ID: 1068249285

View in Genome Browser
Species Human (GRCh38)
Location 10:54416122-54416144
Sequence GTGTATATATATATTTAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1313
Summary {0: 1, 1: 2, 2: 23, 3: 199, 4: 1088}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068249285_1068249287 12 Left 1068249285 10:54416122-54416144 CCAAGCTAAATATATATATACAC 0: 1
1: 2
2: 23
3: 199
4: 1088
Right 1068249287 10:54416157-54416179 AAATTTTTACTTTAAGTTCTGGG 0: 18
1: 204
2: 1221
3: 3602
4: 11658
1068249285_1068249286 11 Left 1068249285 10:54416122-54416144 CCAAGCTAAATATATATATACAC 0: 1
1: 2
2: 23
3: 199
4: 1088
Right 1068249286 10:54416156-54416178 AAAATTTTTACTTTAAGTTCTGG 0: 16
1: 113
2: 461
3: 1534
4: 5161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068249285 Original CRISPR GTGTATATATATATTTAGCT TGG (reversed) Intronic
902408227 1:16198190-16198212 ATGTATATTTATATATATCTGGG - Exonic
902418922 1:16262192-16262214 ATGTATATATATTTTAAGATGGG + Intronic
902434380 1:16388399-16388421 ATATATTTATATATTTGGCTGGG - Intronic
902440520 1:16426552-16426574 ATATATATATATATATAGCCGGG - Intronic
902913705 1:19622184-19622206 GTGTATACATATACGTAGCAGGG + Intronic
902975812 1:20087677-20087699 CTGTATATATATATATGACTTGG - Intronic
903171102 1:21554323-21554345 GTGTGTATATATATATATATGGG - Intronic
903602846 1:24555058-24555080 ATGTATATATATATTTTGGTAGG - Intergenic
903602847 1:24555062-24555084 GTGTATGTATATATATATTTTGG - Intergenic
904088636 1:27929016-27929038 ATATATATATATATTTTGCCCGG + Intergenic
904984355 1:34532613-34532635 ATGTATTTATATATAGAGCTAGG + Intergenic
905155108 1:35971021-35971043 ATATATATATATATTTAGGCTGG - Intronic
905575353 1:39039794-39039816 TTGTATATATATATTTCTTTTGG - Intergenic
905602106 1:39261801-39261823 GTGTATACATGTATATACCTAGG + Intronic
905935989 1:41824734-41824756 ATATATATATATATTTAACTTGG - Intronic
905981199 1:42229924-42229946 GTGTATATGTGTATTAATCTGGG + Intronic
906578590 1:46914440-46914462 GTGTATATATATATATCACATGG + Intergenic
907193816 1:52670141-52670163 GTGTATAAACATATTTTTCTAGG - Intergenic
907207230 1:52783781-52783803 ATATATATATATATAAAGCTGGG - Intronic
907209079 1:52803065-52803087 GTGTATATATATATATATAGTGG - Intronic
907720757 1:56969885-56969907 GTGTGTATATACATTTTTCTGGG + Intergenic
907994244 1:59612947-59612969 GGGTACATATATATTTAGGATGG - Intronic
908108348 1:60869784-60869806 GTGTATAAATATGTTTACCATGG - Intronic
908231118 1:62106172-62106194 ATATATATATATATATGGCTGGG + Intronic
908280140 1:62524926-62524948 ATATATATATATATATAGTTTGG - Intronic
908619394 1:65960614-65960636 TTTTATATATATTTTTAGCCTGG - Intronic
908708654 1:66990692-66990714 GTGTATATGTATAGTTAGTTAGG + Intergenic
908875087 1:68664150-68664172 ATATATATATATATATAGTTTGG - Intergenic
908962359 1:69713332-69713354 GTATATATATATATTTAGACAGG + Intronic
908965362 1:69755323-69755345 GTGTATATATATATTCCTTTTGG - Intronic
908965364 1:69755406-69755428 ATATATATATATATTTTGCAAGG + Intronic
909349808 1:74638011-74638033 TTGTACATATATATTTAGGAAGG + Intronic
909372981 1:74908160-74908182 TTGTATATAAATATTTCTCTTGG + Intergenic
909432940 1:75610845-75610867 GTGTATATATATAGATATCCTGG - Intronic
909458922 1:75885339-75885361 GTGTATATATATATATATAAAGG + Intronic
909473718 1:76058510-76058532 GTGTATATATATATATATGTGGG - Intergenic
909824326 1:80108448-80108470 GTGTGTATATATATATATGTAGG - Intergenic
909895944 1:81069284-81069306 ATATATATATAAAATTAGCTGGG - Intergenic
909913152 1:81285216-81285238 GTGTATATATATATATATACAGG + Intergenic
910176102 1:84431852-84431874 GTTTTTATATATACTTAGCATGG - Intergenic
910502304 1:87906722-87906744 GTGTGTACATATATGTAGGTAGG - Intergenic
910545543 1:88412339-88412361 GTGTCTGTATGTATTTACCTTGG - Intergenic
910831801 1:91468905-91468927 GTGTATATATATATATATGAAGG + Intergenic
911001934 1:93175298-93175320 GTGTATATATATATATATATAGG - Intronic
911555012 1:99333236-99333258 TTGTCTAGATATTTTTAGCTGGG - Intergenic
911785439 1:101940675-101940697 CTGGATATATATATATAGCTGGG - Intronic
911877221 1:103182093-103182115 TTTTATATATATATTTAAATGGG - Intergenic
911889591 1:103350503-103350525 ATATATATATATATATATCTTGG - Intergenic
911889592 1:103350518-103350540 ATATATATATATATATATCTTGG + Intergenic
911908450 1:103599464-103599486 ATATATATATATATATAGCAAGG - Intergenic
911914470 1:103680000-103680022 ATATATATATATATATAGCAAGG + Intronic
912127257 1:106554769-106554791 GTGTATATATATATCTCAGTAGG + Intergenic
912132345 1:106619027-106619049 ATATATATATATATTTAGACGGG - Intergenic
912328028 1:108787263-108787285 GTGTATATAAAAATCCAGCTAGG - Intronic
912561365 1:110554037-110554059 ATATATATATATAATTAGCCAGG - Intergenic
912762683 1:112383017-112383039 ATATATATATATAATTAGCCAGG + Intergenic
912989558 1:114471465-114471487 GTGTTTATTTAAATTTAGCAGGG - Intronic
913016483 1:114741736-114741758 GTCAATATATATTTTTAGCTTGG + Intronic
913033341 1:114934857-114934879 GGGTACATATATATTTAGGATGG - Intronic
913323031 1:117603226-117603248 GTATATATATATTTTTTTCTTGG - Intergenic
913323098 1:117604167-117604189 TTGGATATATATATATACCTAGG - Intergenic
913397412 1:118387209-118387231 GTATATATATATATATTGGTGGG - Intergenic
914739278 1:150450309-150450331 ATGTATTTATTTATTTAGCCGGG + Intronic
915182566 1:154075307-154075329 GTGTATATATATGTATACGTGGG - Intronic
915242576 1:154533868-154533890 ATATATATATATATATGGCTGGG - Intronic
915698897 1:157772034-157772056 ATATATATATATATTTAGCAGGG + Intronic
915847330 1:159280184-159280206 GTGTGTATATATATATATATGGG + Intergenic
916302036 1:163286033-163286055 CTGTATATATATATATAGTGGGG - Intronic
916392502 1:164345897-164345919 ATATATATATATATATAGCCAGG + Intergenic
917056040 1:170982732-170982754 ATGTATATTTTTAATTAGCTGGG + Intronic
917207680 1:172594974-172594996 GTGCATATATGTATTTAGGATGG + Intronic
917228030 1:172804605-172804627 GTGTATATTTTTGTTTGGCTTGG - Intergenic
917960339 1:180138843-180138865 GTGTGTATATATATATAAGTGGG + Intergenic
917960347 1:180138957-180138979 GTATATATATATATATAAGTGGG + Intergenic
918411773 1:184266211-184266233 GTGCATATAAAAATTTGGCTAGG - Intergenic
918532530 1:185539009-185539031 GTGTATACATATATGTATATCGG - Intergenic
918760291 1:188396135-188396157 ATGTATATATATATATAACATGG + Intergenic
919000792 1:191828583-191828605 GTGCATATATATATATATATGGG + Intergenic
919009254 1:191938493-191938515 GTATATATATATATATATATAGG + Intergenic
919043255 1:192419953-192419975 GTGTATATACATATGTAGGTAGG + Intergenic
919169959 1:193940962-193940984 GTATATATATATATATATGTGGG - Intergenic
919548657 1:198956612-198956634 GTATATATATATATTTACAATGG + Intergenic
919553230 1:199018985-199019007 GTGTATATATATATTTATTTTGG + Intergenic
919580103 1:199360997-199361019 GTGTGTATATATATATATATAGG + Intergenic
919674816 1:200370773-200370795 ATGAATATATATATATAGATGGG + Intergenic
919890220 1:201967011-201967033 GTGTGTATATATATATAGTGAGG + Intronic
920744301 1:208611742-208611764 ATCTATCTATCTATTTAGCTAGG - Intergenic
920856353 1:209665753-209665775 GTGTTTATTTTTATTTAGATGGG + Intergenic
921412301 1:214848838-214848860 GTGTATATATATATATATGAGGG - Intergenic
921658902 1:217775682-217775704 CTATATATATATATATAGATCGG - Intronic
921786112 1:219231512-219231534 GTGTATATATATGTATATGTGGG + Intergenic
922282926 1:224143095-224143117 ATATATGTATTTATTTAGCTGGG - Intronic
922394860 1:225187389-225187411 ATGTATATAGATATATATCTGGG + Intronic
922736542 1:227985945-227985967 CTATATATATATATGTAGCAAGG + Intergenic
923218105 1:231868722-231868744 ATATATATATATATTTAGCTGGG + Intronic
923417575 1:233778646-233778668 ATATATATATATATATATCTCGG + Intergenic
923615293 1:235532291-235532313 GTATATATATATATATGGTTTGG - Intergenic
923642383 1:235778090-235778112 ATATATATATATATTTAACTGGG - Intronic
923787428 1:237081508-237081530 GTATATATATATATATATGTGGG - Intronic
924225733 1:241920243-241920265 ATATATATATATAATTAGCTGGG - Intergenic
924393204 1:243586509-243586531 GTGTATATATATATATGCCATGG + Intronic
924660270 1:246009461-246009483 GTGAATATATATTTTTAACTGGG + Intronic
924693788 1:246378636-246378658 GTGTATATATATATATATGAAGG - Intronic
924807586 1:247373556-247373578 ATATATATATATATTTAGCCGGG + Intergenic
1063438268 10:6051812-6051834 ATATATATATATATATAGCTGGG - Intronic
1063456681 10:6187994-6188016 ATATATATATATATGTAGGTAGG - Intronic
1063571415 10:7217483-7217505 GCGCATGTATATATTTAGCCAGG + Intronic
1063622011 10:7658303-7658325 ATGTATATATATATTTTGGGTGG - Intronic
1063802386 10:9595044-9595066 ATATATATATATATATATCTTGG + Intergenic
1063879007 10:10511459-10511481 GTGTATATATATTTATATATGGG + Intergenic
1064134909 10:12742139-12742161 GTGTATATATATTTTTAGACAGG + Intronic
1064232706 10:13543510-13543532 ATATATATATATATATACCTTGG - Intergenic
1064434717 10:15301339-15301361 ATATATATATATATATAGCTGGG - Intronic
1064438454 10:15331749-15331771 GTGTATGTATATATATATGTGGG + Intronic
1064438456 10:15331795-15331817 GTGTATATATGTATATATGTGGG + Intronic
1064672077 10:17725390-17725412 GTGTATACATATATATATATAGG + Intergenic
1064842499 10:19610584-19610606 GTGTATATGCATACTTATCTGGG + Intronic
1064852050 10:19719149-19719171 GTATATATATATATATAATTTGG - Intronic
1065030902 10:21584712-21584734 GTGTATATATATTTATATGTAGG + Intronic
1065364313 10:24920315-24920337 GTGTATATATATATATACCATGG + Intronic
1065382703 10:25105761-25105783 ATTTATATATTCATTTAGCTTGG + Intergenic
1065457152 10:25918681-25918703 GTGTATATATATGTATATATAGG - Intergenic
1065606628 10:27424813-27424835 ATCTATATATATATATAGATAGG - Intergenic
1066641526 10:37558892-37558914 GTGTGTATATATATATATCTTGG + Intergenic
1067106082 10:43367462-43367484 GTGTATATATATATATATATGGG - Intergenic
1067155526 10:43778304-43778326 GTATATATATATATTTAGGTTGG + Intergenic
1067360818 10:45576574-45576596 GTGTATACATAGATGTTGCTAGG + Intronic
1067820614 10:49526145-49526167 ATATATATATATATATATCTGGG + Intronic
1067916538 10:50406008-50406030 GTGTATATATATATTTAGGTGGG - Intronic
1068190770 10:53649725-53649747 GTGTGTATATATATTTATACAGG + Intergenic
1068249285 10:54416122-54416144 GTGTATATATATATTTAGCTTGG - Intronic
1068249646 10:54421951-54421973 ATATATATATATATTTAGGGAGG + Intronic
1068281283 10:54873570-54873592 GTGTGTATATATATATATGTTGG + Intronic
1068459108 10:57303194-57303216 GTGCATAAAAATATTTTGCTAGG + Intergenic
1068459186 10:57304617-57304639 GTGTATCTATATATTTGTTTTGG + Intergenic
1068463150 10:57352870-57352892 ATATATATATATATATTGCTAGG + Intergenic
1068478470 10:57559103-57559125 GTGTATATATAAATATATATAGG - Intergenic
1068832564 10:61513871-61513893 GTGTGTATATATTATTACCTGGG + Intergenic
1069006550 10:63323830-63323852 GTGTATACATATATATATATAGG + Intronic
1069067940 10:63963810-63963832 GTGTATATGTATATGTATATAGG + Intergenic
1069245459 10:66199760-66199782 ATATATATATATATATAGCCAGG - Intronic
1069251511 10:66272684-66272706 GAGTATATATATGTATGGCTTGG - Intronic
1070245508 10:74727978-74728000 ATATATATATATATTTAGCCAGG + Intergenic
1070311099 10:75274586-75274608 GTGTATATATATATATATAATGG - Intergenic
1070426352 10:76291851-76291873 GTGTATATTTTCATTTTGCTGGG + Intronic
1071083705 10:81842950-81842972 GTGTATATATATATATAAAATGG - Intergenic
1071086040 10:81869846-81869868 TTGTGTATATAGATATAGCTAGG - Intergenic
1071148363 10:82601920-82601942 CTATATATATATAGTTAACTAGG + Intronic
1071312722 10:84358617-84358639 ACATATATATATATTTAGATAGG - Intronic
1071466147 10:85941688-85941710 TTGTGCATATATATTTAGATAGG - Intronic
1072220322 10:93321795-93321817 ATGTATGTATATGTATAGCTTGG + Intronic
1072501799 10:96025205-96025227 ATATATATATATATATAGCTGGG + Intronic
1073877220 10:107938851-107938873 GTGTATATATATATACACCATGG - Intergenic
1073972975 10:109065644-109065666 ATATATATATATATATTGCTAGG - Intergenic
