronic
1167136576 19:47619782-47619804 TCTAATCTGGAGGCTGAGGTAGG + Intronic
1167247246 19:48380961-48380983 GCTATTCTGCAGGCTGAGGTAGG + Intergenic
1167416053 19:49373189-49373211 GCTACTCTGGAGGCTGTGGTGGG + Intronic
1167781065 19:51599222-51599244 ACCAATCAGCAGAATGTGGGTGG + Intergenic
1167896504 19:52586151-52586173 GCTACTCTGCAGGCTGAGGTGGG - Exonic
1168036171 19:53721440-53721462 ACTATTCGGCAGGCTGAGGTGGG - Intergenic
1168651401 19:58094764-58094786 GCTACTCTGGAGACTGAGGTTGG + Intronic
925701333 2:6641378-6641400 GCTACTCTGGAGACTGAGGTAGG + Intergenic
926191956 2:10734971-10734993 ACTACTCAGGAGGCTGTGGTGGG + Intronic
926468739 2:13226328-13226350 ACTAATCAGGAGATTGTGCTAGG + Intergenic
927126585 2:20017390-20017412 ACTACTCGGGAGACTGAGGTAGG + Intergenic
927777934 2:25916396-25916418 ACCAATCAGCAGGATGTGGTGGG + Intergenic
928563838 2:32521578-32521600 GCTACTCTGCAGACTGAGGCAGG - Intronic
928637451 2:33262302-33262324 TTTAATCTGCAAACTGTGGCTGG + Intronic
929198422 2:39210097-39210119 ACTACTCAGCAGGCTGAGGTGGG - Intronic
929527659 2:42720834-42720856 ACTACTCAGGAGACTGAGGTGGG + Intronic
929691781 2:44080821-44080843 ACTACTCTGGAGGCTGAGGTGGG + Intergenic
929854877 2:45628516-45628538 ACTACTCTGGAGGCTGGGGTGGG - Intergenic
930031381 2:47060044-47060066 GCTACTCTGGAGACTGAGGTAGG + Intronic
930184305 2:48396353-48396375 ACTACTCAGGAGACTGAGGTGGG - Intergenic
930696170 2:54413854-54413876 ACTAATCGGGAGACTGAGGCAGG + Intergenic
931334339 2:61323569-61323591 GCTACTCTGGAGACTGAGGTGGG + Intronic
931358195 2:61555345-61555367 GCTAATCGGCAGGCTGAGGTGGG + Intergenic
932167403 2:69520828-69520850 ACAAACCTGCAGCCTGAGGTGGG + Exonic
932173640 2:69579465-69579487 ACTACTCAGGAGACTGAGGTGGG + Intronic
932178408 2:69622951-69622973 ACCAATCAGCAGAATGTGGGTGG + Intronic
932724707 2:74169388-74169410 GCTACTCTGGAGACTGAGGTGGG + Intronic
932777219 2:74535582-74535604 ACTCACCTGCAGGCCGTGGTTGG + Exonic
933911487 2:86944512-86944534 ACTACTCGGGAGACTGAGGTGGG - Intronic
934776761 2:96943833-96943855 ACTGATCTGCAGCCTTTGGGCGG - Intronic
934898617 2:98139769-98139791 ACCAATCAGCAGAATGTGGGTGG + Intronic
935087080 2:99858437-99858459 GCTACTCTGGAGACTGAGGTGGG + Intronic
935247722 2:101233658-101233680 ACTACTCTGGAGGCTGAGGTAGG + Intronic
935991358 2:108721550-108721572 ACTACTCGGGAGACTGAGGTGGG - Intronic
936384538 2:112017120-112017142 ACTAATCAGCAGGATGTGGGTGG - Intronic
936427068 2:112431144-112431166 ACTACTCGGGAGACTGAGGTGGG + Intronic
936582209 2:113710662-113710684 ACTACTCAGGAGACTGAGGTGGG + Intronic
936866543 2:117081415-117081437 ACTACTCAGGAGACTGAGGTGGG - Intergenic
938004052 2:127773022-127773044 ACTACTCAGGAGACTGAGGTGGG + Intronic
939851503 2:147311439-147311461 ACCAATCTGCAGGATGTGGTGGG + Intergenic
940948639 2:159646736-159646758 ACCAATCTGCAGCCAGGGGTTGG + Intergenic
940957243 2:159741255-159741277 GCTACTCTGGAGACTGAGGTGGG + Intronic
941254866 2:163216386-163216408 GCTACTCTGGAGACTGAGGTAGG - Intergenic
941408920 2:165127998-165128020 AATAATCTGCAGATTGCAGTAGG - Exonic
941502822 2:166301324-166301346 ATAAATCAGCAGGCTGTGGTTGG - Intronic
941536905 2:166734870-166734892 AGTTATCTGCAGATTGTGGTAGG - Intergenic
942902254 2:181135253-181135275 GCTACTCTGGAGGCTGTGGTAGG - Intergenic
943121169 2:183737840-183737862 ACTACTCAGGAGACTGAGGTGGG + Intergenic
943608740 2:190007165-190007187 AATAATCTTCAAACTGGGGTAGG + Intronic
944225284 2:197343463-197343485 ACTACTCAGGAGACTGAGGTGGG - Intergenic
