ID: 1068247197

View in Genome Browser
Species Human (GRCh38)
Location 10:54388596-54388618
Sequence AGCTAGCAGAAGAAGATGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 330}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068247197_1068247203 25 Left 1068247197 10:54388596-54388618 CCCACCATCTTCTTCTGCTAGCT 0: 1
1: 1
2: 1
3: 26
4: 330
Right 1068247203 10:54388644-54388666 AACATTATTGGATTAAGCTGTGG No data
1068247197_1068247201 -7 Left 1068247197 10:54388596-54388618 CCCACCATCTTCTTCTGCTAGCT 0: 1
1: 1
2: 1
3: 26
4: 330
Right 1068247201 10:54388612-54388634 GCTAGCTGCTTCTGAATGGTAGG No data
1068247197_1068247202 13 Left 1068247197 10:54388596-54388618 CCCACCATCTTCTTCTGCTAGCT 0: 1
1: 1
2: 1
3: 26
4: 330
Right 1068247202 10:54388632-54388654 AGGCATTGTAGTAACATTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068247197 Original CRISPR AGCTAGCAGAAGAAGATGGT GGG (reversed) Intronic
903695948 1:25207056-25207078 AGCTAGCAGGAGGAGAAGCTGGG + Intergenic
903939613 1:26920591-26920613 AGGTAGCAGCAGAAGAAAGTGGG + Intronic
905223713 1:36466290-36466312 AGCTAGCTGGAGAAGAGGGGAGG - Exonic
905465224 1:38148097-38148119 AGTTATCTGAAGAAGATGGTAGG - Intergenic
907609547 1:55854517-55854539 AGCTTGCAGAAGAAGTTGGAAGG - Intergenic
908335762 1:63121126-63121148 AGCTTGCAGGGGAAGATGATGGG + Intergenic
908353713 1:63311252-63311274 AGAAAGAAGAAGAAGATGGCTGG - Intergenic
908580855 1:65515089-65515111 AGCCAGCAGATGATGGTGGTGGG + Intronic
910336313 1:86135932-86135954 TGCTGGCAGAAGAAGAGGATGGG + Intronic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
911143992 1:94535077-94535099 AGATACCAGAGGAGGATGGTTGG + Intronic
912119797 1:106456075-106456097 AGCAGGCAGAAGAACATGGAAGG - Intergenic
912739910 1:112184691-112184713 TGTTAGGAGAAGAAGATGGAGGG + Intergenic
912856068 1:113169715-113169737 AGCTACCAGAAGAGGAAAGTAGG + Intergenic
914877107 1:151520301-151520323 AGCTAGAAGAAAAAGAAGGAGGG - Intronic
915291641 1:154888146-154888168 GGCCAGCTGAAGAAGATGGCAGG - Intergenic
915923668 1:159998787-159998809 AGCTAGCAGCAAAAGAAGTTGGG + Intergenic
916389845 1:164319829-164319851 AGCCACCACAAGAAAATGGTAGG - Intergenic
916447985 1:164891374-164891396 AGCTTGCAGATGCAGATTGTGGG + Intronic
917203646 1:172545105-172545127 AGATAGCAGTACCAGATGGTGGG + Intronic
917214184 1:172660788-172660810 AGCTAGGGCAAGAAGATGATAGG + Intronic
917341513 1:173983557-173983579 AACTAGTAGAAGAAGAAGGCAGG - Exonic
917365001 1:174221803-174221825 AGCTACCAGCAGAAACTGGTAGG + Intronic
919501029 1:198338372-198338394 AGCCATCAGATGAAGATGATAGG + Intergenic
919509120 1:198438969-198438991 AGCTAGCTGGACAAGAAGGTAGG + Intergenic
920197429 1:204238364-204238386 AGTTAGCTGCAGAAGATGGCAGG - Intronic
921773856 1:219074312-219074334 AGAAAGCAGAAGATGAAGGTGGG - Intergenic
924755279 1:246934961-246934983 AGCTGGGAGATGGAGATGGTGGG - Intergenic
1063647214 10:7897081-7897103 TGGTAGCAGAAGAAGAAGTTGGG - Intronic
1064177884 10:13091091-13091113 AGCAGGCAGAAGAAGGTGGAAGG - Intronic
1065155852 10:22869485-22869507 AGCAGGCAGAAGAATATGGAAGG + Intergenic
1065761146 10:28984459-28984481 AGCTAGCTCAAGAAAATGCTTGG + Intergenic
1066107494 10:32168564-32168586 AGCTAGGAGAAAAATATGGAAGG + Intergenic
1067072630 10:43146380-43146402 AGCAGGCAGGAGAAGATGGAAGG - Intronic
