ID: 1068250785

View in Genome Browser
Species Human (GRCh38)
Location 10:54437047-54437069
Sequence CTAATTAGACAGGTGTGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 144}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068250785_1068250790 0 Left 1068250785 10:54437047-54437069 CCTTGTCACACCTGTCTAATTAG 0: 1
1: 0
2: 2
3: 6
4: 144
Right 1068250790 10:54437070-54437092 CACGGACTCTAAATTGAGGAGGG No data
1068250785_1068250792 14 Left 1068250785 10:54437047-54437069 CCTTGTCACACCTGTCTAATTAG 0: 1
1: 0
2: 2
3: 6
4: 144
Right 1068250792 10:54437084-54437106 TGAGGAGGGGAGCCCTAAAAAGG No data
1068250785_1068250788 -4 Left 1068250785 10:54437047-54437069 CCTTGTCACACCTGTCTAATTAG 0: 1
1: 0
2: 2
3: 6
4: 144
Right 1068250788 10:54437066-54437088 TTAGCACGGACTCTAAATTGAGG No data
1068250785_1068250791 1 Left 1068250785 10:54437047-54437069 CCTTGTCACACCTGTCTAATTAG 0: 1
1: 0
2: 2
3: 6
4: 144
Right 1068250791 10:54437071-54437093 ACGGACTCTAAATTGAGGAGGGG No data
1068250785_1068250789 -1 Left 1068250785 10:54437047-54437069 CCTTGTCACACCTGTCTAATTAG 0: 1
1: 0
2: 2
3: 6
4: 144
Right 1068250789 10:54437069-54437091 GCACGGACTCTAAATTGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068250785 Original CRISPR CTAATTAGACAGGTGTGACA AGG (reversed) Intronic
901161973 1:7184899-7184921 CTTATTAGACTGGTGGTACATGG - Intronic
901960953 1:12826196-12826218 CTGATGATACAGGTGTGTCAGGG - Intronic
902724543 1:18325983-18326005 CCAATTACACAGGTGTGAGGAGG + Intronic
904096488 1:27982291-27982313 TTAATTAGCCAGGTGTGGCCAGG - Intronic
904683351 1:32243912-32243934 AAAATTAGCCAGGTGTGGCATGG + Intergenic
907018299 1:51039602-51039624 TCAATTAGACAGGTGAGAAATGG - Intergenic
907569096 1:55466591-55466613 CTAATTAGCCAAGTTTGCCAAGG + Intergenic
908741447 1:67332870-67332892 CTAGTTAGAGATGTGTGAAAAGG + Intronic
909512217 1:76466452-76466474 CTAATTTGACAGATGTAAAATGG - Intronic
910729134 1:90371812-90371834 CAAATTAGGTAGCTGTGACAGGG + Intergenic
911060469 1:93743595-93743617 CAAATTAGACAGGTGTCTCAAGG - Intronic
912853146 1:113144445-113144467 CTAGTTAGAAAGGTGTTATATGG + Intergenic
913235696 1:116781071-116781093 TTAATAAGATAGATGTGACAAGG + Intergenic
919292991 1:195657655-195657677 CTTTTTAGACAGGTGTGACATGG - Intergenic
923674509 1:236068160-236068182 CTAATTCTAAAGGAGTGACAGGG - Intergenic
923899462 1:238310075-238310097 CGAATTAGACAGGTCTTGCAAGG + Intergenic
924819689 1:247476870-247476892 CTATTTTGACTGGTGTGAGATGG - Intergenic
1064845654 10:19649425-19649447 CCATTTGGACAGGTGTGAGATGG + Intronic
1067787971 10:49264682-49264704 CTGAATACACAGGTGTGATATGG - Intergenic
1068250785 10:54437047-54437069 CTAATTAGACAGGTGTGACAAGG - Intronic
1068692520 10:59931666-59931688 CTATTTTGACTGGTGTGAGATGG + Intergenic
1069309881 10:67021273-67021295 CTAATTTTAAAGGTGTGAAATGG - Intronic
1071881755 10:89906490-89906512 CTATTTGGACTGGTGTGAGATGG + Intergenic
1073291020 10:102413346-102413368 CTGATTAGGCAGGGGTGACATGG + Intronic