944237176 2:197451110-197451132 ACCAATCAGCAGGCTGTGGGTGG + Intergenic
944350771 2:198724322-198724344 ACTACTCGGGAGACTGAGGTGGG + Intergenic
945664089 2:212720506-212720528 ACCAATCAGCAGAATGTGGGTGG - Intergenic
946243975 2:218375000-218375022 GCTACTCTGGAGGCTGTGGTGGG - Intergenic
948105605 2:235411418-235411440 ACTACTCTGGAGGCTGAGGTGGG + Intergenic
948739101 2:240031171-240031193 AATAATCTGGAGTCTGTGCTGGG + Intergenic
1168950594 20:1798159-1798181 CCTATTCAGGAGACTGTGGTAGG + Intergenic
1170541995 20:17398410-17398432 GCTACTCTGGAGACTGAGGTGGG + Intronic
1170884749 20:20330445-20330467 ACTACTCAGGAGACTGAGGTGGG - Intronic
1170966817 20:21080884-21080906 ACTACTCAGGAGACTGAGGTGGG + Intergenic
1171318713 20:24220198-24220220 ACCAATCTGCAGGATGTGGGTGG - Intergenic
1172140102 20:32716680-32716702 GCTACTCAGCAGACTGAGGTGGG + Intronic
1172142338 20:32732194-32732216 GCTACTCAGCAGACTGAGGTGGG - Intronic
1172320563 20:33993140-33993162 TCAAATCTGCAGGCTGTGGGCGG - Intergenic
1172432447 20:34903788-34903810 ACTACTCTGGAGGCTGAGGTGGG + Intronic
1172504229 20:35449386-35449408 ACTATTCTGGAGGCTGAGGTAGG - Intronic
1172802701 20:37589151-37589173 ACTACTCTGGAGGCTGAGGTGGG - Intergenic
1173364060 20:42369207-42369229 ATTACTCTGGAGACTGAGGTGGG - Intronic
1173490489 20:43475860-43475882 GCTACTCAGCAGACTGAGGTGGG + Intergenic
1173519638 20:43689663-43689685 ACTACTCTGCAGACAGGTGTGGG - Intronic
1174022432 20:47541488-47541510 ACTACTCAGGAGACTGAGGTGGG - Intronic
1176796934 21:13377773-13377795 ACTAATCTGCTTACTGCTGTCGG + Intergenic
1177221375 21:18197502-18197524 ACTAATCTGGAGGCTGCAGTGGG + Intronic
1177497609 21:21910005-21910027 ACCAATCAGCAGAATGTGGGTGG - Intergenic
1177565231 21:22811431-22811453 ACTATTCTGCAGGCTGAGGTGGG + Intergenic
1178633637 21:34283556-34283578 ACTAATCTGCAGATCGCTGTCGG + Intergenic
1178661050 21:34508136-34508158 GCTAATCTGGAGGCTGAGGTGGG - Intergenic
1179187802 21:39097987-39098009 AGTGACCTGCAGGCTGTGGTTGG - Intergenic
1180304291 22:11061762-11061784 ACTAATCTGCTTACTGCTGTCGG - Intergenic
1180658046 22:17441058-17441080 ACTACTCTGGAGGCTGTGGCAGG - Intronic
1180801283 22:18633225-18633247 TCTACTCAGCAGACTGAGGTGGG + Intergenic
1180906502 22:19416433-19416455 ACTACTCAGGAGACTGAGGTGGG - Intronic
1181220438 22:21362036-21362058 TCTACTCAGCAGACTGAGGTGGG - Intergenic
1181948826 22:26539655-26539677 ACTACTCGGGAGACTGAGGTGGG + Intronic
1182128099 22:27830896-27830918 GCTACTCTGCAGGCTGAGGTGGG - Intergenic
1182266477 22:29119773-29119795 ACTAATATGCTCAGTGTGGTGGG + Intronic
1182860219 22:33553402-33553424 ACTACTCTGGAAACTGAGGTGGG + Intronic
1182924197 22:34107385-34107407 ACTACTCTGGAGACTGAGGGAGG - Intergenic
1183065987 22:35363149-35363171 GCTACTCAGGAGACTGTGGTGGG - Intergenic
1183496273 22:38146145-38146167 GCTACTCTGGAGACTGAGGTAGG - Intronic
1183512419 22:38243902-38243924 AGGGAGCTGCAGACTGTGGTGGG + Intronic
1183964801 22:41435247-41435269 ACTGGTTTGCAGACTGTGGAAGG - Exonic
1184135420 22:42546361-42546383 ACTACTCTGGAGACCGAGGTGGG + Intergenic
1184480289 22:44742821-44742843 ACTACTCTGGAGGCTGAGGTGGG - Intronic
1184709077 22:46237484-46237506 GCTACTCTGCAGGCTGAGGTGGG + Exonic
1184869650 22:47227444-47227466 ACTACTCAGGAGACTGAGGTGGG - Intergenic
1185183187 22:49375479-49375501 GCTACTCTGCAGACTGAGGTGGG - Intergenic
949666950 3:6350096-6350118 AGCAAGCTGCAGTCTGTGGTGGG - Intergenic
949902653 3:8831060-8831082 ACTACTCTGGAGGCTGAGGTGGG + Intronic
949958138 3:9287101-9287123 ACTAATCAGGAGGCTGAGGTAGG - Intronic