1068247197 10:54388596-54388618 AGCTAGCAGAAGAAGATGGTGGG - Intronic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1068735874 10:60412490-60412512 AGCTTGCAGATGAAGATTGCAGG + Intronic
1069273999 10:66566969-66566991 AGCGGGGAGAAGAGGATGGTAGG + Intronic
1069404017 10:68078820-68078842 AGCAAGCAGGATAAGATGATAGG - Intergenic
1071959262 10:90793935-90793957 AGCAGGCAGAAGAAGTTGGAAGG - Intronic
1073133644 10:101207085-101207107 AGACAGCAGGGGAAGATGGTGGG + Intergenic
1073957686 10:108891655-108891677 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1073961739 10:108939057-108939079 AGCTGATAGAAGAAGGTGGTGGG + Intergenic
1074114330 10:110444192-110444214 AGCTATAAGAAGAAGAGTGTGGG - Intergenic
1074192604 10:111150708-111150730 AGGAAGCAGAAGAAGATCCTTGG - Intergenic
1074531154 10:114299779-114299801 AGCAGGCAGAAGAACATGGAAGG + Intronic
1074602694 10:114931354-114931376 AGCAGGCAGAAGAAGGTGGAAGG + Intergenic
1076510320 10:131009014-131009036 AGCAGGCAGAAGAAGATGGAAGG - Intergenic
1078552825 11:12292234-12292256 TGGTTGAAGAAGAAGATGGTGGG - Exonic
1078870289 11:15337057-15337079 AGCTACCAGAAGCTGAGGGTGGG - Intergenic
1080417305 11:32080829-32080851 AGCAGGCAGAAGAACATGGAAGG + Intronic
1080603869 11:33847670-33847692 AACTAGCCGAGCAAGATGGTAGG - Intergenic
1080676878 11:34436068-34436090 AGCAAGCCAAAGAAGAAGGTGGG - Intergenic
1085655890 11:78314483-78314505 AACTAGCAGAAGATCAAGGTGGG - Intronic
1085685216 11:78615459-78615481 AGGTAGAAGAAGAATATGGAAGG - Intergenic
1085911545 11:80832796-80832818 AGATAGCAGAAGAAAAATGTAGG - Intergenic
1087475780 11:98632692-98632714 AGGTAGGACAAGAAAATGGTGGG + Intergenic
1087957417 11:104305532-104305554 ATCTAGGACAAGAAGATGATGGG - Intergenic
1088102620 11:106171855-106171877 AGCTGGCAGAGGAACATGGAAGG + Intergenic
1088449661 11:109967857-109967879 AGCAGGCAGAAGAAGTTGGAAGG + Intergenic
1088921883 11:114265402-114265424 CTCCAGCAGAAGAAGATGATGGG - Intronic
1088993733 11:114977896-114977918 TGCTGGCAGAAGAACAGGGTGGG + Intergenic
1090481247 11:127070635-127070657 AGCAAGCAGAAGAAGGTGGAAGG - Intergenic
1091585838 12:1816166-1816188 GGCTAGCAGGAGATGATGGGAGG - Intronic
1091918943 12:4289196-4289218 AGCAAGCAGATGAAGGGGGTGGG + Intronic
1092575538 12:9778527-9778549 AGCAGGCAGAAGAAGATGGAAGG + Intergenic
1093499094 12:19790374-19790396 TGTTAGCAGAAGAATATGGGTGG + Intergenic
1094206771 12:27848678-27848700 AGCAGGCAGGAGAAGATGGAAGG + Intergenic
1098378641 12:69844479-69844501 TGCTAACAGAAGCAGATGGAGGG - Intronic
1099126190 12:78761183-78761205 AGAAAGTGGAAGAAGATGGTAGG - Intergenic
1099943230 12:89214948-89214970 AGCTGGCAGAAGCAGAGAGTTGG + Intergenic
1101992641 12:109499851-109499873 AGAAGGAAGAAGAAGATGGTGGG - Intronic
1103055058 12:117812573-117812595 AGCTAGCAAATGATGATGCTGGG - Intronic
1103396866 12:120613993-120614015 AGCAGGCAGAAGAAGGTGGAAGG + Intergenic
1103547683 12:121713344-121713366 AGCTACCAAAAGCAGATGGGAGG - Intronic
1104261050 12:127182368-127182390 AGCAGGCAGAAGAAGTTGGAAGG - Intergenic
1104531876 12:129579664-129579686 AGCAGGCAGAAGAAGATAGAAGG - Intronic
1105652067 13:22389885-22389907 GACTAGCAGAAGAAAATGGCAGG - Intergenic
1107773307 13:43811359-43811381 AGCAAGCAGAAGGAGACTGTGGG + Intergenic