1075214531 10:120520571-120520593 CTTGTTTGACAGGTGTGAAAAGG - Intronic
1080622957 11:34002624-34002646 CTAATCGGACTGGTTTGACAAGG - Intergenic
1082732044 11:56810662-56810684 CTATTTTGACTGGTGTGAGATGG + Intergenic
1083527213 11:63380140-63380162 CTATTCTGACAGGTGTGAGATGG - Intronic
1083792728 11:64996405-64996427 AAAATTAGCCAGGTGTGGCAGGG - Intronic
1086662582 11:89439456-89439478 CTAAATATATAGCTGTGACATGG + Intronic
1089805180 11:121080887-121080909 AACATTAGACAGGTGTGCCATGG + Intronic
1089894574 11:121917022-121917044 CTAATTAGAAAAGTGTGAATCGG + Intergenic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1092996485 12:13955934-13955956 CAAATAAGACAAGGGTGACAAGG + Intronic
1099824958 12:87763318-87763340 CTATTCTGACAGGTGTGAGATGG + Intergenic
1101400021 12:104379066-104379088 CTAATTTGACAGGTGTCACATGG + Intergenic
1104178950 12:126359432-126359454 GTGATTAGACAGATGTGAGATGG - Intergenic
1105282732 13:18978204-18978226 CTATTTATATGGGTGTGACATGG - Intergenic
1107476665 13:40743654-40743676 CTATTCAGACTGGTGTGAGATGG - Intronic
1109629110 13:65020541-65020563 CCACTTTGACTGGTGTGACATGG + Intergenic
1109808683 13:67478473-67478495 ATAATTAAACAGGAGTTACAGGG + Intergenic
1111080134 13:83294479-83294501 CTATTCTGACTGGTGTGACATGG + Intergenic
1112661217 13:101510685-101510707 CTATTTTGACTGGTGTGAGATGG + Intronic
1115057646 14:29150626-29150648 CTAAATAAACTGGTGGGACATGG - Intergenic
1120244480 14:81990590-81990612 GTAATAAGACATGTGTGACCTGG - Intergenic
1121777358 14:96599352-96599374 CTCATTTTACAGGTGTGACCTGG - Intergenic
1122022578 14:98851495-98851517 CTCATTAGACAGCAGTGACTGGG + Intergenic
1124885111 15:33678069-33678091 CTGACAAGACAGGTGTGGCATGG - Intronic
1125085406 15:35723886-35723908 CTAATTAGAAAAGTGATACATGG + Intergenic
1125704499 15:41721315-41721337 AAAATTAGCCAGGTGTGATAGGG + Intronic
1127223587 15:56906688-56906710 CTAATTTGGCAGTTGTAACATGG + Intronic
1130325448 15:82875933-82875955 CTAATTATACGGGTGTGAGTGGG + Intronic
1132987605 16:2776170-2776192 CTAAGTAGACATGTGGCACACGG + Intronic
1138794965 16:59956677-59956699 AAAATTAGCCAGGCGTGACATGG - Intergenic
1141090166 16:81124642-81124664 AAAATTAGCCAGGTGTGACCGGG + Intergenic
1142841959 17:2639435-2639457 TTAATGAGAGAGGTGTGAAATGG + Intronic
1148927729 17:51102079-51102101 CTGATTAGAAAGGTCTAACATGG + Intronic
1150894083 17:69189220-69189242 CTATTTTGACTGGTGTGAGATGG + Intronic
1155031733 18:21990956-21990978 CAAATAAGACAGCTGGGACAAGG - Intergenic
1156129712 18:33956442-33956464 CTAATTAGTTAGGTGTGATTGGG - Intronic
1156769527 18:40702204-40702226 CTAATCTGACTGGTGTGAGATGG + Intergenic
1158579785 18:58671458-58671480 CCAATTAGACAGGTTTGCCGAGG - Exonic
1161835930 19:6646280-6646302 TTAATTAGCCAGGTGTGGCTGGG + Intergenic
1163000765 19:14365307-14365329 AAAATTAGCCAGGTGTGGCAGGG + Intergenic
1166957311 19:46473109-46473131 AAAATTAGCCAGGTGTGATAGGG + Intergenic
931261459 2:60623127-60623149 CTAATGAGACAGCTATGTCAGGG - Intergenic
933607931 2:84403627-84403649 CTAATTGGACAGGTTTGGCTTGG - Intergenic