950054988 3:10017290-10017312 GCTACTCAGCAGGCTGTGGTGGG - Intergenic
950297045 3:11841192-11841214 GCTACTCTGGAGACTGAGGTGGG - Intronic
950501711 3:13368185-13368207 ACTAATCAGGAGGCTGAGGTAGG - Intronic
951079629 3:18437727-18437749 AGTGATCTCCAGACTGTGGGAGG - Intronic
951245789 3:20340293-20340315 ACCAATCTTTAGAATGTGGTAGG + Intergenic
951280897 3:20748137-20748159 ACTGATGTGGAGACTGTGGAAGG + Intergenic
951733016 3:25831783-25831805 ACAAATTTTCAGACTGTGCTTGG + Intergenic
951882526 3:27493085-27493107 GCTACTCTGCAGGCTGAGGTAGG + Intergenic
952376838 3:32774804-32774826 ACTATTCTGGAGGCTGAGGTGGG + Intergenic
952814983 3:37439410-37439432 ATTACTCTGGAGACTGAGGTTGG + Intergenic
952817931 3:37461898-37461920 ACTTATCTGGAGCCTGGGGTGGG - Intronic
953003007 3:38951877-38951899 ACCAATCAGCAGAATGTGGGTGG + Intergenic
953318866 3:41954246-41954268 GCTACTCTGGAGACTGAGGTGGG + Intronic
953673957 3:44985782-44985804 ACCAATCAGCAGAATGTGGGTGG - Intronic
954293307 3:49661030-49661052 AGTATTCTGCAGGCAGTGGTGGG + Exonic
956054208 3:65281143-65281165 ACTATTCTGTACTCTGTGGTAGG - Intergenic
956565363 3:70631096-70631118 ACTACTCGGGAGACTGAGGTAGG + Intergenic
956963017 3:74424839-74424861 ACTTACCTCCAGAGTGTGGTGGG + Exonic
957663143 3:83186704-83186726 GCTACTCTGGAGACTGAGGTGGG - Intergenic
957683398 3:83469463-83469485 ACTAATCAGGAGACTGAAGTGGG + Intergenic
957695116 3:83626166-83626188 ACTACTCTGGAGACTGAGGCAGG + Intergenic
957829913 3:85504479-85504501 ACCAATCAGCAGGATGTGGTGGG - Intronic
958838996 3:99180472-99180494 ACTATTCTGGAGGCTGAGGTGGG - Intergenic
959969014 3:112387383-112387405 ACTACTCTGCAGGCTGAGGCAGG + Intergenic
960511842 3:118558697-118558719 AATAATATGCATACTGTAGTGGG - Intergenic
960799450 3:121523125-121523147 ACTAACCAGGAGACTGAGGTAGG - Intronic
960868449 3:122226553-122226575 ACTAATCAGCAGGATGTGGGTGG - Intronic
961028062 3:123578380-123578402 GCTAATCAGGAGACTGAGGTGGG - Intronic
961375938 3:126465837-126465859 GCTACTCTGGAGACTGGGGTGGG + Intronic
962003836 3:131328176-131328198 GCTATTCTACAGACTGAGGTGGG + Intronic
962380064 3:134891219-134891241 GCTACTCTGGAGACTGAGGTAGG - Intronic
962582549 3:136811417-136811439 ACTACTCTGGAGGCTGAGGTGGG + Intergenic
962780062 3:138705862-138705884 GCTACTCTGGAGACTGAGGTAGG - Intronic
963084736 3:141426483-141426505 GCTAATCTGGAGACGGTGCTGGG - Intronic
963312484 3:143723854-143723876 GTTAATCTGCAGATTCTGGTTGG - Intronic
964654388 3:159050842-159050864 ACTACTCAGCAGGCTGAGGTGGG + Intronic
965125802 3:164627719-164627741 ACTACTCTGGAGACTGAGGTGGG - Intergenic
965349770 3:167598191-167598213 GCTACTCTGGAGACTGAGGTAGG + Intronic
965575606 3:170214726-170214748 ACTACTCAGGAGGCTGTGGTGGG + Intergenic
965689503 3:171340499-171340521 ACAAATCTACAGACTGAAGTAGG + Intronic
965694432 3:171392626-171392648 AATAATCAGCAGGGTGTGGTGGG + Intronic
965728701 3:171746789-171746811 ACGAATCAGCAGAATGTGGGTGG + Intronic
966125595 3:176572591-176572613 GCTACTCAGCAGACTGAGGTGGG + Intergenic
966480564 3:180403936-180403958 AGTTATCTGCAGAGGGTGGTAGG - Intergenic
967126840 3:186431727-186431749 GCTATTCAGGAGACTGTGGTGGG - Intergenic
967233989 3:187367262-187367284 ACCAATCTGCAGGATGTGGGTGG - Intergenic
969369775 4:6724232-6724254 CCTCATCTGGAGACTGTGATGGG + Intergenic
969547018 4:7836556-7836578 GCTACTCTGGAGACTGAGGTGGG - Intronic
970407892 4:15780994-15781016 GCTACTCTGGAGACTGAGGTGGG + Intronic
970415207 4:15850185-15850207 GCTACTCTGGAGACTGAGGTGGG + Exonic