1108725461 13:53175879-53175901 AGCTAGAAAAAGAAGTTAGTGGG + Intergenic
1109379650 13:61542998-61543020 AGCCAGCAGAGGAATATGGAAGG + Intergenic
1109931921 13:69226934-69226956 AGCAAGCAGAAGAAGGTGGAAGG + Intergenic
1110409735 13:75191161-75191183 AGCAAGCAGAGGAACATGGAAGG + Intergenic
1110939967 13:81337833-81337855 AGTTAGCAGAAGAAAAGGGAAGG - Intergenic
1111218520 13:85175944-85175966 AGCAGGCAGAAGAACATGGAAGG + Intergenic
1111317812 13:86584342-86584364 AGCGAGCAGAGGAACATGGAAGG + Intergenic
1111811654 13:93099055-93099077 AGCAGGCAGAAGAAGGTGGAAGG + Intergenic
1112303239 13:98249579-98249601 AGCTGGGTGAAGAACATGGTGGG - Intronic
1113393950 13:109926352-109926374 AGCTGGCAGAAAAAGGTGCTGGG + Intergenic
1114246869 14:20922381-20922403 AAGTAGCAGAAGGAGAAGGTGGG + Intergenic
1114427260 14:22634318-22634340 AGCTGGGAGATGAGGATGGTTGG + Exonic
1114905378 14:27120449-27120471 TGCTATCTGAAGAAGATGGCAGG + Intergenic
1115950270 14:38713310-38713332 AGCTTGCAGAATAAAATGGAGGG - Intergenic
1116068091 14:40009144-40009166 AGTTATCTGAAGAAGATGGGAGG - Intergenic
1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1116608949 14:47040947-47040969 GCAGAGCAGAAGAAGATGGTAGG + Intronic
1116956023 14:50924080-50924102 AGGTAGAAGAAGCAGATGATTGG - Exonic
1118306631 14:64660471-64660493 AGCCACCTGAAGAAGAGGGTAGG - Intergenic
1118741018 14:68739250-68739272 TGTGAGCAGAAGAAAATGGTTGG - Intergenic
1119132297 14:72185162-72185184 AGCAAGCAGAAGAACATGGAAGG - Intronic
1120626047 14:86827706-86827728 AGCAGGCAGAAGAACATGGAAGG + Intergenic
1120654771 14:87176811-87176833 AGCAGGCAGAAGAACATGGAAGG + Intergenic
1121455862 14:94038581-94038603 AGCTGGCAGAAGTAGGGGGTAGG - Intronic
1122854302 14:104552797-104552819 ATCTTGCAGAAGCAGATGCTGGG + Intronic
1123917420 15:25046810-25046832 AGCAAGCAGAAGAATATAGAAGG + Intergenic
1124160194 15:27261199-27261221 CTCTAGAAGAAGAAAATGGTTGG + Intronic
1126175812 15:45734284-45734306 AGCTAGCAGATGCAGATGCGGGG + Intergenic
1127319748 15:57831408-57831430 AGCTAGATGAAGCACATGGTGGG + Intergenic
1127725246 15:61743457-61743479 ATCTATCACAAGAAGCTGGTGGG + Intergenic
1128068590 15:64779447-64779469 AGCAAGGAGCAGATGATGGTGGG + Intergenic
1128906159 15:71469530-71469552 GGCTCTCAGAAGAAGTTGGTTGG - Intronic
1130315937 15:82796670-82796692 AGCTAGCAGAGAAAGCTGGGTGG - Intronic
1130768569 15:86899965-86899987 AGCAGGCAGAAGAACATGGAAGG + Intronic
1137523990 16:49217771-49217793 AGCAGGCAGAAGAACATGGAAGG - Intergenic
1138179100 16:54930499-54930521 AGTTAGCAGAAGAGGAAAGTTGG + Intergenic
1138848081 16:60591668-60591690 CGCTATCAAAAGAACATGGTGGG + Intergenic
1139456814 16:67086079-67086101 AGCTAAGAGAAGAAAATGGAGGG + Intronic
1143356389 17:6332034-6332056 AGCTAGCAGGTGGAGGTGGTGGG - Intergenic
1145725361 17:27116039-27116061 AGCTAGCACAAGAAGATGGTAGG + Intergenic
1148960444 17:51388136-51388158 AGCAGGCAGAAGAAGGTGGAAGG - Intergenic
1149207846 17:54268889-54268911 AGCAGGCAGAAGAACATGGAGGG - Intergenic
1151129345 17:71880314-71880336 AGCTGCCAGAAGAAGATGAGGGG + Intergenic
1152433728 17:80262922-80262944 AGCCAGCAGAAGAAGGTGGTGGG + Intronic
1152664791 17:81561290-81561312 AGAAAGCAGAAGAAGAAGCTGGG - Intronic
1153083041 18:1250596-1250618 ATATTGAAGAAGAAGATGGTTGG - Intergenic
1153958302 18:10117651-10117673 AGGCAGCAGAAGAGAATGGTGGG + Intergenic