934496709 2:94808293-94808315 CTTTTTAGACATGTGTGTCATGG - Intergenic
937876884 2:126832710-126832732 CTTATTAGGCAGATGTGAGAGGG - Intergenic
938733820 2:134167979-134168001 TTTGTCAGACAGGTGTGACAAGG - Intronic
941170324 2:162128152-162128174 ATAATTTGACATGTGAGACAAGG + Intergenic
941582344 2:167314928-167314950 CTAATTAGAGAGCTGTTTCATGG + Intergenic
942818558 2:180082159-180082181 CTATTTTGACTGGTGTGAAATGG + Intergenic
948443372 2:238012735-238012757 CTAGTTAGATAGGTGAGACGTGG + Intronic
1169868691 20:10228475-10228497 CTAAATAGCCAGGTGAGATATGG + Intronic
1172887822 20:38243220-38243242 CTAATTAAACAGGTGTTTCCTGG + Intronic
1173828898 20:46065678-46065700 CTAATAAAACAGGAGTAACATGG + Intronic
1174752288 20:53123487-53123509 ACAATTACACAGGTGTGATATGG - Intronic
1174921098 20:54702924-54702946 ATAATTAGAGAAATGTGACAAGG - Intergenic
1178135773 21:29625731-29625753 CTAATAAGACAAGAGAGACATGG - Intronic
1182543037 22:31055638-31055660 CTAATTAAACAGCTTTGACTTGG + Intergenic
1183941516 22:41298294-41298316 CAAATTAGCCAGGTGTGGCCAGG - Intergenic
952585584 3:34888095-34888117 TAAATTAGACAGGTTTGACATGG + Intergenic
952779444 3:37080947-37080969 TTAATTTTACAGGTGTGAAATGG + Intronic
952994048 3:38860120-38860142 CTAATTGGTCAGGTTTGATATGG - Intronic
954530697 3:51316500-51316522 CTAATTACACACTTGTCACAAGG - Intronic
955162778 3:56481085-56481107 CTAATTAGCTAGATGTCACAAGG - Intergenic
955582394 3:60438286-60438308 CTAATGAGACATGTGGCACATGG + Intronic
963821832 3:149905273-149905295 CTAATCAGATAGGTGAGAAATGG + Intronic
965751013 3:171975098-171975120 CCAATTGGACAAGTGTGTCAGGG + Intergenic
967138890 3:186536435-186536457 CAAGTTACACAGGAGTGACATGG - Intergenic
970313788 4:14809834-14809856 ATACTTAGCCAGGTGTGCCAGGG + Intergenic
970617231 4:17780083-17780105 TTAATGAGACAGGTGGGAGAAGG + Intronic
971922638 4:32962300-32962322 CTAATTAGGCAGGGGTGTGATGG + Intergenic
975351140 4:73348645-73348667 CTATTTTGACTGGTGTGAGATGG - Intergenic
976324021 4:83750522-83750544 AAAATTAGCCAGGTGTGTCAGGG + Intergenic
976987833 4:91325121-91325143 CTAATTCCACAGGTGTCAAATGG + Exonic
979719117 4:123878493-123878515 CCATTTTGACTGGTGTGACATGG - Intergenic
979967553 4:127093595-127093617 CTATTCTGACAGGTGTGAGATGG - Intergenic
982617525 4:157659134-157659156 CTATTTTGACTGGTGTGAGATGG - Intergenic
986283809 5:6345478-6345500 CAAATAAGAAAGATGTGACAAGG + Intergenic
986528501 5:8708062-8708084 CTATTTAGAGAGGTTAGACAGGG - Intergenic
989623608 5:43409128-43409150 TTAATTAGCCAGGTGTGCCTGGG + Intronic
989717640 5:44483059-44483081 GTTATTTGACAGGTGTGACTGGG - Intergenic
991019284 5:61963308-61963330 CTAATGAGAAAGATGGGACATGG + Intergenic
991552776 5:67860372-67860394 CTATTTTGACTGGTGTGAGATGG - Intergenic
993759995 5:91783025-91783047 CTATTTTGACTGGTGTGAGATGG + Intergenic
993810128 5:92465204-92465226 TTATTTAGACAGATGTGATAAGG - Intergenic
995012358 5:107271573-107271595 CTAATTCAGAAGGTGTGACATGG + Intergenic
997178020 5:131798338-131798360 TTAATTAGCCAGGTGTGGCCGGG + Intergenic