971030865 4:22635339-22635361 ACCAATCAGCAGAATGTGGGTGG + Intergenic
971083878 4:23247600-23247622 ACTACTCAGCAGGCTGAGGTAGG - Intergenic
971315771 4:25566703-25566725 ACTGCATTGCAGACTGTGGTGGG - Intergenic
971476715 4:27079622-27079644 GCTACTCAGGAGACTGTGGTGGG - Intergenic
971796300 4:31233274-31233296 GCTACTCTGCAGGCTGAGGTAGG - Intergenic
972035431 4:34514005-34514027 ACCAATCAGCAGAATGTGGGTGG + Intergenic
972069013 4:34991418-34991440 ACTACTTGGGAGACTGTGGTGGG + Intergenic
972153533 4:36126947-36126969 GCTATTCTGAAGACTGAGGTGGG - Intronic
972491538 4:39592082-39592104 GCTACTCTGGAGACTGAGGTGGG + Intronic
973290567 4:48466194-48466216 GCTAATCTGGAGGCTGAGGTGGG + Intergenic
974664493 4:64940242-64940264 ACTACTCAGGAGACTGAGGTGGG - Intergenic
974898384 4:67967573-67967595 CACACTCTGCAGACTGTGGTGGG - Intergenic
976143485 4:82018109-82018131 ACTACTCTGGAGGCTGAGGTGGG - Intronic
976423386 4:84871744-84871766 ACTACTCAGAAGACTGAGGTGGG - Intronic
976690474 4:87863121-87863143 ACTAATCAGCAGGATGTGGGTGG - Intergenic
976736156 4:88312491-88312513 ACTAATCAGCAGGATGTGGGTGG - Intergenic
977311391 4:95391943-95391965 GCTACTCTGAAGACTGAGGTGGG + Intronic
977599924 4:98925009-98925031 ACTAATTTGCATAGTCTGGTTGG + Intronic
978096212 4:104781908-104781930 ACTAATCTACTGAGTGTGGTGGG + Intergenic
978207067 4:106091847-106091869 ACCAATCAGCAGGATGTGGTTGG - Intronic
979236994 4:118412208-118412230 AATAATCTGCAAACTGTGAAAGG + Intergenic
979534623 4:121805915-121805937 ACTACTCAGGAGACTGAGGTGGG - Intronic
980038640 4:127913911-127913933 ACTACTCTGGAGGCTGAGGTGGG - Intergenic
980115319 4:128673371-128673393 ACCAATCAGCAGAATGTGGGTGG + Intergenic
980563114 4:134502428-134502450 ACCAATCAGCAGAATGTGGGTGG + Intergenic
981596072 4:146424161-146424183 ACTACTCTGGAGGCTGAGGTGGG - Intronic
981709366 4:147693713-147693735 GCTACTCTGGAGACTGAGGTAGG - Intergenic
982560028 4:156918456-156918478 ACCAGTCTGCAGCCAGTGGTTGG - Intronic
982844636 4:160234434-160234456 GCTGTTCTGCAGGCTGTGGTGGG - Intergenic
983015882 4:162611361-162611383 ATTACTTTGCAGACTTTGGTAGG + Intergenic
983139200 4:164126940-164126962 GCTAATCTGGAGGCTGAGGTGGG + Intronic
983360936 4:166722326-166722348 ACTACTCGGGAGGCTGTGGTGGG - Intergenic
983405895 4:167329375-167329397 GCTAATCTGGAGACTGAGGTGGG + Intergenic
983425822 4:167582261-167582283 ACCAATCAGCAGGCTGTGGGTGG + Intergenic
983629934 4:169839939-169839961 GCTACTCTGGAGACTGAGGTGGG - Intergenic
983706010 4:170660245-170660267 GCTACTCTGCAGGCTGAGGTGGG - Intergenic
983802787 4:171956112-171956134 GCTACTCTGGAGACTGTGGCGGG - Intronic
984453218 4:179930432-179930454 ACTACTCAGCAGGCTGAGGTGGG + Intergenic
984643678 4:182198214-182198236 TCTAATCTGCAGAATGTGTAGGG - Intronic
984728797 4:183046175-183046197 ACTAATCAGCAGGATGTGGGTGG + Intergenic
985076018 4:186215683-186215705 GCTACTCAGCAGACTGAGGTGGG - Intronic
985980900 5:3462323-3462345 AAAATTCTGCAGGCTGTGGTAGG + Intergenic
986477341 5:8148716-8148738 ACTACTCTGGAGGCTGAGGTGGG + Intergenic
987089843 5:14500774-14500796 ACTACTCTGGAGGCTGAGGTGGG + Intronic
987334770 5:16889059-16889081 ACTACTCAGCAGGCTGAGGTGGG + Intronic
987355974 5:17063101-17063123 ACCAATCAGCAGAATGTGGGTGG + Intergenic
988583071 5:32485294-32485316 ACTACTCAGGAGACTGAGGTGGG - Intergenic
989661426 5:43802486-43802508 ACTAACCTGCAGAATGAGGAAGG + Intergenic
990207839 5:53449278-53449300 GCTACTCTGAAGACTGAGGTGGG + Intergenic
990238276 5:53791242-53791264 GCTACTCTGGAGACTGAGGTGGG + Intergenic