1155589483 18:27410285-27410307 AGCGGGCAGAAGAACATGGAAGG + Intergenic
1157654927 18:49375839-49375861 AGCAGGCAGAAGAACATGGAAGG + Intronic
1159700272 18:71617661-71617683 AGTTAGAAGAAGAAAATGGGAGG + Intergenic
1162703422 19:12536971-12536993 GACTGGCAGAAGAAGATGGGAGG - Intronic
1166819937 19:45572042-45572064 AGCCAGCAGAAAAACATGGCAGG - Intronic
1168060959 19:53891942-53891964 AAAGGGCAGAAGAAGATGGTGGG + Intronic
925248239 2:2403854-2403876 AGATGGCAGAAGGGGATGGTGGG + Intergenic
925258418 2:2509173-2509195 AGCTAGCAGATGTAGATTGTGGG - Intergenic
925960400 2:9009145-9009167 AGCTGGCAGCAGAAGAGGGTGGG - Intergenic
926152102 2:10430988-10431010 AGCTTGCAGAAGGAGGTGGTTGG - Intergenic
926841855 2:17089728-17089750 AGCAGGCAGAGGAAGATGGAAGG - Intergenic
928845726 2:35669507-35669529 AGCAGGCAGAAGAAAATGGAAGG - Intergenic
929752876 2:44735422-44735444 AGCAAGCAGAACAAGATGAAAGG - Intronic
931168851 2:59780717-59780739 AGATAGGAGAAGAAGGTGTTTGG - Intergenic
932508516 2:72261241-72261263 AACAAGTAGAAGAACATGGTTGG + Intronic
933566780 2:83960095-83960117 AGCAAGCAGTAGAAGCTGATTGG - Intergenic
934162965 2:89269854-89269876 AGCTAGACTCAGAAGATGGTGGG - Intergenic
934204308 2:89912670-89912692 AGCTAGACTCAGAAGATGGTGGG + Intergenic
935277326 2:101486198-101486220 GGCTGGCTGAAGAAGATGGAGGG - Intergenic
935513657 2:104006975-104006997 TGCTAGCAGAAGATGGTAGTGGG - Intergenic
935856808 2:107283290-107283312 AACTAGCAGAAGAAGATCCAGGG - Intergenic
935943444 2:108265298-108265320 GACTACCAGAAGAAGATGGCAGG + Exonic
936940554 2:117879655-117879677 AGCAAGCAGAAGAACATGGATGG + Intergenic
939648266 2:144729210-144729232 AGGTAACAGAAGAAGATGACAGG - Intergenic
940297064 2:152137372-152137394 AGCAAGCACAAGTAGATGCTTGG - Intronic
940452197 2:153853180-153853202 AGCAGGCAGAAGAACATGGAAGG - Intergenic
943076815 2:183205840-183205862 AGCAGGCAGAAGAAGTTGGAAGG + Intergenic
943388126 2:187227107-187227129 AGTTATCTGCAGAAGATGGTAGG - Intergenic
943494153 2:188598702-188598724 AGCTTTCAGAAGAACATGTTGGG + Intergenic
943593967 2:189832980-189833002 AGCTGGCAGAGGGAGATGGTTGG - Intronic
943922682 2:193729547-193729569 AGCAGGCAGAAGAACATGGAAGG + Intergenic
943966190 2:194336998-194337020 AGCAAGCAGAAGAAGTTGGAAGG + Intergenic
945743383 2:213690667-213690689 AGCAGGCAGAAGAAGAGGATAGG + Intronic
947592368 2:231393104-231393126 AGATACCAGGAGAAGAGGGTGGG - Intergenic
948122410 2:235540720-235540742 AGAAAGCAGGTGAAGATGGTGGG + Intronic
948536448 2:238650865-238650887 AGCTATCAGAGGAGGATGGCCGG - Intergenic
948558847 2:238836967-238836989 AGCAAGCAGAAGAACGTGGAAGG - Intergenic
1169679838 20:8198507-8198529 TCCTAGCAGAAGAAGATACTAGG - Intronic
1170505842 20:17024962-17024984 AGAAAGCAGAAGAAGGTGGGAGG + Intergenic
1171566326 20:26193556-26193578 AGTCAGCAGAAGAATATGTTAGG + Intergenic
1172126777 20:32629173-32629195 AGCTAGCAGAGGATGCTGGATGG - Intergenic
1172482547 20:35279453-35279475 AGCTACCAGAACAAACTGGTAGG + Intronic
1173596920 20:44264472-44264494 AGCTACCTGAAGAAGATCCTCGG + Exonic
1174633934 20:51982645-51982667 AGATGGTAGAAGAAGATGGGAGG + Intergenic
1177232452 21:18340228-18340250 AGCAGGCAGAAGAACATGGAAGG + Intronic
1178011488 21:28291441-28291463 AGCTGGCAGAAGAATGTGGAAGG - Intergenic