999915768 5:156257711-156257733 AAAATTAGTCAGGTGTGATAGGG + Intronic
1001155671 5:169270607-169270629 CTAAATATACATGTATGACATGG + Intronic
1001357162 5:171039279-171039301 CTATTCTGACTGGTGTGACATGG + Intronic
1006566364 6:34961226-34961248 CTAATAGGACAGCTGTGATAGGG + Intronic
1007136656 6:39528661-39528683 CTATTCTGACAGGTGTGACTTGG + Intronic
1009426893 6:63524093-63524115 CTACTTAGAAAGCTGAGACATGG - Intronic
1012860681 6:104555694-104555716 CTAATTATAAAGGTGTGAGTAGG - Intergenic
1015175442 6:130302381-130302403 CTATTTTGACTGGTGTGAGATGG - Intronic
1021687320 7:23199683-23199705 CTCATTAGACATTTGTGAAAGGG + Intronic
1024473737 7:49789538-49789560 TTTAAAAGACAGGTGTGACATGG - Intronic
1028242447 7:88437768-88437790 TTAATAAGAGAGGTGTGATAGGG - Intergenic
1030316482 7:108120097-108120119 TTCAGTAGACAGGAGTGACAGGG + Intronic
1037265252 8:17051885-17051907 CTAAATAGAGAGGAGGGACAGGG + Intronic
1038173263 8:25158068-25158090 CTAATCTGACTGGTGTGAGATGG + Intergenic
1039185676 8:34913544-34913566 CCAATGAGACCAGTGTGACAGGG - Intergenic
1043262246 8:78216941-78216963 CGAAGTAACCAGGTGTGACAAGG + Intergenic
1044357456 8:91239777-91239799 CTAAGTAGACAGGTTTGAAAGGG + Intronic
1045574817 8:103409078-103409100 CTAATTACAAAGGTGTGAGCAGG + Intronic
1047812518 8:128425895-128425917 CTAAGGAGACAGGTGTTTCAAGG + Intergenic
1049980608 9:900838-900860 TTAATTAGCCAGGTGTGGCATGG - Intronic
1051717428 9:19999629-19999651 CTAAATAGATTTGTGTGACAGGG + Intergenic
1053059151 9:35015731-35015753 ATAGTTAGACAGGACTGACAAGG + Intergenic
1053910816 9:42901508-42901530 CTTTTTAGACATGTGTGTCATGG + Intergenic
1054361449 9:64125070-64125092 CTTTTTAGACATGTGTGTCAGGG + Intergenic
1058691348 9:107523189-107523211 AAAATTAGCCAGGTGTGACCAGG + Intergenic
1058728970 9:107831848-107831870 CTAATTTGTTAGGAGTGACAAGG + Intergenic
1058951872 9:109911538-109911560 CTAAGTATACAGCTGGGACATGG - Intronic
1060247806 9:121960918-121960940 CTAATGAGAGAGGTGGGAGAGGG - Intronic
1062475844 9:136726826-136726848 CTAATGACACAGATGTGACACGG + Intergenic
1203557096 Un_KI270744v1:9938-9960 CTTTTTAGACATGTGTGTCATGG - Intergenic
1189560188 X:42184412-42184434 CTACTTAGAAAAGTGTGACTGGG + Intergenic
1189876699 X:45443800-45443822 CTATTTGGACTGGTGTGAGATGG - Intergenic
1191679568 X:63826771-63826793 CCATTTTGACAGGTGTGAGATGG + Intergenic
1192543786 X:71996307-71996329 CTATTTGAACAGCTGTGACATGG - Intergenic
1193492913 X:82171386-82171408 CCATTTTGACAGGTGTGAGATGG - Intergenic
1193837692 X:86366071-86366093 CTAATTATAGTGGTGTGAAAAGG - Intronic
1194320148 X:92436277-92436299 CCATTTTGACTGGTGTGACATGG - Intronic
1194943751 X:100043686-100043708 ATAATAAAACAGGTTTGACAAGG - Intergenic
1195538158 X:106032740-106032762 CTACTTAAACAAGTGGGACAGGG + Exonic
1196510824 X:116510064-116510086 CTATTTTGACTGGTGTGAGATGG + Intergenic
1199857293 X:151770525-151770547 CTATTCTGACTGGTGTGACATGG - Intergenic
1200628267 Y:5549409-5549431 CCATTTTGACTGGTGTGACATGG - Intronic
1202050131 Y:20772186-20772208 AAAATTAGCCAGGTGTGGCAGGG - Intronic