990243371 5:53837799-53837821 ACCAATCAGCAGAATGTGGGTGG + Intergenic
990348861 5:54895845-54895867 GCTACTCTGCAGGCTGAGGTGGG - Intergenic
990476072 5:56162783-56162805 ACTACTCTGAAGACTGAGGCAGG - Intronic
991460384 5:66852257-66852279 GCTACTCAGCAGGCTGTGGTGGG - Intronic
992138567 5:73772488-73772510 GCTAATCAGCAGGCTGAGGTGGG - Intronic
992850966 5:80807078-80807100 ACTACTCTGGAGACTGTGGCAGG + Intronic
993770407 5:91918005-91918027 ACCAATCAGCAGAATGTGGGTGG + Intergenic
995010951 5:107256719-107256741 AAAAATCTGCAGGCTGTGTTCGG - Intergenic
995111126 5:108429349-108429371 ACTACTCAGGAGACTGAGGTGGG + Intergenic
996991783 5:129642620-129642642 TCTAATTTGCATACTGTGATGGG + Intronic
997319426 5:132965037-132965059 CCTACTCTGGAGACTGAGGTGGG + Intergenic
997452733 5:133996449-133996471 AGTATTATGCAGACTGTGCTGGG - Intronic
999788472 5:154913887-154913909 ACTACTCAGGAGACTGAGGTGGG + Intronic
999973453 5:156888187-156888209 GCTACTCTGGAGACTGAGGTGGG + Intergenic
1000055975 5:157606526-157606548 GCTACTCAGCAGACTGAGGTGGG + Intergenic
1001622418 5:173099265-173099287 ACTACTCAGGAGACTGAGGTGGG - Intronic
1002203034 5:177541874-177541896 AGTAATCTGGAGATTGTGGGAGG - Intronic
1002908058 6:1466967-1466989 GCTACTCTGGAGACTGAGGTGGG + Intergenic
1004013977 6:11715752-11715774 ACTAGTCAGGAGACTGAGGTTGG - Intronic
1004141770 6:13024698-13024720 ACTATTAAGCAGCCTGTGGTCGG + Intronic
1004254948 6:14054871-14054893 AGTGATATGCAGACAGTGGTGGG - Intergenic
1004694216 6:18019261-18019283 ACCAATCAGCAGAATGTGGGTGG - Intergenic
1004914544 6:20319634-20319656 ACTAATCAGCAGGATGTGGGTGG + Intergenic
1005751192 6:28884751-28884773 ACCAATCAGCAGAATGTGGGTGG - Intergenic
1005756088 6:28925981-28926003 ACTACTCTGGAGACTGAGGCTGG + Intergenic
1005782638 6:29208720-29208742 GCTACTCTGAAGACTGAGGTGGG + Intergenic
1005851440 6:29825988-29826010 GCTACTCTGAAGACTGAGGTAGG + Intergenic
1005927348 6:30454364-30454386 ACTAAACTGCAGACTTTATTTGG + Intergenic
1005930876 6:30482744-30482766 ACTAAACTGCAGACTTTATTTGG + Intergenic
1006782962 6:36644530-36644552 GCTAGTCGGCAGACTGAGGTGGG - Intergenic
1007467402 6:42063865-42063887 GCTACTCTGCAGGCTGAGGTGGG - Intronic
1007734378 6:43971646-43971668 ACTACTCTGGAGGCTGAGGTGGG - Intergenic
1008038927 6:46775484-46775506 ACTAATCAGCAGGATGTGGGTGG + Intergenic
1008242715 6:49131316-49131338 ACCAATTAGGAGACTGTGGTAGG + Intergenic
1008587405 6:52962145-52962167 ACCAATCAGCAGAATGTGGGTGG - Intergenic
1008704497 6:54141824-54141846 ACTAATCTTCAGACTGTCTTCGG - Intronic
1009774729 6:68191690-68191712 ACTACTCTGGAGGCTTTGGTGGG + Intergenic
1010086739 6:71928107-71928129 ACTTTTCTGCAGAATGTGATTGG - Intronic
1010214999 6:73393704-73393726 ACTATTCGGGAGGCTGTGGTGGG + Intronic
1010496034 6:76534357-76534379 ACTAATATCTAGACTGTGCTAGG - Intergenic
1010969086 6:82245443-82245465 ACTACTCTGGAGGCTGAGGTGGG + Intronic
1011035331 6:82967887-82967909 CCTATTCTGGAGACTGAGGTGGG - Intronic
1011439698 6:87374415-87374437 GCTACTCTGGAGACTGGGGTGGG + Intronic
1011464876 6:87644735-87644757 GCTACTCTGGAGACTGAGGTGGG + Intronic
1011503619 6:88017505-88017527 ACTAATATGCATAATGTGTTTGG + Intergenic
1011582868 6:88889865-88889887 ACTATTCAGGAGACTGAGGTGGG + Intronic
1011648236 6:89481057-89481079 CCTAAACTGCAGACCATGGTGGG - Intronic
1011665089 6:89625843-89625865 GCTACTCAGCAGACTGAGGTGGG - Intronic
1012113755 6:95267078-95267100 ACTAATGTGAGGACTGAGGTAGG + Intergenic
1012189201 6:96260419-96260441 ACCAATCAGCAGAATGTGGGTGG - Intergenic