1074119126 10:110480234-110480256 GTGTATGTATATATATAGTCTGG - Intergenic
1074172288 10:110953734-110953756 ATATATATATATATTTTGATAGG + Intronic
1074309742 10:112312155-112312177 ATGTGTATTTCTATTTAGCTAGG - Intergenic
1074991778 10:118715197-118715219 GTGTATATATATATTTTTAGTGG - Intronic
1075285059 10:121176723-121176745 GTGTATATATATATATATTCAGG - Intergenic
1076012130 10:126997624-126997646 GTGTATATATATATACTGGTGGG - Intronic
1076142687 10:128092190-128092212 ATGTTTATATAGATTTAGGTTGG - Intergenic
1077738093 11:4813013-4813035 ATGTATATATATATATATATGGG + Intronic
1078024781 11:7684469-7684491 GTGTATATATATATATATATAGG - Intergenic
1078310236 11:10233538-10233560 ATATATATATATATTTGGTTAGG - Intronic
1078813840 11:14799623-14799645 GGGTACATATATATTTAGGATGG + Intronic
1078980805 11:16531493-16531515 GTTGATATATATATTAAGCAAGG - Intronic
1079188183 11:18255756-18255778 ATGTATATATATATGTATATTGG + Intergenic
1079462844 11:20699326-20699348 GTGTATACATATATATACCTTGG - Intronic
1079520369 11:21319483-21319505 ATATATATATAAATTTAGCTGGG - Intronic
1079715577 11:23739454-23739476 TTGTACATATATATTTTTCTAGG + Intergenic
1079918461 11:26400835-26400857 ATATATATATATATTCATCTAGG - Intronic
1080155224 11:29103107-29103129 ATGTATTTATTTATTTAGATGGG + Intergenic
1080315659 11:30945383-30945405 GTGCATATATATATATAACTTGG - Intronic
1080616413 11:33948541-33948563 GTATATATATATATTTAGTGTGG + Intergenic
1080884262 11:36350897-36350919 ATATATATATATATTTACCATGG - Intronic
1081139180 11:39476391-39476413 GTATATATATATATTTTTTTTGG + Intergenic
1081302870 11:41474543-41474565 ATGTATATTTATTTATAGCTGGG + Intergenic
1081332066 11:41815365-41815387 GTGTGTATGTATGTTTAGATGGG - Intergenic
1081390269 11:42520953-42520975 GTGTATATATGTATATATGTTGG + Intergenic
1081464958 11:43307945-43307967 ATGTATATATATATATATATTGG + Intergenic
1081987773 11:47319106-47319128 ATATATATATATATTTTCCTTGG - Intronic
1082752581 11:57035171-57035193 GTATATATATATATTTGGGAGGG - Intergenic
1082752583 11:57035175-57035197 GTGTGTATATATATATATTTGGG - Intergenic
1082921546 11:58500497-58500519 GTGTATATATATATAAAATTTGG + Intergenic
1083011308 11:59402495-59402517 AAGTATATGTATATATAGCTTGG - Intergenic
1084498481 11:69519945-69519967 ATATATATATATATATAGCTGGG + Intergenic
1084719887 11:70898259-70898281 GTGTGTGTATATATTTGGCCAGG - Intronic
1084782842 11:71422345-71422367 AGGTATATATATATTTACATGGG - Intergenic
1085470624 11:76755244-76755266 TTATATATATATATATATCTGGG + Intergenic
1085819940 11:79781496-79781518 GTGTGTGTATATATTTGGCAGGG + Intergenic
1085881465 11:80471997-80472019 GTGAATATATATGCGTAGCTTGG - Intergenic
1085928219 11:81047842-81047864 GTATATATATATATGAAGATTGG - Intergenic
1085928222 11:81047993-81048015 GTGTATATATATATGAAGTTTGG - Intergenic
1085928223 11:81048038-81048060 GTGTATATATATATGAATATTGG - Intergenic
1085928225 11:81048128-81048150 GTATATATATATATGAAGATTGG - Intergenic
1085928227 11:81048220-81048242 GTGTATATATATATGAAGATTGG - Intergenic
1085928228 11:81048265-81048287 GTGTATATATATATGAATATTGG - Intergenic
1085928231 11:81048384-81048406 GTGTATATATATATGAAGATTGG - Intergenic
1085928232 11:81048429-81048451 GTGTATATATATATGAAGATTGG - Intergenic
1085928234 11:81048472-81048494 GTATATATATATATGAAGATTGG - Intergenic
1085928244 11:81048879-81048901 GTGTATATATATGTGAAGATTGG - Intergenic
1086052254 11:82607066-82607088 CTGTATATATATTTTTAAATAGG + Intergenic
1086057334 11:82662318-82662340 GTGTATATATATATATTTTTTGG - Intergenic
1086983504 11:93224320-93224342 ATGTATATACATATTTATATAGG - Intergenic
1087302575 11:96453163-96453185 GTGTATATATATATAGGGTTTGG + Intronic
1087457755 11:98408700-98408722 GTATAAATATATATTCAGATTGG - Intergenic
1087540501 11:99511734-99511756 GGGTGCATATATATTTAGCATGG + Intronic
1087939019 11:104071387-104071409 GTGTATATATATATATAATATGG + Intronic
1088398672 11:109398620-109398642 GTGTGTATATATATATAGATAGG + Intergenic
1088495385 11:110426793-110426815 ATGTATATATATATGGACCTAGG - Intergenic
1088589034 11:111386590-111386612 GTGTATATACATATTTTCCTTGG + Intronic
1088668422 11:112117825-112117847 ATGTATATATATATAAAGGTCGG - Intronic
1088999175 11:115035365-115035387 ATCTACATATATATTTAGCAAGG - Intergenic
1089714587 11:120345743-120345765 CTGTATATATATATATATTTAGG - Intronic
1090041106 11:123292348-123292370 GTGTATTTATATATTTAAGTTGG - Intergenic
1090090397 11:123691802-123691824 GTTTATAAATATAATTATCTGGG - Intergenic
1090285888 11:125498573-125498595 ATGTATATATATATATGTCTTGG + Exonic
1090705542 11:129333097-129333119 ATATATATATATATTTAGCCAGG + Intergenic
1091084214 11:132705062-132705084 GTGTATTTATTTATTTTACTTGG + Intronic
1091432045 12:444621-444643 GTGTATATTTTTATTTATCTTGG - Intergenic
1092311463 12:7359983-7360005 GGGAATGTATATATTTAGTTTGG + Intronic
1092316500 12:7421185-7421207 GTGTATATATGTATATATATGGG + Intronic
1092382393 12:8007833-8007855 GTGTATATATATATTTAAATAGG - Intergenic
1092582481 12:9858686-9858708 GTGTATATATATATGTATATAGG + Intronic
1092758388 12:11786355-11786377 GCGTATATATATCTTTAATTAGG - Intronic
1092912232 12:13156540-13156562 TTGTATATATTTACATAGCTGGG + Intergenic
1092945152 12:13447195-13447217 ATGGATATATATATTTTGATAGG - Intergenic
1093017195 12:14166516-14166538 GTGCATATATATATATATATAGG + Intergenic
1093058638 12:14580006-14580028 AAATATATATATATATAGCTAGG - Intergenic
1093221185 12:16422263-16422285 CTATCTATATATATTTATCTTGG + Intronic
1093318164 12:17677605-17677627 GTGTATATTTGTATTTATGTGGG + Intergenic
1093459847 12:19398121-19398143 ATATGTATATATATATAGCTAGG + Intergenic
1094029942 12:26000294-26000316 GTGTATATGAATATCTATCTTGG + Intronic
1094121331 12:26977800-26977822 GTGTGTATACATATATAGGTAGG + Intronic
1094686158 12:32717577-32717599 TTTTATATATATATCTACCTAGG - Intronic
1094686160 12:32717610-32717632 TTTTATATATATATCTACCTAGG - Intronic
1094686162 12:32717643-32717665 TTTTATATATATATCTACCTAGG - Intronic
1094686164 12:32717676-32717698 TTTTATATATATATCTACCTAGG - Intronic
1094686166 12:32717709-32717731 TTTTATATATATATCTACCTAGG - Intronic
1094686168 12:32717742-32717764 TTTTATATATATATCTACCTAGG - Intronic
1095728871 12:45483052-45483074 TTATATATATATATTTATATGGG + Intergenic
1096872923 12:54605466-54605488 ATATATATATAAAATTAGCTGGG - Intergenic
1097446257 12:59675912-59675934 CTATATATATATATATATCTGGG - Intronic
1097490785 12:60268445-60268467 GTGTGTATATATATGTATATGGG - Intergenic
1097671117 12:62539685-62539707 GTTTATATAATTATCTAGCTAGG - Intronic
1097768808 12:63556676-63556698 ATATATATATAAAATTAGCTGGG + Intergenic
1097785165 12:63751308-63751330 ATATATATATAAAATTAGCTGGG + Intergenic
1097968522 12:65607489-65607511 GTGTTTAGATATATTTATGTGGG + Intergenic
1098187417 12:67912370-67912392 ATATATATATTTATTTATCTGGG - Intergenic
1098485062 12:71011075-71011097 TTATATATATATATATAGCGGGG - Intergenic
1098794096 12:74866496-74866518 ATATATATATATATATAGCCAGG - Intergenic
1098914399 12:76241900-76241922 GTATATATATATATAGTGCTAGG - Intergenic
1099248684 12:80225006-80225028 GTGTATATACATATATATATGGG - Intronic
1099461663 12:82929579-82929601 GTGTTGAGATATATTTAGTTGGG - Intronic
1099869021 12:88322694-88322716 ATATATATATATATATATCTGGG - Intergenic
1100066746 12:90656131-90656153 ATGTATATATATATATATATAGG + Intergenic
1100461575 12:94804879-94804901 GTGTATAGAAACATTTTGCTGGG + Intergenic
1100543598 12:95580636-95580658 GTGTCTATGTATATGTAGGTGGG + Intergenic
1100545414 12:95597471-95597493 TTATATATATATATGTAGCTGGG + Intergenic
1101907955 12:108841846-108841868 ATATATATATATATATAGCTAGG + Intronic
1102024481 12:109706304-109706326 GCATATATATATATATATCTTGG + Intergenic
1102282862 12:111632250-111632272 ATGTATATATATATATATGTAGG + Intergenic
1102445746 12:113001341-113001363 GTATATATATATTTTTTGGTTGG - Intronic
1102749938 12:115283882-115283904 GTGTATATATATATATATCTGGG - Intergenic
1103148064 12:118612445-118612467 TTATATATATATATATAGCTGGG + Intergenic
1103218328 12:119221372-119221394 GTGTATATATATATTTTTTATGG - Intergenic
1103477329 12:121228455-121228477 GTATATATATATATATAACATGG + Intronic
1103483639 12:121267815-121267837 ATGTATATAGATATTTAGGGAGG - Intronic
1103538038 12:121646885-121646907 ATGTATGTATATATTTATTTGGG - Intergenic
1103597726 12:122034227-122034249 ATATATATATATATATATCTTGG + Intronic
1104395293 12:128427424-128427446 GTGTGTATATATATTTAAGGAGG + Intronic
1104403825 12:128500822-128500844 TTGCATATATATATATATCTGGG - Intronic
1105312618 13:19226395-19226417 GTGTATATATATATTTTTTGAGG - Intergenic
1105774483 13:23644829-23644851 GTGTATATATATATATATTTGGG + Intronic
1105873721 13:24534953-24534975 GTGTATATATATATGTATATGGG + Intergenic
1106200631 13:27533764-27533786 GTGTATATATATATATATACAGG - Intergenic
1106292020 13:28372586-28372608 ATATATATATATATATAGCTGGG + Intronic
1106352384 13:28945176-28945198 GTGTATATATATATATATAATGG - Intronic
1106389759 13:29323679-29323701 GTGTATATTTATAAATACCTAGG + Intronic
1106572712 13:30941862-30941884 GTGTATATATATATACACCATGG - Intronic
1106862478 13:33924727-33924749 GTATATATATATATATATCAGGG + Intronic
1106894418 13:34283056-34283078 ATATATATATATATTTATTTAGG + Intergenic
1107091348 13:36484400-36484422 GTGTATATATATATATATGTAGG - Intergenic
1107168767 13:37315205-37315227 GGGTGTATATATATTTAGGATGG + Intergenic
1107414177 13:40186062-40186084 GTGTATATATATATGTATGTTGG + Intergenic
1107704165 13:43082843-43082865 GTGTGTATATATATATATATAGG - Intronic
1107704166 13:43082910-43082932 GTGTATATATATATGAAATTTGG + Intronic
1108633083 13:52305381-52305403 GTGTATATATATATATATATAGG - Intergenic
1109141441 13:58717493-58717515 ATATATATATATATTAAGTTTGG + Intergenic
1109148482 13:58813701-58813723 GTGTATGTATATATATGACTTGG - Intergenic
1109349965 13:61166773-61166795 GTATATATATATAGGTAGATAGG - Intergenic
1109393326 13:61721749-61721771 GTGTATATATACTGTTAGCAAGG + Intergenic
1109470400 13:62796885-62796907 ATATATATATATATATGGCTGGG + Intergenic
1109550424 13:63890772-63890794 GTGTATATATATATATATCTGGG + Intergenic
1109660495 13:65452554-65452576 CTATATATATATATATATCTTGG - Intergenic
1109755600 13:66755532-66755554 GTGGACATCTATATTTAGGTGGG - Intronic
1110096303 13:71526706-71526728 GTATATATATATATATATATAGG + Intronic
1110110013 13:71734100-71734122 GTGTATATATATATGTATATGGG + Intronic
1110168899 13:72476156-72476178 GTTTATGTATATCTTTATCTTGG - Intergenic
1110233094 13:73187123-73187145 GTGTGTATATATATATATGTAGG + Intergenic
1110508336 13:76316435-76316457 GTGTATATATATTTAAAACTAGG + Intergenic
1110755801 13:79172325-79172347 ATGTATATATATATATACCATGG - Intergenic
1111183264 13:84695951-84695973 ATATATATATAAAATTAGCTGGG + Intergenic
1111252896 13:85628007-85628029 ATATATATATATATATAGTTTGG - Intergenic
1111378950 13:87420393-87420415 GGGTATATACATATTTATATTGG + Intergenic
1111502422 13:89139143-89139165 GTGTGTATATATATATAGATAGG - Intergenic
1111530826 13:89535875-89535897 GTATATATATATATATATATCGG + Intergenic
1111790452 13:92848655-92848677 GTCTATATATATCTTAAGCTGGG + Intronic
1111822608 13:93231425-93231447 GTATATATATATATATAGTCTGG + Intronic
1112052800 13:95660459-95660481 GTCTATAGAAATATTTATCTTGG + Intergenic
1112104190 13:96222898-96222920 GTGTATATATATGTTTCAGTGGG + Intronic
1112181011 13:97080611-97080633 GTTTATTTATTTATTTAGATAGG + Intergenic
1112647042 13:101345758-101345780 ATATATATATATATTTAGAGAGG + Intronic
1112818838 13:103307005-103307027 GTGTATATATATATGTATATAGG + Intergenic
1112841662 13:103586894-103586916 GTGTATATATATATATATAAAGG + Intergenic
1112907389 13:104441477-104441499 ATGTATCTATATATTTAGATAGG - Intergenic
1112934211 13:104779292-104779314 TTGTATATGTATTTTTAGTTTGG + Intergenic
1113132894 13:107057895-107057917 GTATATATATATATATATATGGG - Intergenic
