ID: 1068252281

View in Genome Browser
Species Human (GRCh38)
Location 10:54457904-54457926
Sequence CAAACTTCTCCACTTGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 152}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068252281_1068252286 13 Left 1068252281 10:54457904-54457926 CCTGTTTCAAGTGGAGAAGTTTG 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1068252286 10:54457940-54457962 ATGTTGTTTCCATACATCAGTGG No data
1068252281_1068252285 -10 Left 1068252281 10:54457904-54457926 CCTGTTTCAAGTGGAGAAGTTTG 0: 1
1: 0
2: 0
3: 11
4: 152
Right 1068252285 10:54457917-54457939 GAGAAGTTTGGGCTGTATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068252281 Original CRISPR CAAACTTCTCCACTTGAAAC AGG (reversed) Intronic
904422887 1:30405446-30405468 CACACTTCTCCCCTGGAAACTGG + Intergenic
904940863 1:34164398-34164420 CCATTTTCTCCAATTGAAACCGG - Intronic
910377026 1:86583582-86583604 CAAACTTCAGCACTTCAAAGAGG - Intergenic
912211066 1:107557374-107557396 CAAACTTCTGATTTTGAAACTGG + Intergenic
915880309 1:159663759-159663781 CAGACTTCTCAACAGGAAACAGG - Intergenic
917545002 1:175955965-175955987 CAAACTTTTCTAGTAGAAACTGG + Intronic
917789210 1:178488580-178488602 CAGACTCCTCCACTGGACACCGG - Intergenic
920163338 1:204016907-204016929 CAAGCCTCTTCCCTTGAAACTGG - Intergenic
921698639 1:218242277-218242299 CATATTTCTCCAGTTGAAAATGG + Intergenic
924735182 1:246749308-246749330 CAAACTACAGCAATTGAAACAGG - Intronic
1063250984 10:4274556-4274578 CAAACAACTCCATTTAAAACTGG - Intergenic
1063557812 10:7097227-7097249 CACACAGCTCCACTGGAAACAGG + Intergenic
1063937075 10:11089135-11089157 CAATCCTCTCCTCTTGAATCTGG - Intronic
1068226322 10:54111441-54111463 AAAAATTCTCCAATTCAAACAGG + Intronic
1068252281 10:54457904-54457926 CAAACTTCTCCACTTGAAACAGG - Intronic
1068480490 10:57583687-57583709 CTAACTTGTACACTTGAAATAGG - Intergenic
1072023127 10:91425068-91425090 CAAACTTCTCAATTTGTAATTGG + Intronic
1076129901 10:128006592-128006614 CAAACTTCACCACGTGGAGCTGG + Intronic
1077698411 11:4416891-4416913 CCAACTTCTCTCCTTAAAACAGG - Intergenic
1087139349 11:94750323-94750345 CTCTCTTCTCCACTTGACACTGG + Intronic
1087550864 11:99646227-99646249 CCAGCTTCTTCACTTGTAACAGG - Intronic
1087564355 11:99835383-99835405 TAAACTTCTCCACTGGAGTCAGG + Intronic
1087590280 11:100178393-100178415 AAATCTTGTCCACTTGTAACTGG + Intronic
1090407770 11:126487618-126487640 CAAGCTTCTACATTTGAAAAAGG + Intronic
1092260728 12:6952037-6952059 CAAACTTCTCCCCTCCATACAGG - Exonic
1092293077 12:7176237-7176259 CAAACAACTCAACTTGAAAATGG - Intergenic
1092493454 12:8968170-8968192 CAAAATTCTCCAATTAAAACGGG + Intronic
1093173688 12:15886820-15886842 TAAATTTCTCCACAAGAAACGGG - Intronic
1093219306 12:16399864-16399886 CAAAGTTCTTCAGGTGAAACTGG + Intronic
1095788454 12:46137266-46137288 TAAACATTTCCACATGAAACTGG - Intergenic
1097161862 12:57052044-57052066 CAAATTTGTACACTTAAAACTGG + Intergenic
1098218687 12:68245814-68245836 CAAGCTCCACCACTGGAAACGGG - Intergenic
1099104668 12:78483612-78483634 CAAACTTCAGCAGTTGAAACAGG + Intergenic