1012282368 6:97344023-97344045 ACTACTCTGGAGACTGAGGCAGG + Intergenic
1012777697 6:103519317-103519339 TATAATATGAAGACTGTGGTGGG - Intergenic
1013290496 6:108715242-108715264 ACTACTCTGGAGGCTGAGGTGGG - Intergenic
1013292400 6:108730657-108730679 GCTACTCTGCAGACTGCTGTGGG - Intergenic
1013595933 6:111661174-111661196 GCTAATGTGGAGACTGTGGCCGG - Exonic
1014037240 6:116781113-116781135 ACTACTCTGGAGTCTGAGGTGGG - Intergenic
1015393800 6:132713021-132713043 GCTACTCTGGAGACTGTAGTGGG + Intronic
1015822668 6:137280654-137280676 GCTACTCTGGAGGCTGTGGTGGG - Intergenic
1016149513 6:140722145-140722167 ACTACTCAGGAGACTGAGGTGGG - Intergenic
1016486633 6:144546695-144546717 ACTAATCAGGAGGCAGTGGTGGG + Intronic
1016859832 6:148706381-148706403 CTTCATCTGCAGACTGTGCTGGG + Intergenic
1017100920 6:150849272-150849294 ACCAATCAGCAGGATGTGGTGGG + Intergenic
1017110776 6:150930155-150930177 ATTACTCTGGAGACTGTGGGTGG + Intronic
1017490420 6:154940058-154940080 ACTACTCCGGAGACTGAGGTGGG + Intronic
1019582740 7:1774803-1774825 GCTACTCTGCAGACTGAGGCAGG + Intergenic
1019809610 7:3155393-3155415 ACTATTCTGGAGGCTGAGGTGGG + Intronic
1019974590 7:4570540-4570562 CCTACTCTGGAGACTGAGGTGGG + Intergenic
1020067998 7:5204353-5204375 GCTACTCTGCAGGCTGAGGTAGG + Intronic
1021128871 7:16886833-16886855 GCTATTCTGGAGGCTGTGGTGGG - Intergenic
1021457363 7:20844247-20844269 ACTAAGAGGCAGAATGTGGTTGG + Intergenic
1022005922 7:26265545-26265567 ACTACTCAGGAGACTGAGGTGGG - Intergenic
1022194278 7:28049192-28049214 ACTACTCTGGAGACTGAGGCAGG - Intronic
1022369947 7:29761093-29761115 GCTAATCTGGAGGCTGAGGTGGG + Intergenic
1023181846 7:37492517-37492539 ACCAATCGGCAGAATGTGGGTGG + Intergenic
1023674439 7:42615593-42615615 ACTACTCTGGAGACTGAGGCAGG - Intergenic
1025080220 7:55975239-55975261 GCTAATCTGGAGGCTGAGGTGGG + Intronic
1025943623 7:66090383-66090405 GCTACTCTGGAGACTGAGGTGGG - Intronic
1026095628 7:67344225-67344247 GCTAATCTGAAGGCTGAGGTGGG - Intergenic
1026174679 7:67986116-67986138 ACTACTCTGGAGACTGAGGCAGG - Intergenic
1026433581 7:70372813-70372835 ACTAATCTGCTGAATGTGGGAGG + Intronic
1027057641 7:75060960-75060982 GCTACTCTGGAGACTGTGGTGGG + Intronic
1027132988 7:75604552-75604574 GCTACTCTGGAGACTGAGGTGGG + Intronic
1027181393 7:75942113-75942135 ACTACTGTGGAGACTGAGGTGGG + Intronic
1027362510 7:77424051-77424073 ACTACTCTGGAGGCTGAGGTGGG - Intergenic
1027435519 7:78160113-78160135 ACTGGTCTGCAGGCTGTGGGAGG + Exonic
1027659705 7:80974767-80974789 ACCAATCAGCAGGCTGTGGGTGG - Intergenic
1028201599 7:87968424-87968446 ACGAATCAGGAGACTGAGGTAGG + Intronic
1028593244 7:92521069-92521091 GCTACTCAGCAGACTGAGGTAGG - Intronic
1028842208 7:95440836-95440858 ACTCTTCTGCAGGCTGAGGTGGG + Intergenic
1029194788 7:98797704-98797726 GCTACTCTGGAGACTGAGGTGGG - Intergenic
1030292807 7:107889010-107889032 ACCAATCAGCAGAATGTGGGTGG + Intergenic
1030599846 7:111581376-111581398 ACCAATCAGCAGAATGTGGGTGG - Intergenic
1031442899 7:121814736-121814758 ACTACTCAGGAGACTGAGGTGGG + Intergenic
1031513166 7:122673296-122673318 ACCAATCTGCAGGATGTGGATGG - Intronic
1031700175 7:124915201-124915223 TCTCATCTGAAGCCTGTGGTTGG - Intronic
1032143540 7:129357236-129357258 ACTAAACTGCAGGCTTTAGTTGG - Intronic
1032589166 7:133176471-133176493 GCTACTCTGGAGACTGAGGTGGG + Intergenic
1033145497 7:138867441-138867463 GCTACTCAGCAGACTGAGGTGGG + Intronic
1033165098 7:139033095-139033117 ACTATTCAGGAGACTGAGGTGGG + Intronic
1033310278 7:140256280-140256302 GCTACTCTGGAGACTGAGGTGGG - Intergenic