1113319331 13:109217501-109217523 ATATATATATATATTAAGCTGGG + Intergenic
1113601336 13:111570749-111570771 GTATATATATATATGGAGTTAGG - Intergenic
1113736443 13:112681804-112681826 ATATATATATATTTTTAGCCGGG - Intronic
1114046984 14:18883773-18883795 ATATATATATATATATATCTGGG - Intergenic
1114117230 14:19635672-19635694 ATATATATATATATATATCTGGG + Intergenic
1114137798 14:19872464-19872486 GTGTATATATATATATAAATAGG - Intergenic
1114137800 14:19872526-19872548 GTGTATATATATATATAAATAGG - Intergenic
1115287619 14:31733169-31733191 GTTTATATATATAGATAGGTAGG + Intronic
1115480263 14:33853637-33853659 ATATATATATATATGTGGCTTGG + Intergenic
1115853877 14:37609253-37609275 ATATATATATAAAATTAGCTGGG + Intronic
1115884933 14:37960575-37960597 GTATATATATATATTCATTTGGG - Intronic
1116051665 14:39811338-39811360 GAATATATATATATTCATCTAGG + Intergenic
1116115071 14:40637520-40637542 ATGTATATATATATGTATATTGG + Intergenic
1116132665 14:40877204-40877226 GTATATATATATATATATATGGG - Intergenic
1116133884 14:40895960-40895982 ATATATATATATATATAGTTGGG + Intergenic
1116310255 14:43316558-43316580 TTATATATATATATTTAATTTGG - Intergenic
1116313929 14:43362457-43362479 GTGTGTATATAAATATAGATAGG - Intergenic
1116631799 14:47345145-47345167 TTTAATATATATTTTTAGCTAGG + Intronic
1116981742 14:51178203-51178225 GTGTATATATATATTCATTATGG + Intergenic
1117405869 14:55402957-55402979 ATATATATATATAAATAGCTGGG + Intronic
1117551162 14:56837736-56837758 GTGCACATATATATTTATGTTGG + Intergenic
1117587267 14:57222695-57222717 GGGTATATATATATATATATGGG - Intronic
1118044463 14:61951793-61951815 GTATATATATATTTTAAGATAGG + Intergenic
1118100647 14:62597676-62597698 GTGTTTATCTAAAATTAGCTTGG - Intergenic
1118233558 14:63977505-63977527 GTGAATAAATATTTTTGGCTGGG - Intronic
1118297391 14:64583050-64583072 ATATATATATATATATAGCTGGG - Intronic
1119056833 14:71430968-71430990 GTGTATATGTATATCTATATAGG - Intronic
1119314417 14:73680238-73680260 TAGTATTAATATATTTAGCTAGG + Intronic
1119499768 14:75114966-75114988 GTGTATATATGTATATGACTTGG - Intronic
1119630967 14:76231891-76231913 TTATATATATATATTTATATGGG - Intronic
1120045903 14:79805682-79805704 ATGTATATATATATTTTCCATGG + Intronic
1120067870 14:80065722-80065744 ATGTATATTTATAGTTAGATAGG + Intergenic
1120120256 14:80670407-80670429 GTGTATGTATATAAATAGGTAGG - Intronic
1120366482 14:83577808-83577830 ATATATATATATATATATCTTGG - Intergenic
1120385029 14:83833963-83833985 ATATAGATATATATTTACCTTGG - Intergenic
1120385366 14:83839080-83839102 TTGTGTATATATGTTTAGATGGG - Intergenic
1120484822 14:85099894-85099916 GTATATATATATATATATGTTGG + Intergenic
1120549220 14:85848634-85848656 GTGTATATATATATATATAAAGG + Intergenic
1120569753 14:86102116-86102138 ATGTATATATATATATACCAGGG + Intergenic
1121349132 14:93159804-93159826 ATATATAAATATATTTAGCTGGG + Intergenic
1122563544 14:102634694-102634716 GTGTATATATATATATTTTTTGG + Intronic
1122655491 14:103256462-103256484 GTAAATATATATATCTATCTTGG - Intergenic
1122715594 14:103695158-103695180 TTATATATATATATATGGCTGGG + Intergenic
1123101390 14:105804006-105804028 ATATATATATATATATGGCTGGG - Intergenic
1123184121 14:106498296-106498318 GTGTGTGTATATATTTACCATGG - Intergenic
1123896425 15:24834763-24834785 ATATATATATATATATAGCCAGG + Intronic
1125060278 15:35412208-35412230 GCTTATATATATCTTTAGCGAGG - Intronic
1125064321 15:35463781-35463803 GTGTATATATATATATCCATAGG - Intronic
1125180267 15:36874945-36874967 ATATATATATATATGTAGTTGGG + Intergenic
1125353967 15:38797456-38797478 GTGTATATATATATTTAAACTGG + Intergenic
1125764951 15:42128584-42128606 ATATATATAAAAATTTAGCTGGG + Intergenic
1125793203 15:42385505-42385527 GTGTATATATATATATAATAGGG - Intronic
1125995449 15:44155582-44155604 ATGTATATATATATTTGGGGAGG - Intronic
1126012554 15:44316976-44316998 TTGAATATATATATTCAGCCTGG - Intronic
1126035387 15:44540230-44540252 ATATATATATATATATAGCCAGG - Intronic
1126267092 15:46767729-46767751 ATGTATAGATATATTTATCTTGG + Intergenic
1126460301 15:48907767-48907789 GTGTATATATATATATATGATGG - Intronic
1126469570 15:48993687-48993709 ATATATATATATATATAGCTTGG + Intronic
1126576572 15:50203025-50203047 ATATATATATATATATAGCCAGG + Intronic
1126596693 15:50390418-50390440 ATATATATATATATATAGCATGG + Intergenic
1126980261 15:54234240-54234262 GTATATATATATATATATATGGG + Intronic
1127004230 15:54547916-54547938 GTTTATATATAAATTTCCCTAGG + Intronic
1127749530 15:62019943-62019965 ATGTATATATATATATAGGCTGG - Intronic
1128021428 15:64394238-64394260 ATGTATACATATTTTTAGTTCGG + Intronic
1128042830 15:64590686-64590708 ATGTATATATATATGTATCTGGG + Intronic
1128049596 15:64652335-64652357 TTATATATATATTTTTAGCCGGG + Intronic
1128075839 15:64824948-64824970 GTGTATATATATATAGAAATTGG - Intronic
1128164274 15:65448910-65448932 ATATATATATATATTTAGCCTGG + Intronic
1128200497 15:65802407-65802429 ATATATATATAACTTTAGCTGGG + Intronic
1128422319 15:67505276-67505298 GTGTTTATAGATATTCAACTTGG - Intergenic
1128883340 15:71263326-71263348 GTATATATATATATATACCATGG - Intronic
1129001174 15:72335639-72335661 GTGTATATATATATATATGAAGG - Intronic
1129410138 15:75346208-75346230 GTGTATATATATATATATTTGGG + Intergenic
1129487211 15:75885929-75885951 GTATATGTAAATATTTGGCTGGG - Intronic
1129575149 15:76735210-76735232 ATAGATATATATATTTAGCCAGG + Intronic
1130247443 15:82264597-82264619 GAGTATATATATAGTTCACTTGG + Intronic
1130584453 15:85169753-85169775 ATATATATATATATATAGTTAGG + Intergenic
1131005484 15:88974006-88974028 ATATATATATATAGTTGGCTGGG + Intergenic
1131069196 15:89454375-89454397 GTGTATATATATATATATGTTGG - Intergenic
1131436560 15:92427332-92427354 GGGACTATATATATCTAGCTTGG + Intronic
1131708383 15:95023778-95023800 GTTTATATGTATATATAACTGGG + Intergenic
1131773397 15:95765799-95765821 TTCTATATATAAAGTTAGCTTGG + Intergenic
1131863946 15:96686711-96686733 ATATATATATATAATTAGCCAGG + Intergenic
1132401624 15:101511588-101511610 GTGTATATATATATATATATAGG + Intronic
1132401626 15:101511592-101511614 ATATATATATATATATAGGTGGG + Intronic
1132426561 15:101723018-101723040 GTGTATATAGTTAATTACCTAGG - Intronic
1132711492 16:1270836-1270858 GTGTATATATCTATCTTGCATGG - Intergenic
1133265519 16:4581172-4581194 ATATATATATATAATTAGCCAGG + Intronic
1133796238 16:9048760-9048782 GTGTGTATATATATATAGAATGG + Intergenic
1133901523 16:9979813-9979835 GTATATGTATGTATTTATCTAGG + Intronic
1134120624 16:11581797-11581819 GTGTAAATATGCATTCAGCTGGG - Intronic
1134339079 16:13328571-13328593 GTATACACATATATTTAGCCAGG - Intergenic
1134351865 16:13444977-13444999 ATATATATATATATATAGCTAGG - Intergenic
1134751086 16:16625690-16625712 AAATATATATATATTTAGCTGGG + Intergenic
1134994370 16:18727897-18727919 ATATATATATATATTTAGCTGGG - Intergenic
1135044192 16:19141399-19141421 GTGTATATATATATGTGTGTGGG - Intronic
1135208472 16:20503048-20503070 GTATATATATATATATAATTGGG + Intergenic
1135395292 16:22126710-22126732 CTGTATATATAAATTTGGCCAGG + Intronic
1135583136 16:23645078-23645100 ATATATATATATATATAGTTAGG - Intronic
1136001182 16:27294935-27294957 ATATATATATATATATAACTGGG - Intergenic
1136238484 16:28929841-28929863 ATATATATATATATATATCTCGG - Intronic
1136495606 16:30641713-30641735 ATATACATATATATTTAGCTGGG + Intergenic
1136911136 16:34145545-34145567 ATATATATATATATATAGCCAGG - Intergenic
1137298002 16:47115735-47115757 GTATATATATATATTTTGTAGGG + Intronic
1137596914 16:49730125-49730147 GTGTATATGTGTATTTGTCTGGG - Intronic
1137859146 16:51828892-51828914 GTGTATATATATGTATATATGGG - Intergenic
1137898209 16:52237058-52237080 GTGTATATATAAATATATGTGGG - Intergenic
1138115057 16:54354076-54354098 GTTTATTTATTTATTCAGCTTGG + Intergenic
1138201778 16:55094017-55094039 ATGTATGTATTTATTTAGGTTGG - Intergenic
1138755306 16:59476864-59476886 GTATATATATATATATATATTGG + Intergenic
1138885696 16:61075414-61075436 GTGTATATATATCTCTGTCTTGG - Intergenic
1138890180 16:61132301-61132323 ATGTAGCTATATATCTAGCTAGG - Intergenic
1138906741 16:61345229-61345251 GGGTATAAATATATTTATGTTGG - Intergenic
1139185655 16:64803617-64803639 ATATATATATATATATAGCCAGG + Intergenic
1139199427 16:64957633-64957655 GTATATATATATATATGGATGGG - Intronic
1139232068 16:65293246-65293268 GTGTATGTATATATATATATAGG + Intergenic
1139326803 16:66158868-66158890 GTATATATATATATAAAGATAGG - Intergenic
1139488752 16:67274569-67274591 GTGTGTATATATATATATATGGG - Intergenic
1139627288 16:68200400-68200422 GTTTATATATATATATATATGGG + Intronic
1140073370 16:71672930-71672952 GTGCATATATTTATGTAGATAGG - Intronic
1140181639 16:72725503-72725525 GTGTCAATGTATATTTACCTGGG + Intergenic
1140447416 16:75041833-75041855 ATATATATATAAAATTAGCTGGG + Intronic
1140559581 16:75962619-75962641 GTGTTTTTATTTATTTAGCTTGG - Intergenic
1140563944 16:76018765-76018787 ATGTATATATATATTTACATTGG - Intergenic
1140612228 16:76614050-76614072 GTGTATATATATAATTTAATTGG - Intronic
1140862665 16:79032120-79032142 GTGTATATATATATTTGTTAGGG + Intronic
1140862741 16:79033204-79033226 GTGTATATATATATTTGTTAGGG + Intronic
1140937044 16:79682369-79682391 GTGTATATATATATTTATTGAGG + Intergenic
1141278757 16:82611373-82611395 GTATATATATATATATATATGGG - Intergenic
1141292840 16:82736253-82736275 TTATATAAATATATTTAGTTAGG - Intronic
1142023406 16:87798854-87798876 ATATATATATATATATAGCCAGG + Intergenic
1142543264 17:678625-678647 ATATATATATATATTTAGCCAGG - Intronic
1143049446 17:4112025-4112047 ATATATATATATATTTAGACAGG - Intronic
1143413504 17:6727441-6727463 GTGTATATATATATAAAACATGG - Intergenic
1143929108 17:10402154-10402176 GTGTATATATATATATGGGTTGG + Intronic
1144066466 17:11628867-11628889 ATGTATGTATATATTTATTTTGG + Intronic
1144069525 17:11655600-11655622 GTGTGTATATATATATACATGGG - Intronic
1144222403 17:13112062-13112084 ATATATATATATATATAGCTGGG - Intergenic
1144365044 17:14535459-14535481 ATATATATATATATATAGCTGGG - Intergenic
1145003811 17:19324333-19324355 GTCTAAATATATATTTAATTTGG - Intronic
1145096497 17:20033265-20033287 GTATATATATATTTTTTGGTTGG + Intronic
1145851069 17:28097349-28097371 GTGGATATCTGTATTTAACTTGG + Intronic
1146135725 17:30319262-30319284 ATATATATATATATATAGCTGGG + Intronic
1146232453 17:31125316-31125338 TTGTATATATATATATATCTGGG + Intronic
1146250757 17:31341723-31341745 GTGTATATATATATGAACATGGG + Intronic
1147012618 17:37463443-37463465 GTGTAAATAAATATCTAGCCAGG + Intronic
1147061760 17:37885519-37885541 GTGTATATATATTTATATGTAGG - Intergenic
1147112262 17:38272013-38272035 ATATATATATATATATAGCTGGG - Intergenic
1147123128 17:38347847-38347869 ATATATATATATATTTACCTGGG - Intergenic
1147352852 17:39865423-39865445 GTGTGTATATATATTCAAGTGGG + Intergenic
1147974994 17:44242194-44242216 ATATATATATATAATTAGCTGGG - Intergenic
1148013147 17:44501936-44501958 GTATATATATATATTTCTCAGGG + Intronic
1148428055 17:47617490-47617512 ATATATATATATATATGGCTGGG - Intronic
1148588162 17:48795786-48795808 GTGTGTGTATATATTCTGCTGGG + Intronic
1149169056 17:53788188-53788210 GTTGATATAGATATTTACCTGGG + Intergenic
1149400060 17:56286865-56286887 GTGTATATATGTATATATTTGGG + Intronic
1149907248 17:60537685-60537707 ACAAATATATATATTTAGCTGGG - Intergenic
1149933082 17:60775543-60775565 ATGTATATATAGGTTTACCTTGG + Intronic
1149934778 17:60793760-60793782 GTGTATATATATATATATGATGG - Intronic
1150100945 17:62423366-62423388 GTGTGTATATATATTTTGGTTGG - Intergenic
1150430837 17:65115692-65115714 ATGTATATATATATATATTTTGG - Intergenic
1150441531 17:65195483-65195505 ATGTATATATATATTTTTATTGG + Intronic
1150662834 17:67099724-67099746 GTGTATATAAATAGATAACTGGG + Intronic
1150836840 17:68572028-68572050 ATATATATATATATGTAGCAGGG + Intronic