1178012657 21:28305146-28305168 AGTTATCAGCAGAAGATGGCAGG - Intergenic
1178284258 21:31311910-31311932 AGCAGGCAGAAGAACATGGAGGG + Intronic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1181367439 22:22388973-22388995 AGCTACCTGCAGAAGATGGCAGG + Intergenic
1182053266 22:27329349-27329371 AGGCAGCAGAAGAAGACGTTCGG + Intergenic
1184970831 22:48018802-48018824 AGCTGGGAGAGGATGATGGTGGG + Intergenic
951179957 3:19648040-19648062 AATTAGCAGAAGATGAGGGTGGG - Intergenic
951528998 3:23681446-23681468 AGCTGGCAGAAGAAAGTGGAAGG + Intergenic
951574787 3:24102594-24102616 AGGTAGTAGGAGCAGATGGTGGG - Intergenic
955445519 3:59006266-59006288 AGCCATCAGAAGGAGATGGGAGG + Intronic
956610542 3:71117969-71117991 AGCTAAAAGAAGAAGTGGGTGGG + Intronic
956780699 3:72600912-72600934 AGCTAATAGGAGAAGGTGGTAGG + Intergenic
959302849 3:104624466-104624488 AGCAGGCAGAAGAAGGTGGAAGG + Intergenic
959529177 3:107413159-107413181 AGCTAGGAGAAAGAGATGTTTGG - Intergenic
959545336 3:107589335-107589357 AGCTAGTAGAAGAAAATGATTGG + Intronic
959856319 3:111162791-111162813 AGCTAACAGAAGAAGCTTGATGG - Intronic
959967869 3:112376638-112376660 AGCAGGCAGAAGAAGGTGGGAGG - Intergenic
960270704 3:115671012-115671034 AGCTAGCAGAAGTAGATATAGGG + Intronic
961249248 3:125485788-125485810 AACTAGAAGAAGAGGAGGGTGGG - Intronic
961256163 3:125555108-125555130 AGCTAGCAGGGGAATATGGAAGG + Intronic
961262845 3:125616393-125616415 AGTTATCTGCAGAAGATGGTAGG - Intergenic
961733402 3:128984382-128984404 AGCAGGCAGAAGAACATGGAAGG + Intronic
961746371 3:129065956-129065978 AGCAGGCAGAAGAATATGGAAGG + Intergenic
961826655 3:129602646-129602668 GGCTAGAAGTAGGAGATGGTGGG + Intronic
963258482 3:143169861-143169883 AGATAGCCTCAGAAGATGGTAGG - Intergenic
963568810 3:146965794-146965816 AGCTAGAATAAGAAGATAGGAGG + Intergenic
963575066 3:147049925-147049947 ATGTAGCACAAGAAGATGTTGGG + Intergenic
965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG + Intergenic
965268117 3:166574523-166574545 AACTGGCAAAATAAGATGGTTGG + Intergenic
965951030 3:174308479-174308501 AGCAAGCAGAAGAAGGTGGAAGG - Intergenic
966392431 3:179466483-179466505 AGCTGGCAGAAGAACAAGGAGGG - Intergenic
966942165 3:184754187-184754209 TGATGGGAGAAGAAGATGGTGGG + Intergenic
966942176 3:184754232-184754254 TGGTAGGAGAAGAAGGTGGTGGG + Intergenic
966942220 3:184754403-184754425 TGATGGGAGAAGAAGATGGTGGG + Intergenic
966942231 3:184754448-184754470 TGGTAGGAGAAGAAGGTGGTGGG + Intergenic
966942260 3:184754561-184754583 TGGTGGGAGAAGAAGATGGTGGG + Intergenic
966942271 3:184754606-184754628 TGGTAGGAGAAGAAGGTGGTGGG + Intergenic
966942274 3:184754622-184754644 TGGTGGGAGAAGAAGATGGTGGG + Intergenic
966942285 3:184754667-184754689 TGGTAGGAGAAGAAGGTGGTGGG + Intergenic
966942292 3:184754696-184754718 TGGTAGGAGAAGAAGGTGGTGGG + Intergenic
966942299 3:184754728-184754750 TGGTGGGAGAAGAAGATGGTGGG + Intergenic
966942326 3:184754834-184754856 TGGTAGGAGAAGAAGGTGGTGGG + Intergenic
966942329 3:184754850-184754872 TGGTGGGAGAAGAAGATGGTGGG + Intergenic
968800180 4:2738091-2738113 AGTTAGCTGCAGAAGATGGCAGG - Intergenic
969155361 4:5205283-5205305 AGCTTGCAGATGACAATGGTGGG + Intronic
969982568 4:11173242-11173264 AGCAGGCAGAAGAACATGGAAGG + Intergenic
970644757 4:18107427-18107449 AGCAGGCAGAAGAAGGTGGAAGG - Intergenic
