ID: 1068253241

View in Genome Browser
Species Human (GRCh38)
Location 10:54470730-54470752
Sequence GCAGCCCGCTTGGCTACAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 64}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068253241_1068253245 6 Left 1068253241 10:54470730-54470752 CCAATTGTAGCCAAGCGGGCTGC 0: 1
1: 0
2: 0
3: 8
4: 64
Right 1068253245 10:54470759-54470781 TTGGTCTCCTTTCTTGCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068253241 Original CRISPR GCAGCCCGCTTGGCTACAAT TGG (reversed) Intronic
908870673 1:68608124-68608146 GCAGCCGGTTTGGCTGCAATTGG + Intergenic
911637147 1:100248239-100248261 GCAGCCCTCTTGTATACAGTAGG + Intronic
913553569 1:119940567-119940589 GCTGCCCCCTGGGCTACACTGGG - Exonic
919478519 1:198057126-198057148 GCAGCCTGCTTGGCCAGGATTGG - Intergenic
920736461 1:208537384-208537406 TCAGGCTGCTTGGCAACAATGGG + Intergenic
921771459 1:219045561-219045583 ACAGGCTGCTTGGCTAAAATGGG + Intergenic
922341260 1:224656990-224657012 GGAGTCCCCTTGGCTACAAGTGG + Intronic
922388544 1:225113971-225113993 GGTACCAGCTTGGCTACAATGGG - Intronic
924951184 1:248885079-248885101 GCAGTCCCCTTGGCCACAAGGGG + Intergenic
1068253241 10:54470730-54470752 GCAGCCCGCTTGGCTACAATTGG - Intronic
1068524277 10:58109469-58109491 GCAGCCCTTTAGGCTACAGTTGG - Intergenic
1073639120 10:105231088-105231110 GCAGCCTGCTTGGCCAGGATCGG - Intronic
1075559702 10:123459719-123459741 GGAGTCCGCGTGGATACAATGGG + Intergenic
1077214728 11:1390557-1390579 GCAGGCCGCTTGGCTGCGGTCGG + Intronic
1077543380 11:3158154-3158176 GCAGGCCGCTTGGCCACAGGAGG - Intronic
1083153677 11:60809633-60809655 GGAGCCAGCCTGGCTACAAAAGG + Intergenic
1085186454 11:74579943-74579965 GCACCCTGCTTGGCTAAAACTGG - Intronic
1087353144 11:97059669-97059691 GCAGCCTGCTTGGCTGAAATTGG + Intergenic
1087869848 11:103278932-103278954 GCAACCCTATTGCCTACAATAGG - Intronic
1089944957 11:122461401-122461423 GCAGCCTGCTTGGCCAGGATTGG + Intergenic
1090002806 11:122977201-122977223 GCAGTCCGTTTGGCTGCAAAGGG - Intergenic
1097635467 12:62116240-62116262 GAAGCCCATGTGGCTACAATTGG + Intronic
1098394693 12:70005618-70005640 GCAGCCTGCTAGGCTAGAATTGG + Intergenic
1102081942 12:110105390-110105412 GAAGCCTGCTTGCTTACAATGGG - Intergenic
1105063095 12:133172168-133172190 GCAGCCTGCAGGGCTGCAATTGG + Intronic
1109155801 13:58907089-58907111 GCAGCTTGCTTGGCTAGGATTGG - Intergenic
1118998533 14:70859831-70859853 ACAGGCCGCTTGGTTAAAATAGG - Intergenic
1119268027 14:73276669-73276691 GCAGCCCACTGGGCTTCAAAAGG + Exonic
1124264201 15:28219257-28219279 GCAGCCCGCTTGGCTGGCTTTGG + Intronic
1127222596 15:56895996-56896018 GCAGACCCTTTGGCTTCAATGGG + Intronic
1127298342 15:57629517-57629539 GCAGACCTCTTGGCCACCATGGG + Intronic
1127407942 15:58672559-58672581 GGAGCCCTCTTGGGTACATTGGG - Intronic
1137673971 16:50294753-50294775 TGAGCCCGCTGGCCTACAATGGG + Intronic
