ID: 1068253381

View in Genome Browser
Species Human (GRCh38)
Location 10:54473032-54473054
Sequence TCTATCTGTCACCTGCATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068253381_1068253383 -9 Left 1068253381 10:54473032-54473054 CCTAAATGCAGGTGACAGATAGA 0: 1
1: 0
2: 2
3: 11
4: 205
Right 1068253383 10:54473046-54473068 ACAGATAGACCTCAGTGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068253381 Original CRISPR TCTATCTGTCACCTGCATTT AGG (reversed) Intronic
903323787 1:22557754-22557776 TCTAACTGCCTCCTGCATTGTGG - Intergenic
905513629 1:38544438-38544460 TGTATCTGTCGTCTGCAGTTGGG + Intergenic
905748842 1:40443433-40443455 TTTGTCTGTCATCTGCATTACGG + Intergenic
908077958 1:60541873-60541895 TCTATATTTTACCTTCATTTTGG - Intergenic
908732787 1:67243702-67243724 TCTATCTTTGATGTGCATTTGGG + Intronic
910119666 1:83772569-83772591 TCTAAATGGCACCTGGATTTGGG - Intergenic
911464631 1:98236066-98236088 TCTCTCTGTCTCCTTCAGTTTGG - Intergenic
912636897 1:111304051-111304073 TCTATCTGCCAACTGCCTTCTGG + Intronic
912806264 1:112759138-112759160 TCTTTCTGTCTCCTGCAACTGGG - Intergenic
913298807 1:117348722-117348744 TCTATATCTCATTTGCATTTTGG + Intergenic
914355074 1:146877851-146877873 ACTGTCTGTTACCTTCATTTCGG - Intergenic
915145703 1:153794789-153794811 TCTATGTGTGACCTGTGTTTGGG + Intergenic
916246815 1:162696654-162696676 TGTAGCTGTCAGTTGCATTTGGG - Intronic
916876232 1:168972503-168972525 TCTCTCTATCACCTTCATTTAGG - Intergenic
917715153 1:177727941-177727963 TCTATCACTGATCTGCATTTGGG - Intergenic
918967344 1:191368883-191368905 TGTATCTTACACCAGCATTTTGG - Intergenic
918982454 1:191580768-191580790 TCTATCAGTGATTTGCATTTAGG + Intergenic
920249891 1:204616608-204616630 TCTATCTGTCCATTTCATTTTGG - Intergenic
920609827 1:207425267-207425289 TCTGGCTGTCCCCTGCCTTTAGG + Intergenic
921836166 1:219781255-219781277 TCTTTCTGCCACCTGCCTCTGGG + Intronic
923012285 1:230097649-230097671 TTTATCTGTCAGCTGACTTTTGG + Intronic
1064198049 10:13261498-13261520 TCAATCAGTCACATGCATTCAGG - Intergenic
1064804942 10:19120067-19120089 TTTATGAGTCACCAGCATTTAGG + Intronic
1068253381 10:54473032-54473054 TCTATCTGTCACCTGCATTTAGG - Intronic
1068868160 10:61916672-61916694 TGTTTCTGTCACCTGCATTTTGG - Intronic
1069705617 10:70457512-70457534 TCTTCCTGTCCCCTGCACTTAGG + Intergenic
1069767519 10:70874208-70874230 TCTATGTGTCACTTGGATTGGGG + Intronic
1070644402 10:78191566-78191588 TCTAACTCTCACTGGCATTTTGG + Intergenic
1071942187 10:90602093-90602115 TCTTTCTCTCACCTGGATATAGG + Intergenic
1072010763 10:91301160-91301182 TCTCTCTCTCTCCTGGATTTGGG - Intergenic
1073910635 10:108339283-108339305 ATAATCTGTGACCTGCATTTTGG + Intergenic
1074709567 10:116166191-116166213 TCTATCTTTGACAGGCATTTGGG + Intronic
1084487132 11:69455089-69455111 TCTATCTATCACAAGCATCTTGG - Intergenic
1085745240 11:79109477-79109499 TCTATCTGTCTCCTGCACCTTGG - Intronic
1087152646 11:94872520-94872542 TCCTTCTGTCACCTCAATTTGGG - Exonic
1088109064 11:106240761-106240783 TGTATCTGATACCTACATTTGGG - Intergenic
1088532365 11:110824731-110824753 TCTTTCTGTCTCTTGAATTTTGG - Intergenic