974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG + Intergenic
974853430 4:67430618-67430640 AGCAGGCAGAAGAAGGTGGAAGG + Intergenic
974884619 4:67803271-67803293 TGCTAGGAGAAGAAGATTCTTGG + Intergenic
976028832 4:80725693-80725715 AGCTAGTAGAAAAAGGTGCTGGG + Intronic
977521249 4:98087418-98087440 AGCTGGCAGACTAATATGGTTGG - Intronic
978079384 4:104573573-104573595 AGCGGGCAGAATAAGATGGAAGG - Intergenic
978985382 4:115005736-115005758 AGTTAGCTGGATAAGATGGTGGG + Intronic
980032718 4:127848983-127849005 AGCTAGCAGAAGAAAATAAATGG + Intergenic
982025704 4:151252249-151252271 AGCTGGCAGAAGAGGCTGGGTGG - Intronic
982657431 4:158167754-158167776 AGCAAGCTGAAAAAGATGCTGGG + Intronic
983797470 4:171882707-171882729 AGCAGGCAGAAGAAGCTGGAAGG - Intronic
984207687 4:176805833-176805855 AGCTAGCAAAAGGAGGTGGAGGG - Intergenic
985542060 5:491927-491949 AGGTAGAAGAAGAAGACGGTGGG + Exonic
985931982 5:3065721-3065743 AGCTAACAGAAGGAAATGCTGGG - Intergenic
986147318 5:5090722-5090744 AGCAGGCAGAAGAAGGTGGAAGG - Intergenic
986524849 5:8662965-8662987 AGCAGGCAGAAGAAGAGGGTAGG + Intergenic
986938334 5:12918780-12918802 AGTTACCTGAAGAAGATGGCAGG + Intergenic
987700993 5:21398196-21398218 AGCAGGCAGAAGAAGGTGGAAGG + Intergenic
987795740 5:22625444-22625466 AGCTAGCAGGAAGAGTTGGTTGG + Intronic
987920309 5:24271825-24271847 AGCAGGCAGAAGAAGGTGGAAGG - Intergenic
989045210 5:37267620-37267642 GGTTATCTGAAGAAGATGGTAGG + Intergenic
989296447 5:39832900-39832922 AGAAAGCAGAAGAAAATGTTGGG + Intergenic
989307506 5:39974650-39974672 AGCTATCTGAAGAAGATGGCAGG + Intergenic
989465810 5:41753936-41753958 AGCTAGCAGAAGCACATGACGGG + Intronic
989518677 5:42375167-42375189 AGTTAGCGGCAGAAGAGGGTGGG + Intergenic
989756632 5:44963019-44963041 AGCAGGCAGAAGAAGGTGGAAGG - Intergenic
990078805 5:51886348-51886370 AGCAGGCAGAAGAACATGGAAGG - Intergenic
990100869 5:52184930-52184952 AGCTGCAAGGAGAAGATGGTTGG - Intergenic
990330996 5:54725236-54725258 AGCAAGCACAAGAGGATGATAGG - Intergenic
991127683 5:63086125-63086147 AGATAGCAAAAGAGCATGGTGGG + Intergenic
991433711 5:66574337-66574359 GGCTAGCAGAGGCAGATGGGTGG + Intergenic
991669896 5:69037352-69037374 AGTAAGCAGAAAAAGAGGGTGGG + Intergenic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
992581523 5:78183125-78183147 AGCTATCAGAGAAAGACGGTTGG + Intronic
993301594 5:86217893-86217915 AGCCAGCAGTAGAAGGTGATGGG + Intergenic
993354576 5:86890156-86890178 AGCAAGCAAAAGCAGAGGGTGGG + Intergenic
993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG + Intergenic
993979092 5:94521660-94521682 TGCTAGCAGAAAACAATGGTGGG + Intronic
994503714 5:100613195-100613217 AGCTACCACAAGCAGCTGGTGGG + Intergenic
996572615 5:124948390-124948412 AGGTTGCAGATGAAGATTGTGGG - Intergenic
996761941 5:126994993-126995015 AGCAGGCAGAAGAAGGTGGAAGG - Intronic
996884202 5:128336787-128336809 AGATAACAGAAGAAAATGGCAGG + Intronic
996907760 5:128621112-128621134 AGCTCCCAGAAGAATATGATGGG + Intronic
997280708 5:132642971-132642993 ATGTAGGAGAAGAAGGTGGTGGG - Exonic
998290339 5:140908580-140908602 AGTTAGCTGCAGAAGATGGAAGG + Intronic
999035194 5:148341268-148341290 AGTCAGCAAAAGAAAATGGTGGG + Intergenic
999286362 5:150396581-150396603 AGCAAGAAGAAGAAGAAGCTGGG + Exonic