1151057565 17:71051006-71051028 ATATATATATATATTTAAATAGG + Intergenic
1151075539 17:71268125-71268147 ATATATATATATATTTACATAGG + Intergenic
1151411842 17:73935827-73935849 GTGTATGTATATATTTATACAGG - Intergenic
1151625963 17:75275976-75275998 ATATATATATATATATGGCTGGG + Intronic
1152606268 17:81292418-81292440 ATTTATATATATACATAGCTGGG - Intronic
1153167323 18:2277368-2277390 ATGTATATATATATATAATTAGG - Intergenic
1153172665 18:2333833-2333855 ATATATATATATATTTGCCTGGG - Intergenic
1153736560 18:8075807-8075829 GTTCATATATATTTTTAGCATGG + Intronic
1154155544 18:11941523-11941545 TTTTAAATGTATATTTAGCTGGG - Intergenic
1154947512 18:21176878-21176900 GTGTGTATATATATATATTTTGG + Intergenic
1154984864 18:21540009-21540031 ATATATATATATATATATCTAGG - Exonic
1155633231 18:27920343-27920365 GGGTATATATATATATATCAGGG + Intergenic
1155779602 18:29814202-29814224 TGGTATATATATAGTTTGCTGGG - Intergenic
1155997820 18:32350213-32350235 ATGTGTATATATATTTAGAGAGG - Intronic
1156011824 18:32505303-32505325 GTGTATATATATACTATGCAGGG - Intergenic
1156024594 18:32637670-32637692 GTGTGTATATATATATATATAGG - Intergenic
1156277919 18:35602390-35602412 GTGTATTTATATCTTTCTCTAGG + Intronic
1156357680 18:36356618-36356640 ATATATATATAAAATTAGCTGGG - Intronic
1156542519 18:37929067-37929089 GTGTATATATATATATACCATGG - Intergenic
1156973862 18:43192726-43192748 GTGTGTATATATATATATATGGG - Intergenic
1157049714 18:44148452-44148474 GTGGGTCTATATATTTAGTTAGG + Intergenic
1157885660 18:51363972-51363994 GTGTTTATATGTATTAGGCTTGG + Intergenic
1158049315 18:53196714-53196736 GTGTATAAATATATATAGAACGG - Intronic
1158208481 18:55020873-55020895 GTATACATATATATGAAGCTGGG + Intergenic
1158262689 18:55626335-55626357 GTTTCTAGATAAATTTAGCTGGG - Intronic
1158364910 18:56723329-56723351 GTGTAGATATAGATTTTGCCTGG + Intronic
1158635939 18:59158054-59158076 GTGTATATATATATATTTTTTGG + Intronic
1158736914 18:60092672-60092694 TTATATATATATATTGAGCTGGG - Intergenic
1159187750 18:65000085-65000107 ATATATATATATATATTGCTAGG - Intergenic
1159290356 18:66410729-66410751 GTGAATATATATTTTTAGCTTGG - Intergenic
1159588266 18:70302743-70302765 GTGTATATATATATACAGTTAGG - Intronic
1159665663 18:71156940-71156962 GTCAATATATATATATAGCTAGG - Intergenic
1159714331 18:71803261-71803283 GTGTATATATATATTCACAGAGG + Intergenic
1160360842 18:78276577-78276599 GTGTATATATATATATATACAGG - Intergenic
1162281514 19:9701792-9701814 ATGTGTATATATATATAGCCGGG + Intergenic
1162414305 19:10525458-10525480 GTGTATATATATATATATGCAGG + Intergenic
1162560031 19:11411781-11411803 GTGTCTACAAATAATTAGCTGGG - Intronic
1162696431 19:12480008-12480030 ATATATATATATAATTAGGTGGG + Intronic
1163669928 19:18621421-18621443 ATATATATATATAATTAACTGGG + Intergenic
1164230389 19:23282207-23282229 ATATATATTTCTATTTAGCTAGG - Intergenic
1164252228 19:23488853-23488875 GTGTATATATATATATATGTTGG + Intergenic
1164452240 19:28376696-28376718 AAATATATATATATATAGCTGGG - Intergenic
1164501674 19:28825416-28825438 GTGTATATATATATATATAAAGG - Intergenic
1164578977 19:29422659-29422681 GTGTATATATATATGTGGTGGGG - Intergenic
1164585607 19:29472333-29472355 GGATATATATATATTTAACATGG - Intergenic
1164901245 19:31926804-31926826 ATATATATATATATATAGCCAGG + Intergenic
1165239837 19:34457204-34457226 ATATATATATAAAATTAGCTGGG + Intronic
1165641601 19:37393416-37393438 GTGGGTATATATATGTAGTTTGG - Intergenic
1165763336 19:38335547-38335569 ATATATATATATATTTGGGTAGG + Intergenic
1166120180 19:40681660-40681682 ATATATATATATATTTAAATGGG - Intronic
1167020264 19:46869294-46869316 GTGTATATATATAGTTGGCCAGG + Intergenic
1167451481 19:49572676-49572698 ATATATATATATATATGGCTGGG + Intronic
1167659685 19:50789376-50789398 GTATATATATATATATGGCCAGG - Intergenic
1167905369 19:52656224-52656246 CTCTATATATATATATAGCCAGG + Intronic
1168081459 19:54013286-54013308 GTATATATATATATATATGTTGG - Intergenic
1168279325 19:55295961-55295983 ATATATATATATTTTTAGATAGG - Intronic
925540887 2:4966685-4966707 GTGTATATATATATATATACCGG - Intergenic
926268533 2:11346554-11346576 TTGTATATTTGTATGTAGCTTGG + Intronic
926500564 2:13648098-13648120 CTGTAAATATATCTATAGCTTGG + Intergenic
926866787 2:17368681-17368703 GTGAATATATATATATATTTAGG + Intergenic
927298648 2:21484645-21484667 GTATATATATATATTTAGACAGG - Intergenic
927607604 2:24501766-24501788 GTGAGTCTATATATTTATCTGGG + Intronic
928044387 2:27913582-27913604 GTGTATATATATGTAAAGCATGG - Intronic
928066565 2:28171113-28171135 ATATATATATATATATATCTTGG + Intronic
928073862 2:28244975-28244997 GCGTATATATATATTTATTGTGG + Intronic
928499446 2:31874913-31874935 GTGTACATATATATATACATAGG + Intronic
928692585 2:33816297-33816319 GTGTATACGTATATTTATATAGG - Intergenic
928780603 2:34813850-34813872 ATATATATATATATATAGCCGGG - Intergenic
928800860 2:35089743-35089765 GTAAATATGTAAATTTAGCTGGG - Intergenic
928810396 2:35217876-35217898 GTGTGTATATATATTAACATAGG - Intergenic
928852242 2:35762677-35762699 ATGTGTATATATATTTCTCTGGG + Intergenic
929602261 2:43211744-43211766 GTGTATAAATATTTGTAGATAGG + Intergenic
930146294 2:48008462-48008484 ATATATATATCTAATTAGCTGGG - Intergenic
930301749 2:49624559-49624581 ATATATATATATATTTAGAGAGG - Intergenic
930336119 2:50047919-50047941 GTATATGAATATATTTATCTCGG + Intronic
930496687 2:52154180-52154202 GTGTGTATATATATATATGTGGG + Intergenic
930639786 2:53842688-53842710 GTGTATTTTTAAATTTATCTTGG - Intergenic
930950152 2:57131552-57131574 GTGTGTATATATATTTCTCATGG + Intergenic
931022205 2:58059830-58059852 TGGTGTATATATATTTAGCAAGG + Intronic
931084093 2:58809729-58809751 ATAAATATATATATTTAGCTAGG + Intergenic
931121069 2:59220417-59220439 ATATATATATATATTTAGTCTGG - Intergenic
931431711 2:62213831-62213853 GTGTATATATATATATAATCTGG + Intronic
932072062 2:68630430-68630452 GTATATATATATATATATCAGGG - Intronic
932540362 2:72645240-72645262 GGGTGCATATATATTTAGCATGG - Intronic
933208800 2:79541326-79541348 GTGTATATATATATATATATAGG - Intronic
933431490 2:82185811-82185833 GTGTATATATATATATAAAAGGG - Intergenic
933551621 2:83784830-83784852 ATATATATATTTATTTATCTTGG + Intergenic
933798388 2:85940131-85940153 GTGAACATATATATTTTGATTGG - Intergenic
933903945 2:86870728-86870750 TTGTAGTTATATATTTAGGTGGG + Intergenic
934547445 2:95230015-95230037 GTATATATATATATATACCATGG + Intronic
935058113 2:99585290-99585312 GTTTATATATATATTCAAGTTGG + Intronic
935551239 2:104458005-104458027 GTGTGTATTTTTATTTAGTTAGG + Intergenic
935611179 2:105027297-105027319 CCGTATATATTTATTTAGCTGGG + Intergenic
935776564 2:106478245-106478267 TTGTAGTTATATATTTAGGTGGG - Intergenic
936095983 2:109530523-109530545 GTGTCTATACATATCTATCTTGG + Intergenic
936368290 2:111881406-111881428 TTGTAGTTATATATTTAGGTGGG - Intronic
936655233 2:114477525-114477547 GTATATATATATATGTATATTGG + Intronic
936680150 2:114760542-114760564 ATATATATATATATTTTCCTAGG + Intronic
937433612 2:121861875-121861897 GTGTATATATATATATACACAGG + Intergenic
937457987 2:122060184-122060206 GTGTATATATATATATAAATAGG + Intergenic
937688438 2:124724474-124724496 ATGTATATTTATCTTTAACTTGG - Intronic
937775651 2:125772524-125772546 ATGTATGTATATATTTATATAGG + Intergenic
937816750 2:126259152-126259174 ATATATATATATAATTAGCCTGG - Intergenic
937852982 2:126652027-126652049 CTGTATATATATATATAGTGTGG + Intergenic
937859066 2:126694105-126694127 ATGTATATATATATTTACCCAGG - Intronic
938979176 2:136509308-136509330 GTGTATATATATATATAAAATGG + Intergenic
939435486 2:142171622-142171644 GTGTATATATATATATTGCTTGG - Intergenic
939539044 2:143470697-143470719 GTGTATATATATGTGTTGCCTGG + Intronic
939677685 2:145092939-145092961 GTATATATATATATATATATAGG - Intergenic
939768437 2:146283565-146283587 ATGTATATATATTTAGAGCTGGG - Intergenic
940181988 2:150944248-150944270 GTGTATATATATACTTGGAGGGG + Intergenic
940606336 2:155927722-155927744 ATGTATATATATATATATATAGG + Intergenic
940630757 2:156235508-156235530 GTATATATATATATATACCATGG + Intergenic
941095277 2:161233233-161233255 TTATATAGATATATGTAGCTGGG + Intronic
941219759 2:162762293-162762315 GTGTATATATATATACATATAGG + Intronic
941356125 2:164494605-164494627 GTGTATGCATAAATGTAGCTGGG + Intronic
941633693 2:167912146-167912168 GAGCATAGATATATTTAGCATGG - Intergenic
942023276 2:171888253-171888275 ATATGTATATAGATTTAGCTGGG - Intronic
942033769 2:171990550-171990572 ATGTATATATAAAATTAGCTGGG - Intronic
942052261 2:172150929-172150951 GTGTGTATATATATATACCATGG - Intergenic
942265100 2:174216140-174216162 ACATATATATATAATTAGCTGGG + Intronic
942304699 2:174595128-174595150 ATATATATATATAATTAACTGGG + Intronic
942339940 2:174933180-174933202 GTGTATATATATAGGTATATAGG + Intronic
942405824 2:175653784-175653806 GTGTATATATATATATACCATGG + Intergenic
942497192 2:176552130-176552152 GTGTATATATATATATATGATGG - Intergenic
942779059 2:179619294-179619316 CTGTATATGTATATTTCTCTTGG - Intronic
943245673 2:185447739-185447761 GTGTATATATATATTTATGCAGG + Intergenic
943373933 2:187052309-187052331 GTGTGCATATATATTTAGGATGG + Intergenic
943388235 2:187228739-187228761 GAATATATATATTTTTGGCTAGG + Intergenic
943468262 2:188257893-188257915 GCTTAAATATTTATTTAGCTTGG - Intergenic
943525617 2:189013438-189013460 GTGTATATATATGTATATGTAGG - Intergenic
943565601 2:189512646-189512668 GCATATATATATATTCTGCTTGG + Intergenic
943567442 2:189532719-189532741 GTGTATGTATATATTACACTAGG + Intergenic
943728853 2:191280720-191280742 GTGAATAGATATATTTGGTTGGG - Intronic
943937071 2:193933402-193933424 GTGTATATACATATGTATCATGG + Intergenic
943992942 2:194720801-194720823 GTATATATATATATATACCTCGG + Intergenic
944315494 2:198281003-198281025 GTGTATAGATATATATATTTGGG - Intronic
944552295 2:200855628-200855650 GTGTATATATATAATTTTTTGGG - Intronic
944794057 2:203164244-203164266 ATATATATATATTTTTAGATGGG - Intronic
944802185 2:203247297-203247319 CTGTATATATATATTGTTCTTGG + Intronic
945117601 2:206423670-206423692 ATATATATATATATTTAGAATGG + Intergenic
945449991 2:209982937-209982959 GTGTATATATATATATACATGGG - Intronic
945738736 2:213634953-213634975 GAGTATATATATATGTACCATGG - Intronic
945875703 2:215275955-215275977 ATATATATACATATTTAACTGGG + Intergenic
946937202 2:224734579-224734601 GTGTATATATATATATATGGAGG + Intergenic
947002320 2:225470821-225470843 GTGTGTATATATATTGAGATGGG + Intronic
947294845 2:228618849-228618871 GTGTATATATATGTATGTCTTGG - Intergenic
947332988 2:229049906-229049928 GTATATATGTATATATATCTTGG - Intronic
947515424 2:230800032-230800054 GTGTATATATGTATTTTCTTTGG - Intronic
947520381 2:230841365-230841387 AATTATGTATATATTTAGCTGGG - Intergenic
947923080 2:233895478-233895500 GTGTATATATTTATTTGACCTGG - Intergenic
948117772 2:235506238-235506260 ATTTATTTATTTATTTAGCTCGG + Intronic
948146202 2:235709977-235709999 GTGTATGTTTATATTTATGTAGG + Intronic
948298449 2:236883473-236883495 ATATATATATATATATGGCTAGG + Intergenic
948674805 2:239590674-239590696 GTGTATATATATGTTTGTGTGGG - Intergenic
1169545555 20:6647018-6647040 ATGTATATGTTTATTTAGATAGG - Intergenic
1169676587 20:8161269-8161291 ATGTATGTATATATGTAGCACGG - Intronic
1170166708 20:13367076-13367098 TTTTATATAAATATTTAGCTAGG + Intergenic
1170195567 20:13685617-13685639 GTATATATATATATATACATAGG + Intergenic
1170255494 20:14338367-14338389 GTGTATATATATACATATATTGG - Intronic
1170444371 20:16410259-16410281 GTGTACATATATATATATGTAGG + Intronic
1170754118 20:19183032-19183054 GTTTATATATATATATATCTAGG + Intergenic
1170900588 20:20458855-20458877 GTATATATATATATATATATAGG - Intronic
1171955237 20:31456852-31456874 ATATACATATATATTTATCTGGG - Intergenic
1172547888 20:35775805-35775827 GTGTGTATATATATATATTTTGG + Intronic
1172547890 20:35775809-35775831 GTATATATATATATTTTGGGTGG + Intronic