1108076775 13:46688455-46688477 CTAACTTTTCCATTTGAAACAGG - Intronic
1108100611 13:46950253-46950275 CAAAGTACTCCATTAGAAACTGG - Intergenic
1108384965 13:49890757-49890779 AAAACTTCTCCACAAGAAAAAGG - Intergenic
1108470096 13:50758899-50758921 CAATCTTCTCCCCTTGAATGTGG - Intronic
1109126883 13:58528781-58528803 AAAACTTCTCCACAAGAAAAAGG - Intergenic
1109182220 13:59227308-59227330 AAAACATGTGCACTTGAAACTGG - Intergenic
1111389511 13:87574486-87574508 CACACTTCTCCAGTACAAACTGG - Intergenic
1114299008 14:21357291-21357313 CAAAGTTCTTCAGGTGAAACTGG + Exonic
1118709041 14:68504793-68504815 CAAATTTCTTCACTAGACACTGG + Intronic
1124063345 15:26316672-26316694 CAACCTTATCCTCTTGAATCAGG - Intergenic
1124167675 15:27342623-27342645 CCAGCTTCTCCCCTTGAAAGAGG - Intronic
1125700942 15:41683066-41683088 CAAACTTCTCAACAGGAAACCGG - Intronic
1126865099 15:52927687-52927709 CATATGTCTCCCCTTGAAACTGG - Intergenic
1129580128 15:76799983-76800005 CAAACTCCTCCAGTGGCAACAGG + Intronic
1132229913 15:100173905-100173927 CAAACATCACCACTAGAAACAGG + Intronic
1132405453 15:101539571-101539593 TAAACTTCTCAAATGGAAACAGG + Intergenic
1133618242 16:7500177-7500199 CCAATGTCTCCACTTGAGACTGG - Intronic
1136035622 16:27537779-27537801 CATACCTGTCCACATGAAACCGG + Exonic
1136642457 16:31578277-31578299 CAACTTTTTCCACTTGAAATGGG + Intergenic
1142305275 16:89281012-89281034 CAAACTTCTCCGCGGGAACCGGG + Exonic
1143155635 17:4834221-4834243 TGAACTGCTGCACTTGAAACAGG - Intronic
1147986357 17:44309493-44309515 CGATCTTCTCCCCTTGAACCTGG - Intronic
1150314383 17:64156244-64156266 GAAACCTCTACACTGGAAACAGG + Intronic
1150436427 17:65157736-65157758 GAAACTTCTAAACTTGAACCTGG - Intronic
1156072379 18:33228571-33228593 CAAATTTGTCCACTGGTAACAGG - Intronic
1157378066 18:47184226-47184248 GAGACATCTCCACCTGAAACTGG - Intergenic
1159510200 18:69388109-69388131 AAAATTTCTCCACTTGCACCCGG - Intergenic
1160420892 18:78743150-78743172 CAGACTTCTCCAGATGGAACTGG - Intergenic
1163423615 19:17228691-17228713 CAATTTTCTCTCCTTGAAACTGG - Intronic
928171272 2:29004403-29004425 CAAACTTTTGGACTTGAAAAGGG + Intronic
928707230 2:33963381-33963403 GACACTTCTTCACTTTAAACTGG + Intergenic
930305852 2:49673563-49673585 CAATCTTCTCCCCTTGAATTCGG - Intergenic
933068900 2:77833738-77833760 CAAGCTTGGCCACTGGAAACAGG + Intergenic
933354674 2:81196736-81196758 CAAACTTCTCCACGGGAACCGGG + Intergenic
938212664 2:129481729-129481751 CATTCTTCTCCCCTTGAATCTGG + Intergenic
941651764 2:168099961-168099983 CAAATTGTTCCACTTGAAATAGG - Intronic
948749201 2:240120526-240120548 CAAACATCTCCCCTTCAAATTGG - Intergenic
1168936634 20:1671388-1671410 CAAAGTTCTCCTCTCTAAACAGG + Intergenic
1168969474 20:1921126-1921148 CAAACTTCTCCACTCCACACAGG - Intronic
1169539561 20:6584135-6584157 CAAACTGCTCCGGTTGAAAGGGG + Intergenic
1169662988 20:8000798-8000820 TAGACTTCTCCATTTGGAACTGG + Intronic
1169944227 20:10971806-10971828 CAACCTTCTCCTCTTGAATGTGG - Intergenic
1170145574 20:13170385-13170407 CAACCTTTTCCAAATGAAACTGG - Intergenic