1033331065 7:140417288-140417310 GCTACTCTGGAGACTGAGGTGGG + Intronic
1033663944 7:143423675-143423697 ACCAATCAGCAGAATGTGGGTGG - Intergenic
1035002907 7:155629633-155629655 GCTAATCTGGAGGCTGAGGTGGG + Intronic
1035638830 8:1167022-1167044 GCTAATCTGTAGGCTGAGGTGGG + Intergenic
1035768187 8:2125717-2125739 GCTACTCTGGAGACTGAGGTAGG - Intronic
1036429292 8:8674948-8674970 ACTACTCAGGAGGCTGTGGTGGG + Intergenic
1036943593 8:13073602-13073624 GCTACTCTGAAGGCTGTGGTGGG + Intergenic
1037095680 8:14983489-14983511 ACTACTCTGGAGGCTGAGGTGGG - Intronic
1037106384 8:15113095-15113117 ACTACTCAGGAGACTGAGGTGGG + Intronic
1037171307 8:15895533-15895555 GCTACTCTGGAGACTGAGGTGGG - Intergenic
1037239379 8:16760029-16760051 ACCAATCAGCAGAATGTGGGTGG - Intergenic
1037401846 8:18501851-18501873 GCTACTCTGAAGACTGAGGTGGG + Intergenic
1037542636 8:19887295-19887317 GCTACTCAGGAGACTGTGGTGGG - Intergenic
1037598150 8:20371684-20371706 ACTACTCGGAAGACTGAGGTGGG - Intergenic
1037807192 8:22065140-22065162 GCTACTCTGGAGACTGAGGTGGG - Intronic
1037836550 8:22218058-22218080 ACTACTCTGGAGGCTGAGGTGGG + Intergenic
1038349800 8:26765489-26765511 CCGTATCTGCAGACTGTGCTGGG - Intronic
1038654008 8:29431909-29431931 ACTACTCAGGAGACTGAGGTGGG + Intergenic
1038751663 8:30301699-30301721 GCTAATCAGGAGACTGAGGTGGG + Intergenic
1038804050 8:30774494-30774516 GCTACTCTGGAGACTGAGGTGGG + Intronic
1039432350 8:37534860-37534882 ACTACTCGGGAGACTGAGGTAGG - Intergenic
1039940154 8:42083381-42083403 ACTAATCGGGAGGCTGAGGTGGG + Intergenic
1040658870 8:49545193-49545215 ACTAAGCTGGAGACCATGGTAGG + Intronic
1042154764 8:65832594-65832616 GCTAAGCTGGAGGCTGTGGTGGG - Intronic
1042689913 8:71486399-71486421 CCTAATCTGAAGACTGTTGTAGG - Intronic
1043286133 8:78533746-78533768 ACTACTCTGGAGGCTGAGGTAGG + Intronic
1043595016 8:81875206-81875228 GCTAATCAGAAGACTGAGGTAGG - Intergenic
1043607287 8:82017504-82017526 ACTAATTTACAAATTGTGGTTGG + Intergenic
1043883434 8:85570568-85570590 ACTACTCTGGAGGCTGAGGTGGG + Intergenic
1043908460 8:85833454-85833476 TCTACTCTGGAGACTGAGGTGGG - Intergenic
1044452082 8:92348438-92348460 GCTAATCTGGAGGCTGAGGTGGG - Intergenic
1044580497 8:93821391-93821413 ACTACTCTGGAGGCTGAGGTGGG - Intergenic
1044715890 8:95099126-95099148 GCTAATCTGGAGGCTGAGGTGGG + Intronic
1044977525 8:97680182-97680204 GCTACTCGGCAGACTGAGGTGGG - Intronic
1045087762 8:98705299-98705321 GCTACTCTGCAGGCTGAGGTGGG + Intronic
1045302432 8:100924576-100924598 GCTAATCTGGAGGCTGAGGTGGG - Intronic
1045340664 8:101251615-101251637 ACTACTCTGGAGGCTGAGGTGGG - Intergenic
1046976263 8:120281451-120281473 GCTACTCTGGAGACTGAGGTGGG + Intronic
1047450220 8:124958760-124958782 ACTACTCGGGAGACTGAGGTAGG - Intergenic
1049657982 8:143807207-143807229 ACTGCTCTGCAGAGCGTGGTGGG + Intronic
1049805868 8:144538680-144538702 ACTACTCAGGAGACTGAGGTGGG - Intronic
1050548620 9:6729996-6730018 ACTACTCTGCAGGCTGAGGCAGG + Intronic
1050898330 9:10911640-10911662 ACCAATCAGCAGAATGTGGGTGG + Intergenic
1051484061 9:17589275-17589297 ACTACTCTGGAGGCTGAGGTGGG - Intronic
1052487630 9:29122812-29122834 ACAAATGTTCTGACTGTGGTAGG + Intergenic
1052965876 9:34340342-34340364 ATTCATCTGCAGATTGTGGCAGG + Intronic
1054875878 9:70096134-70096156 GCTACTCAGCAGACTGAGGTGGG - Intronic
1054876619 9:70103868-70103890 GCTAATCAGGAGACTGAGGTAGG + Intronic
1055645115 9:78355839-78355861 ACTACTCTGGAGGCTGAGGTGGG + Intergenic