1172680735 20:36712554-36712576 ATATATATATATATATAGCCGGG - Intronic
1172890688 20:38261598-38261620 GTGTATATATGTATATATATAGG - Intronic
1172890689 20:38261620-38261642 GTGTATATATGTATATATATAGG - Intronic
1173095252 20:40021220-40021242 ATATATATATATATTTAGATGGG - Intergenic
1173409908 20:42801069-42801091 ATTTATTTATATATTTATCTTGG - Intronic
1173764729 20:45597049-45597071 GTGTATATATATTTTTATCCTGG - Intergenic
1174053530 20:47783723-47783745 TTATGTATATAAATTTAGCTGGG + Intronic
1174146728 20:48457228-48457250 GTGTATGTGTATAGTGAGCTTGG - Intergenic
1174307614 20:49625518-49625540 ATATATATATAAAATTAGCTGGG - Intergenic
1174318662 20:49722855-49722877 ATATATATATATAATTAGCCAGG + Intergenic
1174347792 20:49943817-49943839 GTGTGTATATATATATAGCTGGG - Intronic
1174876285 20:54229967-54229989 GTCTCTATATATGTTTAGATTGG - Intergenic
1175023049 20:55872014-55872036 GTGTATATATATATATATAAAGG + Intergenic
1175959656 20:62629237-62629259 GTGTGTATATATATATAAATAGG + Intergenic
1176137680 20:63531452-63531474 ATATATATATATAATTAGCTGGG + Intronic
1176881382 21:14198567-14198589 GGGTACATATATATTTAGGATGG - Intronic
1177058496 21:16339957-16339979 GGTTATATATATATTTATATAGG + Intergenic
1177058497 21:16339980-16340002 TTATATATATATATTTATATAGG + Intergenic
1177219578 21:18174099-18174121 ATATATATATATATATATCTTGG + Intronic
1177399677 21:20586746-20586768 ATATATATATATATATATCTGGG - Intergenic
1177399679 21:20586786-20586808 GGGTATATATATATATATCTGGG - Intergenic
1177399685 21:20586842-20586864 ATATATATATATATATATCTGGG - Intergenic
1177525491 21:22285672-22285694 CTGTATATATATATCTATATAGG - Intergenic
1177547317 21:22575663-22575685 ATATATATATATATTTAACAGGG - Intergenic
1177607653 21:23402040-23402062 GTGTATATATATATTTGAGACGG - Intergenic
1177615536 21:23513181-23513203 CTATAAATATATATTTACCTAGG - Intergenic
1177722213 21:24922039-24922061 GTGTATATATATATTTATGGTGG + Intergenic
1177912724 21:27052285-27052307 GTGTATATATATATATAAAGGGG - Intergenic
1177996082 21:28099727-28099749 GTGTATATATATATAAAATTTGG - Intergenic
1178017477 21:28365955-28365977 GTGTATATATATATATAAAATGG - Intergenic
1178377486 21:32079374-32079396 ATGAATATATATAGTTAGTTTGG + Intergenic
1178572145 21:33748702-33748724 GTATATATATATATGAAACTGGG + Intronic
1178910922 21:36672815-36672837 GTGTATACATATATATATATAGG - Intergenic
1179623794 21:42635956-42635978 ATGAATGTATATATGTAGCTTGG - Intergenic
1179644049 21:42764833-42764855 GTATATATATATATTTTTTTGGG - Intronic
1180465518 22:15606418-15606440 ATATATATATATATATATCTGGG - Intergenic
1181193927 22:21167512-21167534 ATGTATATATATATATAATTTGG - Intergenic
1181527456 22:23498257-23498279 GTGTGTATATATATATATATAGG - Intergenic
1182126271 22:27818114-27818136 ATATATATATATATATATCTAGG + Intergenic
1182661916 22:31931216-31931238 GTGTATATATATATATAAAGGGG - Intergenic
1182992414 22:34780924-34780946 GTGAGTATATATATTTGGCAAGG - Intergenic
1184634082 22:45812458-45812480 GTGTGTGTATTTATTTATCTGGG + Intronic
1184705044 22:46205513-46205535 ATATATATATATATATGGCTGGG - Intronic
949190721 3:1245320-1245342 ATATATATATATATATAGCATGG + Intronic
949248035 3:1948104-1948126 GGTTATTTGTATATTTAGCTAGG - Intergenic
949453274 3:4211101-4211123 GTATATATATATATATATATGGG - Intronic
949709253 3:6855620-6855642 ATCTTCATATATATTTAGCTAGG + Intronic
950255015 3:11497379-11497401 ATATATATATATATTTAGCCAGG + Intronic
950571770 3:13804729-13804751 GTGCATATATATATATGCCTAGG - Intergenic
951083281 3:18478167-18478189 GTGTATATATAGATATATATAGG - Intergenic
951400474 3:22227162-22227184 GTGTATATATATGTGTATGTGGG + Intronic
951459790 3:22938786-22938808 GTCTATAAATATATATAACTGGG + Intergenic
952006926 3:28851842-28851864 GTATATATATATATATGGTTTGG - Intergenic
952121321 3:30248083-30248105 ATATATATATATATTTAGCTAGG + Intergenic
952203697 3:31157782-31157804 GTATGTATATATATTTTGCTAGG + Intergenic
952204484 3:31166656-31166678 GTATATGTATATATATGGCTGGG + Intergenic
953076584 3:39577426-39577448 ATATATATATATAGCTAGCTAGG - Intergenic
953291895 3:41673669-41673691 ATGTATATATATATATATTTAGG - Intronic
953475072 3:43198640-43198662 GTGTATAAATATATTTTGGTTGG - Intergenic
953916606 3:46924504-46924526 GTGAATAAATACATTTATCTTGG - Intronic
954376991 3:50200348-50200370 ATATATATATATATTTGGCCAGG + Intergenic
954723611 3:52587889-52587911 GTGTATATATATATATATGAGGG - Intronic
954860005 3:53679970-53679992 GTATATATAAATGTTTAGCTAGG - Intronic
954929168 3:54265672-54265694 GTGTGTATATATATATAGTGTGG + Intronic
955126895 3:56121753-56121775 GTGTATATATATTTTAAACTAGG + Intronic
955641385 3:61089199-61089221 CAGTATGTATATATTGAGCTGGG - Intronic
956031035 3:65038255-65038277 GTGTATATATATACATAAATAGG + Intergenic
956147759 3:66208744-66208766 GTGTATATATATATTTATATGGG + Intronic
956594646 3:70952828-70952850 GTGTATATATATATATATTTTGG + Intergenic
956888007 3:73579840-73579862 GTGTGTATATATATTTATATGGG + Intronic
957313196 3:78545242-78545264 GTCTTTATATAAATTTATCTGGG - Intergenic
957393216 3:79606031-79606053 GTATATATATATATATATGTGGG - Intronic
957458368 3:80483494-80483516 GTGTATATATATATGTACATAGG - Intergenic
957635803 3:82782686-82782708 GAATATATATATATTTAGTATGG - Intergenic
957793742 3:84974233-84974255 GTATATATATATATATACTTTGG + Intronic
957838232 3:85628504-85628526 GTATATATATATATGTATATGGG - Intronic
957888971 3:86330085-86330107 GTATATATATATATAGGGCTGGG - Intergenic
957888974 3:86330091-86330113 GTGTATGTATATATATATATAGG - Intergenic
957954494 3:87167333-87167355 CTGTATATATACATATAGATAGG - Intergenic
958105357 3:89065687-89065709 GTGTAAATATATATATATTTTGG + Intergenic
958258670 3:91353693-91353715 GTATATATATATATATATCTTGG + Intergenic
958559410 3:95725556-95725578 AAGTATATATATATATAGGTGGG + Intergenic
958714258 3:97760402-97760424 GTGTGTATATATATCTCTCTAGG + Intergenic
958910782 3:99991894-99991916 GTGTATATATATACATATATAGG + Intronic
959010798 3:101073604-101073626 ATGTATATATGTATATATCTGGG - Intergenic
959561094 3:107782386-107782408 GTGTATATATATAAAGAGCAAGG - Intronic
959790948 3:110360367-110360389 GTGTATATATATATGGAACTTGG + Intergenic
959916502 3:111822315-111822337 GTGTATATATATATATATAATGG + Intronic
959960304 3:112290742-112290764 GAGTGGATATATATTTAGTTAGG + Intronic
960451606 3:117816234-117816256 GTGTATATATATATAATACTAGG + Intergenic
960804063 3:121565835-121565857 ATGTGTGTATATATATAGCTGGG + Intergenic
961691474 3:128673184-128673206 ATATAGATATATATGTAGCTGGG - Intronic
961796431 3:129412206-129412228 GTGTATATATATTTTTGGGGGGG - Intronic
962258736 3:133889432-133889454 ATATATATATATATTTATTTTGG + Intronic
962413989 3:135166222-135166244 CTTTAGATATTTATTTAGCTGGG + Intronic
962451756 3:135524638-135524660 GGGTATATATACATTTATTTTGG - Intergenic
962571717 3:136720013-136720035 GTGAAAATATAAAATTAGCTGGG + Intronic
962747813 3:138410515-138410537 GTGTATACATATATTCTTCTGGG + Intergenic
962867447 3:139459460-139459482 ATATATATATATATTTAGCCAGG + Intronic
963408071 3:144893817-144893839 ATGTATATATATTGTTAGCAAGG + Intergenic
963447340 3:145429163-145429185 GTGTATATATATATATATTTGGG - Intergenic
963685423 3:148427639-148427661 ATATATATATATATATATCTAGG + Intergenic
964060181 3:152512625-152512647 GTGTATATATATATATAGTAGGG - Intergenic
964285795 3:155116588-155116610 GAGTATATATATATATATATTGG + Intronic
964418581 3:156476504-156476526 GTGTATATATATATATATGATGG - Intronic
964573385 3:158137395-158137417 ATATATATATATATTTAATTGGG - Intronic
964598289 3:158464245-158464267 GTGTATTTTTATATTTAATTTGG + Intronic
964618848 3:158700223-158700245 GTATATATATATATATAAATTGG + Intronic
964896687 3:161605307-161605329 GTGTATATATATATACATATGGG - Intergenic
964969241 3:162539668-162539690 ATATATATATATAGTTAGCCGGG + Intergenic
964975727 3:162617448-162617470 ATGTATACATATATTTGGGTTGG + Intergenic
965013853 3:163131110-163131132 GTGTATATATATATATGTATGGG + Intergenic
965235854 3:166121273-166121295 ATATATATATGTATATAGCTAGG - Intergenic
965245413 3:166260693-166260715 GTGTATATATATATTTATCCAGG + Intergenic
965285160 3:166810540-166810562 GTGGGTATATATATTTACATGGG + Intergenic
966245069 3:177798823-177798845 ATATATATATATATTTATGTTGG + Intergenic
966271403 3:178111407-178111429 GTAAATATAAATAGTTAGCTGGG + Intergenic
966447938 3:180024339-180024361 ATATATATATATATTTAGTAGGG - Intronic
966897160 3:184454137-184454159 ATATATATATATATATGGCTGGG - Intronic
967466247 3:189809116-189809138 ATGTATATATTTATTTAATTTGG + Intronic
967602006 3:191401444-191401466 GTATATATATGTATATAGCAGGG + Intergenic
968319540 3:197752706-197752728 GTGTATGTCTATATATGGCTTGG + Intronic
968323622 3:197792566-197792588 ATATATATATAAAATTAGCTGGG - Intronic
968349537 3:198041992-198042014 GTATATATATTTATTAAGCTTGG + Intronic
969165189 4:5303004-5303026 GTGTATATATATGTATATGTGGG + Intronic
969278438 4:6152808-6152830 ATACATATATATATATAGCTGGG + Intronic
970180981 4:13393462-13393484 GCTTATATATATATTTTTCTTGG - Intronic
970334161 4:15016229-15016251 GTGTATACACATATGTAACTGGG + Intronic
970765672 4:19545876-19545898 GTGTATATATATGTATATGTAGG + Intergenic
970765966 4:19549365-19549387 GTGTATATATATGTATATGTAGG + Intergenic
970873118 4:20839494-20839516 TTATATATATATATATAGATAGG + Intronic
970910018 4:21263948-21263970 ACGTATATATATATTGGGCTGGG - Intronic
971240954 4:24888255-24888277 ATCTATGTATATATTCAGCTTGG - Intronic
971252130 4:24981881-24981903 ATATATATATATATATATCTTGG - Intergenic
971401689 4:26282041-26282063 GTGTATGTATGTGTTTATCTAGG + Intronic
971547054 4:27899262-27899284 GTGTATATATATATTTATTTGGG - Intergenic
971624062 4:28896027-28896049 GGGTACATATATATTTAGGATGG - Intergenic
971758307 4:30731359-30731381 GTGTATATATATATATATGCTGG + Exonic
971759858 4:30751617-30751639 GTATATATATATATTTTGCATGG + Intronic
972030730 4:34454495-34454517 ATATATATATATATTTCTCTGGG - Intergenic
972051429 4:34739573-34739595 ATGTATATATATATATATGTTGG - Intergenic
972180576 4:36459762-36459784 GTTTATATATATATTTTTGTTGG + Intergenic
972280559 4:37598019-37598041 GTGTATATATATATGTAGGCTGG - Intronic
972506892 4:39728312-39728334 TTATATATAGATATTGAGCTGGG + Intronic
972516946 4:39817875-39817897 ATATATATATATATATAGCTGGG - Intergenic
972518663 4:39833028-39833050 ATATATATATAAAATTAGCTGGG + Intronic
972719864 4:41685217-41685239 GTCTATACACATATTTACCTGGG + Intronic
973065120 4:45780545-45780567 ATGTATATATATATTTCACTGGG - Intergenic
973912502 4:55595535-55595557 ATATATATATATATACAGCTGGG - Intronic
974182243 4:58399457-58399479 GGGTGTATATATATTTAGGCTGG + Intergenic
974308673 4:60175191-60175213 ATATATATATATATATAGTTGGG - Intergenic
974478336 4:62412198-62412220 GGGTATCTATTTCTTTAGCTTGG + Intergenic
974655521 4:64814628-64814650 ATATATATATATATGTACCTTGG + Intergenic
974874695 4:67688730-67688752 TTGTACATATATATTTAACTAGG - Intronic
974984006 4:68996170-68996192 GTATATATATATATATATCTTGG + Intergenic
975240180 4:72048113-72048135 GTGTGTATATATATATGGCAGGG - Intronic
975361016 4:73472260-73472282 GTGCATATATATATTTAGGATGG + Intergenic
975398030 4:73900429-73900451 ATATATATATATATATACCTTGG + Intergenic
975704969 4:77102865-77102887 ATATATATATATATATAGCGGGG - Intergenic
975708797 4:77138328-77138350 GTGTAAATATATATATATTTAGG + Intergenic
975858229 4:78647595-78647617 ATATATATATATTTTTAGATGGG - Intergenic
975901295 4:79156329-79156351 GTATATATATATATTCATATAGG + Intergenic
976819126 4:89185154-89185176 GTATATATATTTATTTTGCTAGG - Intergenic
976979561 4:91209824-91209846 ATCTATATAAATATTTTGCTTGG - Intronic
977027909 4:91843731-91843753 GTATATATATATATATATTTGGG + Intergenic
977133779 4:93275434-93275456 ATATATATATATATATACCTAGG + Intronic
977280526 4:95034187-95034209 GTGTGTATATATGCTAAGCTTGG - Intronic