999659985 5:153850956-153850978 AGCAGGCAGAAGAAAATGGAAGG - Intergenic
1000873171 5:166602633-166602655 AGCTAGAACTAGAAGAAGGTAGG + Intergenic
1001793342 5:174480370-174480392 AGCTGGCAGGAGAGGATGGCTGG - Intergenic
1002166180 5:177348286-177348308 TACTTGCAGAAGAATATGGTAGG + Intronic
1003460378 6:6323012-6323034 AGATGGCAGAGGAAGATGATAGG - Intergenic
1005236110 6:23764102-23764124 AGGTAAGAGAAGAAGATAGTAGG - Intergenic
1007067512 6:39006814-39006836 ACCTGTCAGAAGAAGATGATAGG - Intronic
1008209972 6:48709892-48709914 ACCTAGCAGGAGATTATGGTGGG - Intergenic
1011236753 6:85227098-85227120 AGCTAGAAGAATAAGAGTGTGGG - Intergenic
1011645994 6:89458634-89458656 AGCTGGCAGGAGAAGATGGAAGG - Intronic
1012420154 6:99056123-99056145 AGCAGGCAGAAGAACATGGAAGG + Intergenic
1012736869 6:102959069-102959091 AGCAGGCAGAAGAACATGGAGGG + Intergenic
1012755256 6:103222750-103222772 AACTAGTAGAAGAAAATGCTGGG - Intergenic
1012870536 6:104668025-104668047 AGCAAGCAGAGGAACATGGAAGG + Intergenic
1013471496 6:110470540-110470562 AACTAACTGAAGAAGCTGGTAGG - Intronic
1014736598 6:125101383-125101405 ATCTAGCAGGAGAAAATGCTGGG - Intergenic
1015443289 6:133272593-133272615 AGTTATCTGTAGAAGATGGTTGG + Intronic
1015726366 6:136303484-136303506 AGCAGGCAGAAGAAGGTGGAAGG + Intergenic
1016435751 6:144035458-144035480 AGCAGGCAGGAGAAGATGGGAGG - Intronic
1017357633 6:153528428-153528450 AGCTGGCAGAAGAAGGTGGAAGG - Intergenic
1018479070 6:164171873-164171895 AGCAGGCAGAAGAACATGGAAGG + Intergenic
1018564015 6:165132545-165132567 AGCAGGCAGAAGAACATGGAAGG - Intergenic
1019003145 6:168772313-168772335 AGCAGGCAGAAGAAGGTGGAAGG + Intergenic
1019208764 6:170386710-170386732 AGAGAGCAGAAGAAGAAGGAAGG + Intronic
1020890206 7:13869014-13869036 AGCAGGCAGAAGAACATGGAAGG - Intergenic
1022995748 7:35753720-35753742 AGGTAGAAGAAAAAGTTGGTCGG - Intergenic
1023463695 7:40429632-40429654 AGCAGGCAGAAGAATATGGAAGG - Intronic
1024135952 7:46408329-46408351 AGATAGAAGAGGAAGATGTTAGG + Intergenic
1024205484 7:47156062-47156084 AGCAGGCAGAAGAAGGTGGAAGG - Intergenic
1024361194 7:48470315-48470337 AGCTAGGAGAAGAATAAGGGAGG + Intronic
1024468286 7:49737936-49737958 AGCAGGCAGAAGAAGGTGGAAGG + Intergenic
1024884345 7:54124683-54124705 AGCTATCTAAAGAAGATGGCAGG + Intergenic
1027146689 7:75700455-75700477 AGAAAGCAGAAGAAGATGACAGG + Intronic
1029020835 7:97363543-97363565 AGCTTGCAGACACAGATGGTGGG - Intergenic
1032515486 7:132503455-132503477 AGCTGGCTGGAGAAGATGCTGGG - Intronic
1035612444 8:977311-977333 AGCTGTCAGAAGAACATGGGAGG - Intergenic
1035780994 8:2228471-2228493 AGCAGGCAGAAGAAGGTGGAAGG + Intergenic
1036491385 8:9229274-9229296 AGCAGGCAGAAGAAGGTGGAAGG - Intergenic
1037266564 8:17068815-17068837 AGGTAGAAGAAGATGTTGGTTGG + Intronic
1037485043 8:19339203-19339225 AGCTGGCAGAAGAACGTGGAAGG - Intronic
1037838095 8:22226372-22226394 AGCTAGCAGAGGGAAATGGGGGG + Intronic
1037991165 8:23322122-23322144 GGCTTGCAGAAGAAGGTGATGGG - Exonic
1038308315 8:26424526-26424548 AGGAAGCAGAAGTAGATGGGTGG + Intronic
1038581722 8:28753802-28753824 TGCTCGCAGAAGACGATGGGAGG + Intronic
1040520415 8:48171725-48171747 AGCTAGCAGGATAAGGTGGCAGG - Intergenic
1040793821 8:51267853-51267875 AGCAGGCAGAAGAAGTTGGAAGG - Intergenic
1042734386 8:71971257-71971279 AGCTAGCAGGCAAAGATTGTGGG + Intronic