1144205945 17:12979655-12979677 GAAGTCCTCTTGGCTACAGTAGG + Intronic
1149943963 17:60900467-60900489 GTAGCCTGCTTGGCTAGGATAGG - Intronic
1151707062 17:75774703-75774725 GCAGCCAGCTTAGCCTCAATGGG + Intergenic
1157192403 18:45592514-45592536 GCAGCATGCTTGGCCACTATGGG - Intronic
1158810404 18:61026985-61027007 CCACCGCGCTTGGCTACATTAGG + Intergenic
935965035 2:108464632-108464654 GCAGCCTGCTCCGCTACAGTTGG - Intronic
1173322677 20:42002185-42002207 GCAGCCCGCTTGGCCAGGATTGG - Intergenic
1179710351 21:43209727-43209749 GCAGCCTGCTTGGCTACACAGGG + Intergenic
1183759224 22:39800202-39800224 GCAGCCAGCTTGGCCAGGATTGG - Intronic
970431089 4:15989897-15989919 GCAGCCCTCCTGGCTACACAGGG - Intronic
971342413 4:25782699-25782721 GCAACACGCTTGTCTACAAAAGG + Intronic
984233554 4:177129925-177129947 GCAGCCCACTGGGATACAAGTGG + Intergenic
997671735 5:135680054-135680076 GCAGCCTGCTTGGCTGGGATTGG - Intergenic
1009339858 6:62541209-62541231 GCAGCCTGCTTGGCCTGAATTGG + Intergenic
1012478442 6:99639969-99639991 GCAGCCCCCTGAGCTACAATTGG - Intergenic
1012986683 6:105883605-105883627 GCTGGCAGCTTGGCTACACTTGG - Intergenic
1018766871 6:166940888-166940910 CCAGCCCGCTCGGCCACAACAGG + Intronic
1020090665 7:5338352-5338374 CCAGCTCTCTTGGTTACAATTGG - Intronic
1027996117 7:85427261-85427283 GCTACCAGCTTGGCTACAGTGGG + Intergenic
1031684029 7:124709852-124709874 GCAGCCAGCTTGGCTGAGATTGG - Intergenic
1034026391 7:147708717-147708739 GCTGCCTGCTTGGCTAGCATTGG - Intronic
1041830409 8:62147247-62147269 GCAGCCTGCTTGGCTGGGATTGG + Intergenic
1041996791 8:64071386-64071408 TCAGCCAGCTTTGTTACAATGGG + Intergenic
1043528673 8:81125214-81125236 GCATCCAGCTTGGCTACTAATGG - Intergenic
1043955855 8:86359100-86359122 GCAGCCAGATTGGGGACAATTGG + Intronic
1051168947 9:14298534-14298556 GCAGCCCTCCTTGCTACAAGAGG - Intronic
1052991431 9:34521303-34521325 CTAGCCAGCTTGGCTCCAATAGG - Exonic
1054960018 9:70957596-70957618 GCAGCATGCTTGGCTGCATTCGG + Intronic
1059456209 9:114401952-114401974 ACTGCCCGCATGGCTCCAATTGG - Intergenic
1186218511 X:7325455-7325477 CCAGCCAGCTTGGCTACTGTAGG - Exonic
1186943866 X:14542901-14542923 GGAGTCCCCTTGGCTACAAGAGG + Intronic
1189995272 X:46631703-46631725 GCAGCCTGCATGGCTACCATGGG - Intronic
1194872192 X:99146380-99146402 GCAGCCTGCTTGGCTGGAATTGG + Intergenic
1195840527 X:109171769-109171791 GCAGACCTCTTGGTTAAAATGGG - Intergenic
1197924319 X:131630426-131630448 GCAGTCTGCTTGGCTATGATAGG + Intergenic
1198583613 X:138095701-138095723 GCAGCCTGCTTGGTTAGGATTGG + Intergenic
1200345061 X:155439759-155439781 GCAGCCTGCTTGGCCAGGATTGG + Intergenic
1201354218 Y:13081301-13081323 GCAGCCTGCTTGGCTTGAACTGG + Intergenic
1201368720 Y:13237427-13237449 GCAGCCTGCTTGGCCAGGATGGG + Intergenic
1201390355 Y:13490570-13490592 GCAGCCTGCTTGGCTGGGATTGG - Intergenic