977322090 4:95530013-95530035 TTGCATATATATTTTTAGATGGG + Intronic
977842436 4:101724921-101724943 ATATATATATATATATATCTCGG - Intronic
978147933 4:105398936-105398958 GTGAATATGTATATATAGCATGG - Intronic
978264554 4:106807364-106807386 GTGTATATGTGTAAATAGCTGGG - Intergenic
978312031 4:107395292-107395314 GTATATATAAATATATAGCAGGG - Intergenic
978418032 4:108499377-108499399 ATATATATATATATATAGCTGGG - Intergenic
978746347 4:112198795-112198817 GGGTATAATTATATTTATCTTGG - Intergenic
978783867 4:112586815-112586837 GTTTTTATATATTTTTTGCTAGG + Intronic
979060259 4:116049448-116049470 TTATATATATACATTTATCTTGG + Intergenic
979065283 4:116123668-116123690 ATTAATATATATATTTAGCTTGG - Intergenic
979613583 4:122716743-122716765 GTGTATATATATAATTTCCCTGG + Intergenic
979863141 4:125719558-125719580 ATATATATATATATGTAACTTGG + Intergenic
979868730 4:125789615-125789637 GTGTATATATATTTGCACCTGGG + Intergenic
980312970 4:131158677-131158699 GTGTATATATATAGGTAGATGGG - Intergenic
980373311 4:131908514-131908536 ATATATATATATATATAGATGGG - Intergenic
980445577 4:132902648-132902670 GTGTATATATACATATACATTGG - Intergenic
980555919 4:134404600-134404622 ATGTATATAAAAATATAGCTGGG - Intergenic
980616390 4:135231127-135231149 ATATATATATATATATAGATGGG - Intergenic
980683320 4:136192327-136192349 GTATATATATATATATATGTAGG - Intergenic
980712352 4:136585968-136585990 GTATATGTATATATATACCTGGG - Intergenic
980785751 4:137552241-137552263 ATGTATAAATATATTCACCTAGG - Intergenic
980828914 4:138105990-138106012 ATATATATAAATATTTAGGTTGG - Intergenic
980858345 4:138467983-138468005 GTGTGTATATATATTTTTATTGG + Intergenic
981365815 4:143901943-143901965 ATCTATAGATATCTTTAGCTTGG - Intronic
981541140 4:145847247-145847269 GTGTACGTATATATTTACCAAGG - Intronic
981626389 4:146760752-146760774 GTGTATATATATATATATGATGG + Intronic
981950583 4:150401843-150401865 GTGTGTATATATAATTATGTGGG + Intronic
982085308 4:151829645-151829667 GAGTATATATAAATTTTACTTGG - Intergenic
982186283 4:152804501-152804523 ATATATATATATATATAGTTGGG + Intronic
983085874 4:163443264-163443286 GTGTATCTTAATATTTATCTAGG + Intergenic
983404312 4:167307431-167307453 ATATATATATATATATAGTTTGG + Intergenic
983447370 4:167870590-167870612 GTGTGTATATATATATATATGGG + Intergenic
983546554 4:168970829-168970851 GTATATATATATATATATCATGG - Intronic
983750923 4:171269224-171269246 ATATATATATACATTTTGCTAGG + Intergenic
983775762 4:171605027-171605049 ATGTATATATATATATAAGTTGG - Intergenic
984302360 4:177938135-177938157 GTATATATATATATATAGTGTGG + Intronic
984459069 4:180009745-180009767 GTATATATATATATATATGTTGG - Intergenic
984501219 4:180561652-180561674 GTGTAAATATATAATTGGGTAGG - Intergenic
984611134 4:181839388-181839410 ATGTATATATATATGTATATAGG - Intergenic
984655510 4:182313490-182313512 GTATATATATATATTTAAAATGG - Intronic
984753823 4:183305416-183305438 GTGTGTGTATTTATTTTGCTTGG - Intronic
984970828 4:185188314-185188336 GTATATATATATATGAAGCCAGG - Intronic
985044530 4:185927207-185927229 GTGTATATATAATTTTTGTTTGG + Intronic
985093380 4:186387241-186387263 GTGTATATATATATATATGATGG + Intergenic
985262901 4:188131516-188131538 ATATATATATATATTTAGCTAGG - Intergenic
985382970 4:189414711-189414733 GTGTATATATCCCTTGAGCTAGG + Intergenic
985382973 4:189414736-189414758 GTGTATATATCCCTTGAGCTAGG + Intergenic
985382976 4:189414761-189414783 GTGTATATATCCCTTGAGCTAGG + Intergenic
985382979 4:189414786-189414808 GTGTATATATCCCTTGAGCTAGG + Intergenic
986036529 5:3945562-3945584 GTGTATATATATATATATAGTGG + Intergenic
986313198 5:6570009-6570031 GTGTATATATATATATATAAAGG + Intergenic
986440480 5:7777050-7777072 GTATATATATATATATAGAAGGG - Intronic
986553811 5:8989740-8989762 GTGTATTTATATATTTATCCAGG + Intergenic
986598322 5:9446045-9446067 GTGTTTATTTTTCTTTAGCTCGG - Intronic
986995060 5:13597503-13597525 ATGTATATATATATATAGCAAGG - Intergenic
987197462 5:15541349-15541371 GTGTATATATACATATAGTTTGG - Intronic
987285486 5:16451983-16452005 TTGTATATATACACTTATCTGGG + Intronic
987611254 5:20206649-20206671 ATGTATATATATACTTATCCTGG - Intronic
987668672 5:20980463-20980485 GTGTATATATATATATAAAGGGG - Intergenic
987705357 5:21456960-21456982 GTGTGTATATATATATATATGGG + Intergenic
987801205 5:22698672-22698694 ATATATATATATATATATCTGGG - Intronic
987801672 5:22705110-22705132 GTATATATATATATATGACTGGG - Intronic
987966371 5:24881538-24881560 GTGTATGTATATATGTATTTTGG + Intergenic
988109606 5:26801154-26801176 CTATATATATATATATATCTGGG - Intergenic
988417943 5:30969837-30969859 ACATATATATATATATAGCTTGG + Intergenic
988625989 5:32875212-32875234 GTGTGTATATATACATACCTAGG + Intergenic
988894836 5:35661380-35661402 ATATATATATATATTTATCTTGG - Intronic
989041804 5:37237230-37237252 GTGTGTATATATATGTATCATGG + Intronic
989723079 5:44552882-44552904 GTGTGTATATATATATATGTAGG - Intergenic
989807449 5:45627015-45627037 GTGTACATATATATATAACTGGG + Intronic
989995775 5:50828735-50828757 ATATATATATATATTTATCCAGG + Intronic
990452464 5:55948598-55948620 GTGTATATATATATTGATATGGG + Intronic
990477256 5:56173590-56173612 ATATATATATATATATATCTTGG + Intronic
990567728 5:57046455-57046477 GTGTATCTCTCTATTTAGTTAGG + Intergenic
990934746 5:61136025-61136047 ATATATATATATATATATCTAGG + Intronic
991206390 5:64054688-64054710 ATATATATATATATCTATCTAGG - Intergenic
991299692 5:65118176-65118198 CTTTATATATATAGTTAGATCGG + Intergenic
991379500 5:66005080-66005102 GTCTATATATATATATAGACAGG + Intronic
991643906 5:68781481-68781503 ATGTGTATATATATATAGATAGG + Intergenic
991643907 5:68781485-68781507 GTATATATATATAGATAGGTTGG + Intergenic
991962717 5:72061941-72061963 GTATATATATATATATGGCAAGG + Intergenic
992462623 5:76975956-76975978 GTGTATATATATATATATGTTGG + Intronic
992567668 5:78015292-78015314 GTGTATATATATATATGTTTAGG + Intronic
992725348 5:79601608-79601630 ATATATATATATATCTAGCCAGG - Intergenic
993046980 5:82878643-82878665 CTGTAAATATATATTCACCTAGG - Intergenic
993161793 5:84300901-84300923 GTGTGCATGTATATTTGGCTTGG - Intronic
993296474 5:86147589-86147611 GTGTATATATATCTTTGTATAGG + Intergenic
993348181 5:86812062-86812084 GTGTACATATGTATATAGGTAGG - Intergenic
993392553 5:87338490-87338512 ATATATATATAAAATTAGCTGGG - Intronic
993719084 5:91304321-91304343 GTGTATACAGAAAGTTAGCTTGG - Intergenic
994123102 5:96139485-96139507 GTGTATATATATATGTTACAAGG - Intergenic
994247250 5:97492383-97492405 ATATATATATATATTTAGCTGGG - Intergenic
994540308 5:101086810-101086832 GTGTATATATATGTGTATATGGG - Intergenic
994548051 5:101193964-101193986 GTGTGTATATGTATGTAGGTAGG - Intergenic
994645623 5:102465315-102465337 ATATATATATATATATATCTGGG + Intronic
994939172 5:106298573-106298595 ATATATATATATATATATCTCGG - Intergenic
994940920 5:106322734-106322756 ATATATATATATATTTCTCTTGG - Intergenic
994982712 5:106897490-106897512 ATATATATATATATATATCTAGG - Intergenic
995034803 5:107521451-107521473 ATATATATATATATATAGCCAGG - Intronic
995077898 5:108009219-108009241 ATATATATATATATACAGCTTGG + Intronic
995173561 5:109146274-109146296 ATATATATATATATATATCTTGG + Intronic
995701876 5:114945273-114945295 ATATATATATATATTCGGCTGGG - Intergenic
995766739 5:115627008-115627030 ATATATATATATATATAGCCTGG + Intronic
995832995 5:116374230-116374252 GTGTATATATATATATATATAGG - Intronic
995845113 5:116485093-116485115 GGGTATGTATATTTTTAGGTGGG + Intronic
995978029 5:118065634-118065656 GGGTGCATATATATTTAGCATGG + Intergenic
996066287 5:119083169-119083191 GTGTATATACAAAATTAGCCAGG - Intronic
996219032 5:120906125-120906147 GTATATATATATATATATTTAGG + Intergenic
996245658 5:121261329-121261351 GTGCATATATATATTTAGCATGG + Intergenic
996357821 5:122616398-122616420 ATATATATATATATATAGATTGG - Intergenic
996366963 5:122712639-122712661 ATATATATATATATTTCGCCAGG - Intergenic
996448763 5:123592740-123592762 CTATATATATATATATAGCATGG + Intronic
996591761 5:125155774-125155796 GTGTATATATTCATTTGCCTAGG + Intergenic
996797163 5:127360862-127360884 GTGTATATATATATATATGTTGG + Intronic
996858072 5:128032026-128032048 ATATATATATATATTTTGTTTGG - Intergenic
996942492 5:129025441-129025463 GTATATATATATATATATCCAGG - Intronic
997037296 5:130208026-130208048 GTATATATATATAGATAGGTGGG + Intergenic
997207457 5:132058195-132058217 GTGTATATATATAATTTTTTTGG + Intergenic
997243783 5:132328820-132328842 GTGTATATATATATATATAAAGG - Intronic
997815973 5:137017448-137017470 GTTTACATATATACATAGCTAGG - Intronic
998452252 5:142244157-142244179 GTTTATATATATATATATATTGG - Intergenic
998564932 5:143208453-143208475 CTGTATATATATAAATAGCATGG - Intronic
998951511 5:147397173-147397195 GTGTGTATATATATATATATAGG - Intronic
999231102 5:150062240-150062262 ATATATATATATATTTGGATGGG - Intronic
1000208540 5:159087249-159087271 GTGTATATATATATATATTAGGG - Intronic
1000239012 5:159391801-159391823 CTCTCTATATATATTTAGTTTGG + Intergenic
1000292830 5:159886856-159886878 ATGTATATATATATTTACAGAGG - Intergenic
1000385805 5:160673682-160673704 GTTTATTTATATATTTAGGGTGG + Intronic
1000402372 5:160844189-160844211 GTATATATATATATTTCTGTTGG - Intronic
1000471362 5:161646065-161646087 ATATATATATATATATAGCTGGG + Intronic
1000568955 5:162886507-162886529 GTGTATATATGTATGTATATAGG + Intergenic
1000641521 5:163708497-163708519 GTATATATATATATATATTTAGG - Intergenic
1000794966 5:165653733-165653755 TTGTAGATATATATTTATGTGGG + Intergenic
1001997169 5:176171691-176171713 GTATATATATAAAATTATCTGGG - Intergenic
1002290454 5:178196848-178196870 GCTTATTTATTTATTTAGCTAGG - Intergenic
1002375536 5:178786451-178786473 GTGTATAAATATATTTCCCCCGG + Intergenic
1002848938 6:974167-974189 GTGTATATATATATATACCATGG + Intergenic
1002848943 6:974243-974265 GTGTATATATATATATATATGGG + Intergenic
1002918718 6:1550103-1550125 GTATATATATATTTTTAGACAGG - Intergenic
1002951755 6:1819785-1819807 ATATATATATATATCTACCTTGG + Intronic
1002963475 6:1939566-1939588 GTGTGTATATATATGTATATAGG - Intronic
1003022594 6:2524090-2524112 GTCTATATCTTCATTTAGCTTGG - Intergenic
1003028944 6:2583867-2583889 GTGTATATATATATATATGATGG - Intergenic
1003103020 6:3191929-3191951 GTATATATATATATTTTTTTTGG + Intergenic
1003876222 6:10439840-10439862 GTGTGTATATACATTTAGAGAGG - Intergenic
1004262409 6:14119432-14119454 ATGTATGTAAATATTTACCTTGG - Intronic
1005216881 6:23539838-23539860 ATATATATATATATATAGATGGG - Intergenic
1005320908 6:24652722-24652744 GTGTGTATATATATATATATAGG - Intronic
1005744567 6:28824279-28824301 ATATATATATATATATAGCGTGG - Intergenic
1006226475 6:32541802-32541824 GTTTACATATATTTTTAGTTTGG + Intergenic
1006774345 6:36580407-36580429 ATAAATATATATATATAGCTGGG - Intergenic
1007040623 6:38718553-38718575 ATGTATTTATATATTTATTTTGG + Intronic
1007083422 6:39125442-39125464 GTGTGTATATATATATATTTGGG - Intergenic
1008281007 6:49596078-49596100 GGATATATATATATATATCTTGG + Intergenic
1008281024 6:49596379-49596401 GGATATATATATATATATCTAGG + Intergenic
1008285061 6:49639602-49639624 TTGTATCTGTGTATTTAGCTGGG - Intergenic
1008314143 6:50018540-50018562 GTGGATTTATATATTTACGTGGG + Intronic
1008838805 6:55872776-55872798 ATGAATATATAAATTTTGCTAGG + Intronic
1009274941 6:61663513-61663535 ATATATATATATATGCAGCTGGG + Intergenic
1009320617 6:62284178-62284200 TTGTATGCATTTATTTAGCTTGG + Intronic
1009347268 6:62630040-62630062 ATATATATATGTATATAGCTAGG - Intergenic
1009760918 6:68004475-68004497 GTATATATATATATATAGCCAGG + Intergenic
1009819623 6:68783283-68783305 ATATATATATATATTTAGGGAGG - Intronic
1009912978 6:69956383-69956405 CTATATATATATTTTTAACTTGG + Intronic
1009964327 6:70562759-70562781 ATGTATATATATATTTGAGTTGG - Intergenic
1009988414 6:70810476-70810498 GTGGATATATATATTTCCATGGG - Intronic
1010398350 6:75418723-75418745 GTTTATTTATATATTTTTCTTGG - Intronic