1043180854 8:77084982-77085004 AGCAAGCAGAAGAAGTTGGAAGG + Intergenic
1043287800 8:78556865-78556887 GACTAGCAGAAGAAGCTGGCAGG + Intronic
1044285975 8:90412476-90412498 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1045394896 8:101750782-101750804 ACCTGGCAGAAGATGAGGGTAGG - Intronic
1045792759 8:106004346-106004368 AGCTATCAGAAGAAGATGAGGGG + Intergenic
1046128677 8:109941632-109941654 AGTTATCTGAAGAAGATTGTGGG + Intergenic
1046515906 8:115260275-115260297 AGCTAGAAGAAATCGATGGTTGG - Intergenic
1047731976 8:127735819-127735841 AGGGAGCAAAAGAAAATGGTAGG + Intronic
1048153151 8:131914099-131914121 AGCCAGCTGCAGCAGATGGTGGG - Intronic
1048521514 8:135159772-135159794 AGCAGGCAGAAGAACATGGAAGG + Intergenic
1049826252 8:144670662-144670684 GGCCTGCAGGAGAAGATGGTGGG - Intergenic
1050082456 9:1929300-1929322 AGGTTGCAGAAGAAAATGGCTGG - Intergenic
1050423380 9:5490076-5490098 CTCTAGCAGCAGAAGCTGGTGGG + Intergenic
1050888738 9:10796784-10796806 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1051716606 9:19991362-19991384 AGCAGGCAGAAGAACATGGAAGG - Intergenic
1051792729 9:20826277-20826299 AGCCGGCAGAAGAAGTTGGAAGG + Intronic
1054806454 9:69400552-69400574 AGCTTGTGGAAGAAGATGGGAGG - Intergenic
1055379936 9:75695358-75695380 AGCAAGCAGAAGAAAGGGGTAGG + Intergenic
1055458673 9:76495775-76495797 ATATAGCAGAAGAAAATGTTGGG + Intronic
1056156662 9:83845179-83845201 AGTTAGCTGCAGAAGATGGCGGG - Intronic
1057791257 9:98126678-98126700 AGCTGGCTGCAGAAGATGGCTGG - Exonic
1059608532 9:115864809-115864831 AGCTAGCACAATAAGATGAAAGG + Intergenic
1061120704 9:128640686-128640708 ACCGAGCAGCAGCAGATGGTAGG - Exonic
1061363842 9:130160126-130160148 AGCCTGCTGAAGAGGATGGTGGG + Intergenic
1061575320 9:131502708-131502730 AGCAAGGAGCAGAAGATGGGTGG + Intergenic
1062135904 9:134928210-134928232 AGCAGGCAGAAGAAGATGGAAGG + Intergenic
1062598842 9:137311182-137311204 AGCTAGCGGAAGAGGAAGGGAGG - Intronic
1189027263 X:37408528-37408550 GGCAAGGGGAAGAAGATGGTGGG + Intronic
1190701214 X:52991186-52991208 AGCTTGCAGATGGAGATGGCAGG - Intronic
1190959403 X:55230557-55230579 AGCAGGCAGAAGAAGGTGGAAGG - Intronic
1190973239 X:55373274-55373296 AACTAGTAGAAGAAAATGTTGGG - Intergenic
1191226143 X:58045104-58045126 AGCAGGCAGAAGAAGGTGGAAGG + Intergenic
1193979192 X:88159952-88159974 AGCAGGCAGGAGAAGATGGAAGG + Intergenic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1195401182 X:104463164-104463186 AGCTAGGAGAAGAAGGGGGTGGG + Intergenic
1196721146 X:118855045-118855067 AAGTAGCAGAAGGAGATGATAGG + Intergenic
1196899184 X:120366571-120366593 AGGAAGCAGAAGAAGAGGCTCGG + Exonic
1197097464 X:122612806-122612828 AGTTATCTGCAGAAGATGGTAGG - Intergenic
1197560177 X:128011365-128011387 AACTAACATAAGAAGATGCTGGG + Intergenic
1197750927 X:129963107-129963129 GGCTTGCAGAAGAAGATGCTGGG - Intergenic
1198213175 X:134533790-134533812 AGGTAGAAGAGGAAGATGGAAGG + Intergenic
1198615309 X:138452159-138452181 AGCAGGCAGAAGAAGTTGGAAGG + Intergenic
1199031420 X:143004832-143004854 AGCAGGCAGAAGAAGTTGGAAGG - Intergenic
1199621284 X:149704059-149704081 AGTTAGCAGTGGAAGATGGCTGG - Intronic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1200914530 Y:8559837-8559859 AGCTATCAGCAAAAGATGGTTGG - Intergenic