1171089148 20:22267719-22267741 CAAACTGCTCCTCTGAAAACAGG + Intergenic
1174422612 20:50409530-50409552 CAAACTTCTCCACTTGGATGGGG - Intergenic
1177316528 21:19469309-19469331 GTAACTCCTCCACTTGAATCTGG + Intergenic
1177607313 21:23398274-23398296 CAAGCTTCTCCTCCTGAAAATGG + Intergenic
1177957287 21:27614611-27614633 CAAACTACTCCATTAAAAACGGG - Intergenic
1179248760 21:39655836-39655858 GATGCTTCTCCACTGGAAACTGG - Intronic
1181270073 22:21653431-21653453 CAACCTTCTCAACTGGAAAGTGG - Intronic
951404984 3:22285041-22285063 CAGAATAATCCACTTGAAACTGG + Intronic
951460696 3:22948599-22948621 CAAACTTTTCCTCTACAAACTGG + Intergenic
952762241 3:36924813-36924835 CAAGCTTGGCCACTGGAAACAGG + Intronic
953098438 3:39802166-39802188 TACATTTCTCCACTTGAAATTGG - Intergenic
955158498 3:56441696-56441718 CAAAATTAGCCACTTGAACCCGG - Intronic
958529124 3:95302193-95302215 CAAGCTTCTCTACTTGATAAGGG - Intergenic
958719665 3:97828161-97828183 CCAGCTTCCCCACATGAAACTGG - Intronic
959501090 3:107106787-107106809 CAAACTTCTCCCCTCCATACAGG + Intergenic
960550472 3:118970560-118970582 AAAACCTTTCCACTTCAAACTGG - Intronic
961075651 3:123979506-123979528 CAAACTTGCCTGCTTGAAACTGG - Intronic
961308034 3:125973002-125973024 CAAACTTGCCTGCTTGAAACTGG + Intronic
962322893 3:134406375-134406397 CCAACATCTGCATTTGAAACGGG + Intergenic
963573787 3:147033182-147033204 CAAACTTCTACACCTAAAATTGG + Intergenic
963775898 3:149439334-149439356 CATACTTCTCCATTTGATAAAGG - Intergenic
966300715 3:178476678-178476700 CAAGCTACTCCCCTTGAAATAGG + Intronic
968389938 4:182831-182853 CAAACATCCCCATTTGAAAGTGG - Intergenic
973153663 4:46921046-46921068 CAAACATCTCCACTTCAAAATGG - Exonic
974133589 4:57787344-57787366 CAAACTGGTCCCCTTAAAACTGG - Intergenic
974157931 4:58098901-58098923 CAAGATTCTTCACATGAAACTGG - Intergenic
974192200 4:58520037-58520059 CCAACTTCTCCACTTGTAATAGG - Intergenic
977319216 4:95489835-95489857 TTAATGTCTCCACTTGAAACAGG - Intronic
977929928 4:102739231-102739253 CAATCTTCTCAGATTGAAACAGG + Intronic
979202381 4:117993898-117993920 CAAACTTCTCCTTTGGAAAAAGG - Intergenic
980241315 4:130180151-130180173 CAAACTTCTACGATTGCAACTGG - Intergenic
981280551 4:142953646-142953668 CATACTTCTCCCCTTAAATCTGG - Intergenic
982356502 4:154474692-154474714 CAAAATTCTCCACTAGTAAGTGG - Intronic
987219367 5:15773803-15773825 TAAACTACTCTACTTGGAACAGG + Intronic
989654810 5:43734866-43734888 CCAACTCCTCCACTTGTAAATGG - Intergenic
991208429 5:64076735-64076757 CAAACTTCTCTATCTGAAATGGG + Intergenic
991330025 5:65484182-65484204 CACACTTGGACACTTGAAACTGG - Intergenic
992293374 5:75303545-75303567 CAAGCTTGGCCACTGGAAACGGG + Intergenic
993288035 5:86026200-86026222 CAAACTTCCCAAAGTGAAACAGG + Intergenic
995232314 5:109781480-109781502 AAAAAATCTCCACTTAAAACAGG - Exonic
995501860 5:112815894-112815916 CAGAATTCTCCACTAGAAAGCGG - Intronic
998024357 5:138801926-138801948 CAAACTTCTCGACTTAAATGAGG + Intronic
998625197 5:143838622-143838644 CACACTCCTCCTCCTGAAACTGG - Intergenic
999533525 5:152489411-152489433 CAACCTTCTCCCCTTGAATGGGG - Intergenic