1010451320 6:76006456-76006478 GTGTATATACATATGTATATAGG + Intronic
1010656810 6:78521142-78521164 AAATATATATATATGTAGCTTGG - Intergenic
1011341570 6:86321014-86321036 ATATATACATATATATAGCTTGG - Intergenic
1011520737 6:88202274-88202296 GTGTAAATATATATGCACCTAGG + Intergenic
1011893730 6:92198437-92198459 ATATATATATATATTTAGCCAGG - Intergenic
1011909565 6:92419751-92419773 GTGTATATATATATCTTGATTGG - Intergenic
1012110094 6:95219314-95219336 ATGTATATATATATTTTTGTTGG - Intergenic
1012238039 6:96839944-96839966 ATATATATATATATTCAACTTGG + Intergenic
1012272154 6:97226699-97226721 GTGTGTATATATATGTATGTAGG + Intronic
1012272155 6:97226703-97226725 GTATATATATGTATGTAGGTAGG + Intronic
1012693703 6:102352170-102352192 CTATGTATATATATTTCGCTAGG - Intergenic
1012726144 6:102813276-102813298 ATATATATATATATGTAGTTTGG + Intergenic
1012798917 6:103800563-103800585 GTGGATTTATGTAATTAGCTTGG - Intergenic
1012820389 6:104079593-104079615 GTATATATATATATATATATGGG - Intergenic
1012876035 6:104727105-104727127 GTGTGTATATATATGTATATGGG + Intergenic
1012895183 6:104939975-104939997 ATATATACACATATTTAGCTTGG - Intergenic
1012923288 6:105242275-105242297 GTGTATATATTTAGTTACTTTGG + Intergenic
1012994496 6:105959998-105960020 ATATATATATATAATTAGCTGGG - Intergenic
1013199293 6:107877117-107877139 GTGTATATATATATTTTAGAAGG + Intronic
1013210735 6:107984450-107984472 GTGTATATATATATTAGGCTAGG + Intergenic
1013467126 6:110427548-110427570 ATATATATATATTCTTAGCTTGG + Intronic
1013839520 6:114373958-114373980 GTGTATATATATAAATACATTGG + Intergenic
1013853762 6:114546409-114546431 ATATATATATATATTTAGTTAGG - Intergenic
1014066427 6:117132353-117132375 GTGTATATATATATATAAAGGGG + Intergenic
1014649772 6:124021693-124021715 ATGTATAGATATATATAGATGGG - Intronic
1014656450 6:124111392-124111414 GTGCATATATATGTTTATCATGG + Intronic
1014733555 6:125064838-125064860 GTGTGTATATATATATAGTTAGG + Intronic
1014788277 6:125642928-125642950 ATATATATATATATATAGTTTGG + Intergenic
1015091670 6:129365707-129365729 AAGTATATAAATTTTTAGCTTGG - Intronic
1015109165 6:129571424-129571446 GTGTACATATATATTTAGGATGG - Intergenic
1015133254 6:129837872-129837894 GTGTGCATATATATTTAGGATGG - Intronic
1015407292 6:132852189-132852211 ATATATATATATATTTCTCTTGG + Intergenic
1015467354 6:133561661-133561683 GTGTATATATATATATATATAGG + Intergenic
1015601337 6:134913932-134913954 GTGTATATATACATATACCATGG - Intergenic
1015901099 6:138068416-138068438 ATGTATATATATATCTATCTTGG + Intergenic
1015925452 6:138305448-138305470 GTATATATATACATATAGCTGGG + Intronic
1016203305 6:141440368-141440390 GTGCACACATATATTTATCTTGG + Intergenic
1016862873 6:148738975-148738997 ATATATATATATATATAGCCGGG + Intergenic
1016954979 6:149617992-149618014 ATATATATATAAAATTAGCTGGG + Intronic
1017148542 6:151256943-151256965 GTTTATATATATATATAGGCCGG - Intronic
1017431874 6:154379441-154379463 GTGTGTATATATATAATGCTTGG + Intronic
1017505676 6:155066673-155066695 GTGTATATATATAATTTTTTTGG + Intronic
1017578096 6:155828887-155828909 ATATATATATATATATTGCTGGG + Intergenic
1017613636 6:156219212-156219234 GTGTATATATATTTATATATTGG - Intergenic
1017637602 6:156457907-156457929 GAGTATATATGGCTTTAGCTTGG + Intergenic
1018010258 6:159663353-159663375 GTGTATATATATATATATGATGG - Intergenic
1019065573 6:169293642-169293664 GTGTATATATATATTTGAGATGG + Intergenic
1019909494 7:4090781-4090803 ATGTACATATATCTATAGCTAGG + Intronic
1019964396 7:4486815-4486837 GTGCATATATTTGTTTTGCTTGG - Intergenic
1020273835 7:6613326-6613348 ATATATATATATATATAGTTTGG - Intergenic
1020531027 7:9335780-9335802 ATATATATATATATATAGCCAGG - Intergenic
1020553219 7:9634570-9634592 GTGTACATACATATATATCTTGG + Intergenic
1020594854 7:10193520-10193542 GTGTATATATATTTTTGAATGGG - Intergenic
1020789698 7:12611750-12611772 GTATAAATAAATATATAGCTAGG + Intronic
1020798842 7:12708773-12708795 GTATATATAAATATATAGGTAGG - Intergenic
1020811242 7:12852728-12852750 GTATAAATATTTATTTTGCTTGG + Intergenic
1020937746 7:14488665-14488687 GTATATATATAAAATTAGCTCGG + Intronic
1020973180 7:14972894-14972916 GTGTATACATACATATAGGTGGG + Intronic
1021259577 7:18437527-18437549 GTGTATATATATATATAATCTGG + Intronic
1021290559 7:18838566-18838588 GAGTATATACATATATAGATGGG - Intronic
1021330113 7:19326539-19326561 GTATATATATATATTAAGTGTGG - Intergenic
1021460245 7:20878902-20878924 GTTTATATATGTATTCAGCAAGG - Intergenic
1021695820 7:23275383-23275405 ATATATATATATATGTAGTTAGG - Intergenic
1021729538 7:23583159-23583181 ATATATATATATATATGGCTGGG - Intergenic
1021814070 7:24430828-24430850 ATATATATATATATATGGCTGGG + Intergenic
1022128596 7:27381172-27381194 ATATATATATATATTTGGATTGG - Intergenic
1022349813 7:29557430-29557452 TTGAATTTATATCTTTAGCTTGG - Intergenic
1022372182 7:29782441-29782463 GGATATAAATATATTTAGGTAGG + Intergenic
1022380610 7:29856035-29856057 ATGTATGTATATATGTAGATAGG + Intronic
1022748167 7:33194029-33194051 CTGGAGATATTTATTTAGCTTGG + Intronic
1022863350 7:34390981-34391003 ATATATATATATATATAGCTTGG - Intergenic
1022954052 7:35365195-35365217 GATTATATCCATATTTAGCTGGG - Intergenic
1023151991 7:37210501-37210523 GTGTGTATATATATATATTTGGG + Intronic
1023461714 7:40404939-40404961 GTGTCTTTATAGAATTAGCTGGG + Intronic
1024140555 7:46459128-46459150 GTCTATTTATATATCTAGTTAGG + Intergenic
1024173871 7:46818507-46818529 ATATATATATATATTTAGGAAGG - Intergenic
1024289201 7:47788556-47788578 ATATATATATATATATAACTGGG - Intronic
1024718602 7:52108545-52108567 GCCTTTATATATATGTAGCTTGG + Intergenic
1025728771 7:64091632-64091654 GTGTGTATATATATATATATGGG + Intronic
1025791815 7:64695099-64695121 ATGTATATATATATTTATTTGGG - Intronic
1026294968 7:69043399-69043421 GTGTATATATATATATTTATAGG - Intergenic
1027252083 7:76405262-76405284 ATATATATATATAATTAGCTGGG - Intronic
1027360828 7:77407779-77407801 ATATATACATATATTTAGCAAGG + Intronic
1027748608 7:82111251-82111273 GTGTGTATATATATATATCAAGG - Intronic
1027862603 7:83604576-83604598 GTGTGTATATATATATATGTTGG - Intronic
1027931336 7:84538697-84538719 GCATATATATATATATATCTGGG + Intergenic
1027986870 7:85304116-85304138 ATATATATATATATATAGCCTGG + Intergenic
1028094424 7:86742641-86742663 GAGTTTAGATATATTTAGGTAGG + Intronic
1028302631 7:89220177-89220199 GTGTATATATATATATCCTTGGG + Intronic
1028807426 7:95044703-95044725 ATATATATATTTAATTAGCTGGG - Intronic
1028812932 7:95109138-95109160 GTGTATATATATTTTGGTCTAGG + Intronic
1028935353 7:96457806-96457828 GTGTATACATATATATATTTGGG - Intergenic
1029607450 7:101607755-101607777 GTGTATATATATATATATATGGG - Intergenic
1029975894 7:104832960-104832982 GTATATATATATATATATCCTGG + Intronic
1030101628 7:105951792-105951814 GTGTATATAATAGTTTAGCTGGG - Intronic
1030289079 7:107854600-107854622 GTGAAAATATAGATGTAGCTGGG + Intergenic
1030519525 7:110580713-110580735 ATGTATATATATATATAGGAAGG + Intergenic
1030584739 7:111403442-111403464 ATATATATATATATATACCTGGG - Intronic
1030911503 7:115256270-115256292 ATATATATATATATTTAGCCGGG - Intergenic
1031510706 7:122645665-122645687 ATATATATATATATATATCTTGG + Intronic
1031535165 7:122924920-122924942 GTATATATATATATATATATGGG - Intergenic
1031677473 7:124628637-124628659 GTATATATATATATATATATGGG - Intergenic
1031911843 7:127525412-127525434 GTATATATATCTATATATCTAGG - Intergenic
1032030094 7:128476229-128476251 GTGTGTATATATATTTTGGTTGG - Intergenic
1032065943 7:128770792-128770814 ATATATACATATATTTATCTTGG - Exonic
1032118356 7:129136722-129136744 ACATATATATATATTCAGCTGGG + Intergenic
1032144339 7:129365626-129365648 GAGTATATATATATATATATGGG + Intronic
1033081049 7:138297647-138297669 GTGCATATGTATATTTGGATTGG - Intergenic
1033113965 7:138608955-138608977 GTGTATATATATGTGTGGGTGGG - Intronic
1033187368 7:139240421-139240443 ATATATATATATATTTAGGCTGG - Intronic
1033270106 7:139923164-139923186 ATATATATATATAATTAGCCAGG + Intronic
1033754417 7:144386206-144386228 ATGAATATATATATTGAGATAGG + Intergenic
1034058316 7:148059765-148059787 TTATATATATATATTTAGTAAGG + Intronic
1034297074 7:149983447-149983469 GTGTATATATATATATATGTAGG + Intergenic
1034637918 7:152581939-152581961 ATATATATATATATAAAGCTGGG + Intergenic
1035007119 7:155673455-155673477 GTGTATGTATATATATATGTGGG - Intronic
1035906763 8:3520019-3520041 GTATATATATATATATATATAGG - Intronic
1036146812 8:6261597-6261619 ATATATATATATAATTAGCTGGG + Intergenic
1036395350 8:8365789-8365811 GTGTGTATATATATATATATAGG - Intronic
1036987478 8:13551866-13551888 GTATATATATATATATAGACAGG + Intergenic
1037072515 8:14669195-14669217 ATATATATATATATATAGCTGGG + Intronic
1037303870 8:17484161-17484183 GTATATATATGTATTTTGCAAGG - Intergenic
1037357491 8:18037547-18037569 GTGTATATATATATTTTGGCTGG + Intergenic
1037461941 8:19119751-19119773 ATATATATATATATATAGCCAGG - Intergenic
1037598283 8:20372890-20372912 ATGTATATATAGATATAGATAGG + Intergenic
1037699444 8:21261394-21261416 GTGTATATATATACATACATTGG - Intergenic
1038020234 8:23546618-23546640 GTGTATATATATATATATTTGGG + Intronic
1038052953 8:23830599-23830621 GTGTATATATATATATATGATGG - Intergenic
1038144827 8:24885730-24885752 ATATATATATATATATAGCCAGG + Intergenic
1038179111 8:25209999-25210021 ATATATATATATAATTAGCCGGG - Intronic
1038724119 8:30064528-30064550 ATATATATATATATATGGCTAGG - Intronic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1038821963 8:30960524-30960546 ATATATATATATAATTAGCTAGG + Intergenic
1038963071 8:32543240-32543262 GTGTCAATATATATGTATCTGGG - Intronic
1039164420 8:34661186-34661208 CTGTATATATATATATGGCAAGG - Intergenic
1039215948 8:35271757-35271779 ATGTATACATATATTTACATAGG + Intronic
1039297851 8:36176554-36176576 TTGTATATAAATATTATGCTTGG + Intergenic
1039932275 8:42004102-42004124 GTGTATAAGGATATTTAGTTAGG + Intronic
1040822395 8:51577416-51577438 GTGTATATATGTATATAGAGAGG + Intronic
1041251871 8:55942260-55942282 GTGTGTATATATATATAGTGGGG - Intronic
1041470804 8:58206681-58206703 ATGTATATATTTATTTATTTTGG + Intergenic
1041479425 8:58302085-58302107 GTGAATATATATTTTTATTTTGG - Intergenic
1041720861 8:60974116-60974138 GTGTAGGGATATATTCAGCTGGG + Intergenic
1041861933 8:62524217-62524239 ATATATATATATATTTTGGTGGG - Intronic
1041964780 8:63663423-63663445 CTTTATATATTTATTTAACTAGG + Intergenic
1042236185 8:66615305-66615327 ATGTATATATATATCTCGTTTGG - Intergenic
1042247295 8:66720783-66720805 ATATATATATATAATTAGCCAGG + Intronic
1042395295 8:68285266-68285288 AAATATATATATATTTAGATAGG - Intergenic
1042714507 8:71757960-71757982 GTGTATATATATATAGAGAAAGG - Intergenic
1042717226 8:71787396-71787418 ATATATATATAAAATTAGCTGGG + Intergenic
1042735468 8:71983087-71983109 GTGTATATATATATATAGCTAGG + Intronic
1042880804 8:73486608-73486630 GTGTATATATATATATATAATGG - Intronic
1042890619 8:73605810-73605832 GTGTATATATATCTGTGTCTGGG - Intronic
1043228190 8:77761589-77761611 TTATATATATATATTTACCTTGG - Intergenic
1043244888 8:77985389-77985411 GTGTATATATATATGTGTGTGGG - Intergenic
1043618123 8:82153202-82153224 GTGTACATATATATTCATTTTGG + Intergenic
1043677237 8:82972874-82972896 GGGTATATATATATATATATGGG + Intergenic
1043723616 8:83579973-83579995 GTGTAAATATATGTTTATCAGGG + Intergenic
1043750731 8:83930463-83930485 CTGTATATGTATATAGAGCTCGG + Intergenic
1043758792 8:84037928-84037950 ATATATATATTTATTTATCTTGG + Intergenic
1043925222 8:86029300-86029322 GTCCAGATGTATATTTAGCTTGG + Intronic
1044333488 8:90948175-90948197 GTGCATATATATGTTTTCCTAGG - Intronic
1044446942 8:92289308-92289330 GTGGAAATATATATTTATGTGGG + Intergenic
1044497027 8:92898857-92898879 ATATATATATATATATAGATGGG + Intronic
1044714673 8:95089460-95089482 GTGTATATATATATATAAAAGGG + Intronic