1055925756 9:81508281-81508303 ACCAATCAGCAGAATGTGGGTGG + Intergenic
1056182365 9:84097708-84097730 ACTACTCTGGAGGCTGAGGTGGG + Intergenic
1056414018 9:86359055-86359077 GCTACTCAGCAGACTGAGGTGGG + Intergenic
1056755585 9:89380142-89380164 GCTACTCTGGAGACTGAGGTGGG - Intronic
1056799647 9:89682004-89682026 ACTAATCAGCAGGATGTGGGTGG + Intergenic
1057016192 9:91654987-91655009 ACTAAACTGCAGACTTTATTTGG - Intronic
1057300956 9:93881767-93881789 ACTAATCAGCAGGATGTGGGTGG + Intergenic
1057373451 9:94495826-94495848 ACTACTCTGGAGGCTGAGGTGGG + Intergenic
1057457878 9:95230810-95230832 ACTAATCAGCAGGATGTGGGCGG - Intronic
1057607700 9:96512429-96512451 ACTACTCTGGAGGCTGAGGTAGG - Intronic
1058065048 9:100539785-100539807 ACCAATCTGCAGGATGTGGGTGG - Intronic
1059257178 9:112941504-112941526 TCTACTCTGGAGACTGAGGTGGG + Intergenic
1059872271 9:118591022-118591044 TCTACTCTGGAGACTGAGGTAGG - Intergenic
1060071136 9:120548698-120548720 ACTACTCAGGAGACTGAGGTGGG + Intronic
1060215309 9:121735429-121735451 ACTAAGCTGCAGACTGTGTCAGG - Intronic
1060834977 9:126748968-126748990 GCTACTCTGCAGGCTGAGGTGGG - Intergenic
1061044322 9:128156498-128156520 GCTAATCTGGAGGCTGAGGTGGG + Intergenic
1061068043 9:128291109-128291131 GCTACTCAGGAGACTGTGGTAGG + Intergenic
1062059087 9:134485229-134485251 ACTACTCAGCAGACTGAGGCAGG - Intergenic
1185811119 X:3111616-3111638 ATTTTTCTGCAGACTGGGGTGGG + Intronic
1185831171 X:3304413-3304435 ACTACTCTGGAGACTGAGGTAGG - Intergenic
1185976437 X:4725708-4725730 ACCAATCAGCAGAATGTGGGTGG - Intergenic
1186492983 X:9989518-9989540 ACTATTCTGGAGGCTGAGGTGGG - Intergenic
1186984270 X:14994819-14994841 ACTAAACTGCAGACTTTATTTGG + Intergenic
1187010489 X:15273636-15273658 ACCAATCTGCAGGATGTGGGCGG + Intergenic
1187059377 X:15771257-15771279 ACTACTCAGGAGACTGAGGTAGG + Intronic
1187149702 X:16670126-16670148 GCTACTCTGGAGACTGAGGTGGG + Intronic
1187420794 X:19131897-19131919 GCTACTCTGGAGACTGAGGTGGG - Intergenic
1188208908 X:27394656-27394678 GCTACTCTGCAGGCTGAGGTGGG + Intergenic
1189896730 X:45664385-45664407 ACCAATCAGCAGAATGTGGGTGG - Intergenic
1189909981 X:45800992-45801014 ACTAAACTGCAGACTTTATTTGG - Intergenic
1190184860 X:48224650-48224672 GCTACTCTGCAGGCTGAGGTAGG + Intronic
1190549334 X:51562955-51562977 GCTACTCTGGAGACTGAGGTAGG + Intergenic
1191599516 X:62987387-62987409 ACGAATCTGCAGACTGCTTTGGG - Intergenic
1192069923 X:67927547-67927569 CCTAATCTGCAGACTGCTTTGGG - Intergenic
1192086840 X:68107586-68107608 ACTACTCTGGAGGCTGAGGTGGG - Intronic
1193177820 X:78415341-78415363 ACTACTCTGGAGGCTGAGGTGGG - Intergenic
1194196106 X:90894587-90894609 ACTACTCAGGAGACTGAGGTGGG - Intergenic
1195074455 X:101312951-101312973 GCTACTCTGGAGACTGAGGTGGG - Intergenic
1195330700 X:103796913-103796935 ACTACTCTGGAGGCTGAGGTGGG + Intergenic
1195385285 X:104308453-104308475 ACTACTCAGGAGACTGAGGTGGG - Intergenic
1196853231 X:119958747-119958769 ACTACTCAGGAGACTGAGGTAGG + Intergenic
1198853587 X:140992322-140992344 ACTAAAATTCAGACTGTTGTTGG + Intergenic
1200541949 Y:4468780-4468802 ACTACTCAGGAGACTGAGGTGGG - Intergenic
1200960111 Y:8988722-8988744 ACTAATCAGCAGGATGTGGGTGG + Intergenic
1201245998 Y:12004310-12004332 ACTACTCTGTAGACTGAGGTAGG + Intergenic
1201485873 Y:14494044-14494066 ACCAATCAGCAGGATGTGGTTGG - Intergenic
1201499424 Y:14626679-14626701 ACCAATCAGCAGAATGTGGGTGG - Intronic
1201675569 Y:16580064-16580086 GCTATTCTGCAGGCTGAGGTGGG - Intergenic
1201676839 Y:16595525-16595547 ACCAATCAGCAGGCTGTGGGCGG + Intergenic