1002831664 6:827288-827310 CACGCTTCTCCCCTTGAATCAGG - Intergenic
1003083136 6:3038239-3038261 CAAGCTTAGCCACTGGAAACAGG + Intergenic
1003759229 6:9156453-9156475 CAAAGGTTTCCACTTGAACCAGG + Intergenic
1003822105 6:9910204-9910226 CCAACTTCTCCACTGACAACAGG - Intronic
1007649477 6:43409466-43409488 CAAACATCTCCATTAGAAAATGG + Intergenic
1007952121 6:45881806-45881828 CAACCTTCTGCACTTGAAGAGGG - Intergenic
1013067214 6:106695414-106695436 CAGTCTTCTCCTCTTGAAGCTGG + Intergenic
1016659011 6:146554482-146554504 GAATCTTCTCCACTAGGAACCGG - Exonic
1016776407 6:147909441-147909463 CTAATGTCTCCACTTGACACAGG + Intergenic
1019130164 6:169867574-169867596 CCAACTTCACCACTTGAAGTTGG - Intergenic
1019975641 7:4579196-4579218 GCATCTTCTCCCCTTGAAACTGG + Intergenic
1020824723 7:13012391-13012413 AAAACTTCTTCTCTTGAAAGGGG + Intergenic
1025000817 7:55313169-55313191 CAAACTGCTCCACTGCAGACAGG - Intergenic
1025010726 7:55395771-55395793 CAAACTGCTCCACCAAAAACTGG + Intronic
1025248215 7:57333944-57333966 CATACTTCTCCACTTGGATGGGG + Intergenic
1027129536 7:75581273-75581295 CAAACATCTCCACTGTTAACTGG + Exonic
1028531904 7:91847845-91847867 CAAACTGCCCCATTTGAAGCAGG + Intronic
1030238024 7:107288354-107288376 CAAACTTTTTTTCTTGAAACTGG - Intronic
1030299786 7:107963480-107963502 CAAGTTTCTTCACTTGAAAATGG - Intronic
1033237807 7:139652066-139652088 CCCAATTCTCCATTTGAAACAGG + Intronic
1035371703 7:158383472-158383494 CAAAACTCTGCACTTTAAACTGG - Intronic
1035644657 8:1209934-1209956 AAAATTTCTCCAGTTGAAAGTGG - Intergenic
1036356814 8:8050599-8050621 CACACTTATACACTTGACACTGG - Intergenic
1047628554 8:126681303-126681325 CAAACTTCTCCATTTATAAGGGG - Intergenic
1047968420 8:130064484-130064506 CAGGCTTCTCTACTTAAAACTGG - Intronic
1048517403 8:135123440-135123462 CAATCTTCTCCACTTGGCAGTGG - Intergenic
1050183934 9:2951279-2951301 CAGACTTGTCAACTTGGAACAGG + Intergenic
1050291107 9:4156046-4156068 TGTACTTCTCCACCTGAAACTGG - Intronic
1051521346 9:17992194-17992216 CCAACCTCTCCACATGAACCTGG - Intergenic
1052301947 9:26962001-26962023 CCAACTCCACCTCTTGAAACAGG - Exonic
1053342400 9:37348693-37348715 CTAACTTCGACACTTAAAACTGG + Intronic
1054858594 9:69927104-69927126 CAAACTTTAGCAATTGAAACAGG - Intergenic
1056333921 9:85546789-85546811 CAAAATTATCCACTTGATGCAGG + Exonic
1056599970 9:88039203-88039225 CAAACTTTAGCAATTGAAACAGG - Intergenic
1058922779 9:109633168-109633190 CAAACTTCTGCACTTGACCTGGG - Intergenic
1059024430 9:110610231-110610253 CTTACTTCTCCACTTGATAAAGG + Intergenic
1187011006 X:15279320-15279342 CAAAATTCTCCACTGGGAAAAGG + Intergenic
1188976578 X:36682971-36682993 CCAACATGTCCACTTGAAGCTGG + Intergenic
1189263397 X:39694322-39694344 CAAATCTCTCCAATTGCAACAGG + Intergenic
1194453302 X:94071712-94071734 CAAACTTTTACACCTGAAGCAGG - Intergenic
1196440810 X:115718521-115718543 TAAAATTCTCCAATTGAAAAAGG + Exonic
1196652064 X:118178089-118178111 CTAACTTCTCCAAATGAAAGGGG + Intergenic
1196668606 X:118342855-118342877 AAAACTGCTCTATTTGAAACAGG - Intergenic
1199542587 X:148973461-148973483 CAAATTTCTCGAACTGAAACAGG - Exonic