1044768643 8:95605345-95605367 GTTTTCTTATATATTTAGCTAGG + Intergenic
1045079690 8:98612006-98612028 ATGTATTTATTTATTTAGCAAGG - Intronic
1045097736 8:98815979-98816001 ATATATATATATATATAGATGGG - Intronic
1045190989 8:99883372-99883394 AGATATATATATAGTTAGCTGGG - Intronic
1045464836 8:102460348-102460370 ATATATATATATATGTAGCCAGG + Intergenic
1045560045 8:103252747-103252769 GTATAGATATTGATTTAGCTTGG - Intergenic
1045922089 8:107543148-107543170 ATGTATATATATTCTTAGTTTGG + Intergenic
1045951901 8:107861551-107861573 GTGGTTATATATATTTACCACGG - Intergenic
1046004768 8:108465238-108465260 GTGTATATATATCTTTAGTTGGG + Intronic
1046197157 8:110880861-110880883 ATATATATATATAGTTAGTTAGG - Intergenic
1046243909 8:111533366-111533388 ATATATATATATAATTAGCCAGG - Intergenic
1046304231 8:112341728-112341750 GTGTATATTTATGTTTAATTCGG - Intronic
1046403473 8:113739749-113739771 GTGTGTATATATATATATCAAGG - Intergenic
1046500571 8:115071075-115071097 GTGTGTATATATATATATATGGG - Intergenic
1046653123 8:116861711-116861733 ATGCATATATATATTTATATAGG - Intronic
1046929804 8:119830678-119830700 ATGTATGTATATATTTACTTAGG - Intronic
1047029212 8:120858436-120858458 ATATATATATATATATAGCTGGG + Intergenic
1047433206 8:124810704-124810726 ATGCATATGTTTATTTAGCTGGG + Intergenic
1047950899 8:129933711-129933733 GTGAAAATATAAAATTAGCTGGG + Intronic
1048754538 8:137722526-137722548 GTGTATATATATATATATATGGG + Intergenic
1048787520 8:138066088-138066110 GTGTATATATATATATATCAAGG - Intergenic
1048809788 8:138275532-138275554 GTGAATATATAAAATTAGCTGGG + Intronic
1050003693 9:1105203-1105225 GTGTATATATATATATATAAAGG - Intergenic
1050179981 9:2911563-2911585 GTGTGTATATATATGTGGATAGG + Intergenic
1050360744 9:4828613-4828635 AGGTATAAATATATTTAGATTGG + Intronic
1050773877 9:9236252-9236274 GTGTATTTATTTATTTATTTTGG - Intronic
1050906018 9:11007003-11007025 GTATATATATATATGTATATGGG + Intergenic
1051019721 9:12528104-12528126 ATATATATATATAATTAGCTGGG - Intergenic
1051019901 9:12531206-12531228 TGGTATATATATATTTCCCTTGG - Intergenic
1051206778 9:14696292-14696314 GTGTATATGTGTACTTTGCTGGG - Intergenic
1051307605 9:15730622-15730644 GTATATATATTTATATAGTTTGG - Intronic
1051411136 9:16790759-16790781 GAGGCTCTATATATTTAGCTAGG - Intronic
1051425170 9:16925007-16925029 GTGTGTATATATATATATGTGGG + Intergenic
1051863684 9:21654532-21654554 GTGTATAGATAGATTTATTTTGG + Intergenic
1052213848 9:25940277-25940299 TTATATATATATATATATCTAGG + Intergenic
1052344000 9:27390080-27390102 GTGTATATATATATTTGAGACGG + Intronic
1052405002 9:28048262-28048284 CTGTATTTATAGATTTAGTTGGG - Intronic
1052453607 9:28664784-28664806 ATGTAGATATATTTTAAGCTGGG - Intronic
1052522836 9:29571698-29571720 GTATATATATATATTAAAATAGG + Intergenic
1053638304 9:40038685-40038707 GTGTATATATATATATAGATGGG - Intergenic
1053767780 9:41426535-41426557 GTGTGTATATATATATAGATGGG + Intergenic
1053853503 9:42313996-42314018 ATATATATATATATATAGTTTGG + Intergenic
1054319097 9:63635284-63635306 GTGTGTATATATATATAGATGGG - Intergenic
1054546446 9:66338039-66338061 GTATATATATATATATAGATGGG + Intergenic
1054570721 9:66807642-66807664 ATATATATATATATATAGTTTGG - Intergenic
1054841043 9:69740179-69740201 GTGTATACATATATGTATATAGG + Intronic
1054889922 9:70240199-70240221 GTGTATATATATACGTATCATGG + Intergenic
1054930697 9:70632049-70632071 GTGTGCATATATATTTAACCTGG - Intronic
1055093657 9:72388269-72388291 ATATATATATATATATAGCTGGG + Intergenic
1055354229 9:75420820-75420842 GTGTCTATGTATATTTAGATAGG - Intergenic
1055370280 9:75591061-75591083 CTGTTTATATATTTTTAGGTTGG + Intergenic
1055902193 9:81253558-81253580 ATATATATATATATATATCTAGG - Intergenic
1055918133 9:81428149-81428171 TTTGATATATATATTTTGCTGGG - Intergenic
1055922121 9:81472074-81472096 ATATATATATATATATAGCGGGG + Intergenic
1055926086 9:81511238-81511260 ATATATATATATAATTAGCTGGG - Intergenic
1056163004 9:83916608-83916630 GTTTATATATATTTTTAGCCAGG - Intronic
1057375290 9:94516039-94516061 ATATATATATATATATTGCTGGG - Intergenic
1057419576 9:94899955-94899977 TTGAATCTATATATTTGGCTGGG - Intronic
1057996876 9:99827286-99827308 GTGTGTATATATATATATATGGG + Intronic
1057996878 9:99827290-99827312 GTATATATATATATATGGGTGGG + Intronic
1058035183 9:100244466-100244488 CTGTATATATATATTAAATTTGG - Intronic
1058214019 9:102210010-102210032 ATCTATTTAGATATTTAGCTTGG + Intergenic
1059048958 9:110901980-110902002 GTTTATATTTATACTTAGCTGGG - Intronic
1059127468 9:111705154-111705176 GTGTGTATATATATTCTGATAGG - Intronic
1060458740 9:123827401-123827423 ATATATATATATATATAGGTGGG + Intronic
1060805557 9:126573794-126573816 GTATATATATATATTTGGCTGGG - Intergenic
1060907826 9:127323754-127323776 GTATATATATATATTTATGGGGG - Intronic
1060907828 9:127323756-127323778 GTGTATATATATATATTTATGGG - Intronic
1060951201 9:127604543-127604565 ATATATATATATATTTGGCTGGG + Intergenic
1061102702 9:128504384-128504406 ATATATATATATATTTACCTAGG + Intergenic
1061128739 9:128694106-128694128 GTATATATATATATATAGTGTGG + Intronic
1061323321 9:129846222-129846244 ATATATATATATATATGGCTGGG - Intronic
1061956466 9:133964305-133964327 GTGTATATATATATATATCAGGG - Intronic
1185454303 X:300706-300728 GTGTATATATATATTTTTTGAGG + Exonic
1185483690 X:466778-466800 ATATATATATATATATAGCCAGG - Intergenic
1185488676 X:502128-502150 GTGTATATGTGTATTTAGTGTGG - Intergenic
1186010771 X:5130491-5130513 GTCTATATCTATATATAGATAGG + Intergenic
1186064369 X:5745610-5745632 ATATATATATATAATTATCTTGG - Intergenic
1186810900 X:13187650-13187672 ATGTATATATATATATGGTTTGG + Intergenic
1187134848 X:16537861-16537883 ATATATATATATATTTGGATGGG - Intergenic
1187208733 X:17208196-17208218 ATATATATATATAATTAGCTAGG + Intergenic
1187544602 X:20236082-20236104 ATGTATATATTTATTTAGAATGG - Intronic
1188545128 X:31297047-31297069 GTGTATGTATATAGTAAGCATGG + Intronic
1188680581 X:32998596-32998618 GTGTATATATATATATAAATAGG - Intronic
1188704588 X:33311154-33311176 GTGTATCTATATATTAAAGTAGG - Intronic
1188971991 X:36629359-36629381 ATATATATATATATATAGGTGGG + Intergenic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1189272761 X:39762852-39762874 CTATATATATATATATAGCCAGG - Intergenic
1189485998 X:41432532-41432554 GTGTATATATATATTTTTTGAGG - Intergenic
1189662800 X:43320791-43320813 GTGTGTATATATATATACCATGG - Intergenic
1189781602 X:44519438-44519460 GTGTATATTTATGCTCAGCTGGG + Intergenic
1189950812 X:46228849-46228871 ATATATATATATATATAGCTGGG + Intergenic
1190101994 X:47528952-47528974 TTATATATATAAACTTAGCTGGG + Intergenic
1190127111 X:47716007-47716029 GTGAAGATTTAGATTTAGCTGGG + Intergenic
1190156579 X:47998243-47998265 ATGTATATAAAAAATTAGCTAGG - Intronic
1190996301 X:55613267-55613289 GTGGATATATATATATATCAGGG + Intergenic
1191039489 X:56064155-56064177 GTGTATATATATATATATGCAGG + Intergenic
1191131506 X:57017515-57017537 GTGTACATATATACTTATATAGG + Intergenic
1191745459 X:64482059-64482081 GGGTGCATATATATTTAGGTTGG + Intergenic
1191858869 X:65649673-65649695 GTGTATATATATATAAAATTGGG + Intronic
1192565806 X:72162526-72162548 ATATATATATATATATAGCTGGG + Intergenic
1192598176 X:72433601-72433623 GTGTATATAAGTACTTATCTGGG + Intronic
1192616476 X:72628573-72628595 ATATATATATATATTTATATGGG - Intronic
1192640286 X:72855978-72856000 GTGTTTCTATGTATTTACCTTGG - Intergenic
1192641425 X:72864798-72864820 GTGTTTCTATGTATTTACCTTGG + Intergenic
1192869847 X:75174820-75174842 GTGTAGATAGAAATTTACCTTGG + Intergenic
1192899009 X:75474430-75474452 GTGTATATATATATATATAAAGG - Intronic
1193398825 X:81018232-81018254 GGGTACATATATATTTAGGATGG + Intergenic
1193420959 X:81281280-81281302 GGATGTATATATATCTAGCTAGG - Intronic
1193447491 X:81621511-81621533 GTGTATATATATATATAAAGGGG - Intergenic
1193591856 X:83398223-83398245 GGGTGTATATATATTTAGGATGG - Intergenic
1193618015 X:83713687-83713709 GTGTGTATATATATCTATGTTGG + Intergenic
1193814575 X:86089664-86089686 GTGTATATATATATATAGTATGG - Intergenic
1193842615 X:86426151-86426173 GTGTACACATAAAGTTAGCTAGG + Intronic
1193891549 X:87051644-87051666 GTGTGTATATATATATAAATAGG - Intergenic
1193922147 X:87442634-87442656 ATATATATATATATATATCTGGG + Intergenic
1193989685 X:88291117-88291139 GTGTATATATATATACACCATGG - Intergenic
1194107542 X:89790398-89790420 GTATATATATATATATATATAGG - Intergenic
1194279427 X:91930490-91930512 GTATATATATATATTTGGAGAGG - Intronic
1194414411 X:93592775-93592797 TTGTATATAGATTTTAAGCTTGG - Intergenic
1194701912 X:97124806-97124828 GTGTATATATGTATATACATGGG + Intronic
1194759675 X:97780660-97780682 GTATAAATATATATTTTGCTTGG + Intergenic
1194814998 X:98430425-98430447 TTGTATATATGTATGTAGGTAGG - Intergenic
1194970230 X:100334860-100334882 GTATATATATATATATATGTTGG + Intronic
1195398369 X:104435412-104435434 GTGTAAATAAATAATTGGCTGGG - Intergenic
1195778513 X:108434761-108434783 ATATATATATATATATATCTTGG - Intronic
1195991777 X:110690341-110690363 GAATATATATATATGTGGCTGGG - Intronic
1196205771 X:112937711-112937733 ATGTATATATATATTTAGCCGGG + Intergenic
1196219353 X:113093895-113093917 GTGTATATATATATATATAGTGG + Intergenic
1196433139 X:115649130-115649152 CTTTATATATATAATTACCTAGG - Intronic
1196434367 X:115661533-115661555 ATATATATATATATTTAGCTGGG + Intergenic
1196492429 X:116283939-116283961 GTGTGTATATATATATATATAGG - Intergenic
1196492433 X:116284043-116284065 GTGTATATATATATATATATAGG + Intergenic
1196518048 X:116637117-116637139 ATATATATATATATTTTGTTTGG - Intergenic
1196666609 X:118323655-118323677 CTTGATATATATATTTAGCAGGG - Intergenic
1196696988 X:118623862-118623884 GTGTATATACATATCTGGCGAGG + Intronic
1196744574 X:119058533-119058555 GTATATATACATATTTGGTTTGG + Intergenic
1196972650 X:121126248-121126270 TTTTATATATATATATATCTGGG + Intergenic
1197018244 X:121653878-121653900 GTGTGTATATATATATACATAGG - Intergenic
1197722922 X:129756991-129757013 ATATATATATATATATAGCTGGG - Intronic
1197825063 X:130580479-130580501 GTCTCTATATTTGTTTAGCTTGG - Intergenic
1198012952 X:132577955-132577977 GTGTGTATACATATTTATGTAGG + Intergenic
1198122700 X:133609872-133609894 GTGTATCTATATACTTGCCTTGG + Intronic
1198237691 X:134750961-134750983 ATTTATATATATATATAGCCTGG + Intronic
1198244916 X:134821086-134821108 GTGTATATATATATATATATGGG + Intronic
1198539514 X:137621846-137621868 ATATATATATATATTTAATTGGG + Intergenic
1198602479 X:138298729-138298751 GTATATATATATATATATTTGGG - Intergenic
1198838127 X:140826297-140826319 ATATATATATATATATAGCATGG - Intergenic
1198909444 X:141596942-141596964 GTGTGTATATATATAAATCTCGG - Intronic
1198965168 X:142220816-142220838 GTGTATATATATATTTAAACAGG + Intergenic
1199085594 X:143626503-143626525 GTGTGTATATATATATATGTGGG - Exonic
1199088233 X:143657050-143657072 GTGTGTGTATATATATAGGTAGG - Intergenic
1199179608 X:144838358-144838380 GTGTATATATATATATATGATGG - Intergenic
1199511104 X:148623607-148623629 ATATATATATATATTTAACTTGG + Intronic
1200370200 X:155716996-155717018 ATATATATATATATATAGCTGGG + Intergenic
1200596904 Y:5153988-5154010 GTATATATATATATTTGGAGAGG - Intronic
1200786949 Y:7269157-7269179 GTGTGTATATATATATATATGGG - Intergenic
1200834004 Y:7715105-7715127 ATATATAAATATATTAAGCTTGG - Intergenic
1201428102 Y:13876045-13876067 GTTTATACATATATGTAGCATGG - Intergenic
1201495460 Y:14588111-14588133 GTGAATAATTATAATTAGCTAGG + Intronic
1201622117 Y:15971284-15971306 GTGTGTATATATATATATTTAGG + Intergenic
1201905008 Y:19078564-19078586 GTGTGTATATATATATAGATGGG + Intergenic
1201969687 Y:19777839-19777861 ATGTATATATAAAATCAGCTGGG + Intergenic
1202330414 Y:23746168-23746190 ATGTATATATATATGTATATTGG + Intergenic
1202540355 Y:25923893-25923915 ATGTATATATATATGTATATTGG - Intergenic
1202590914 Y:26482242-26482264 ATATATATATATAATTAGCTGGG - Intergenic