1088641321 11:111875927-111875949 ACTTTCTGTCAGCTGCTTTTTGG - Exonic
1089097407 11:115930795-115930817 CCTTTCTGGCACTTGCATTTCGG - Intergenic
1089185969 11:116614943-116614965 TGTGTGTGTCACCTGCCTTTGGG + Intergenic
1091443692 12:530916-530938 TTTATCTGTCACCTGAGATTGGG + Intronic
1092108717 12:5944284-5944306 TCCACCTGCCACCTGCCTTTGGG + Intronic
1093601249 12:21026954-21026976 TCTATCCTTGATCTGCATTTGGG - Intronic
1094190097 12:27689370-27689392 TCTATCTGTCAACTGTCTATTGG - Intronic
1097225591 12:57475394-57475416 TCTACCTGCCTCCTGCAGTTCGG - Exonic
1098291101 12:68957469-68957491 TGTATTTCTCAACTGCATTTTGG - Intronic
1098587931 12:72176421-72176443 TCTAGCTGTCACCTCCTTTAGGG - Intronic
1098977868 12:76922315-76922337 TCCTCCTGTCAACTGCATTTTGG - Intergenic
1099578839 12:84415529-84415551 TCTGTCTGACTCCTGCATCTAGG + Intergenic
1100154677 12:91784013-91784035 ACAGTCTGTCAACTGCATTTGGG + Intergenic
1101860221 12:108476412-108476434 CATTTCTGTCAACTGCATTTAGG + Intergenic
1102909047 12:116698600-116698622 TTTTTCTGCAACCTGCATTTAGG + Intergenic
1104672218 12:130688659-130688681 TGTACCTGTCACCTGCCCTTGGG - Intronic
1105534221 13:21248778-21248800 TCCAGCTGTCACCTTCATTGGGG + Intergenic
1109662337 13:65479335-65479357 CCTATCCTTCACTTGCATTTAGG + Intergenic
1109909052 13:68886102-68886124 ACAATCTGTCATCTGCAATTGGG - Intergenic
1110594847 13:77308847-77308869 CCTTTGTCTCACCTGCATTTAGG - Intronic
1111114727 13:83760143-83760165 TCAACCTGTCATCTACATTTAGG - Intergenic
1112541926 13:100322600-100322622 TCTCTCTGTCACCCAGATTTGGG + Intronic
1113198485 13:107837507-107837529 TCTACCTGTTACATGGATTTGGG + Intronic
1114037152 14:18640341-18640363 TCTATCAGTGACGGGCATTTGGG - Intergenic
1114121489 14:19674702-19674724 TCTATCAGTGACGGGCATTTGGG + Intergenic
1115737516 14:36349689-36349711 TCTATTTCTCTCCTGCATGTCGG - Intergenic
1116712287 14:48383620-48383642 TCTTTCTGTCAGCTGAATCTGGG + Intergenic
1117829955 14:59740358-59740380 TCTAACAGTCACCTCCAGTTAGG + Intronic
1118116084 14:62778320-62778342 TGTATTTTTCATCTGCATTTGGG + Intronic
1118392166 14:65304557-65304579 TCTCACTGGCACCTGCATGTGGG - Intergenic
1118410583 14:65473349-65473371 TCTATCTCTCACCTTCATTTGGG + Intronic
1119909125 14:78333885-78333907 TCAATCTCTCACCTGGATTACGG - Intronic
1119959737 14:78841612-78841634 TGTTTCTGTCTCCTTCATTTTGG + Intronic
1120042999 14:79774740-79774762 TCTATTTATCAACTGCATTCAGG + Intronic
1126941544 15:53772314-53772336 TCTCTCTCTCCCCTGCATTCTGG + Intergenic
1126952935 15:53902292-53902314 TCTGTCTGTCTCCTGTATCTAGG - Intergenic
1127184917 15:56468453-56468475 TCTGTCTGTCATATGCAGTTAGG + Intergenic
1127954027 15:63836717-63836739 TTCATCTTTCATCTGCATTTAGG + Intergenic
1129415003 15:75371420-75371442 TTTATCTGGGACCTGCAGTTTGG - Exonic
1130894307 15:88158505-88158527 TCTATTGGCCACCTGCATCTGGG + Intronic
1132205356 15:99982731-99982753 TCTCTCAGTTACCTGCATCTTGG - Intronic
1132578540 16:674916-674938 CTTATCTGTCACCTCCATTGTGG + Intronic
1133718949 16:8476187-8476209 TCTTGCTGTCACCTGTTTTTCGG + Intergenic
1138735323 16:59244240-59244262 CATATCCGTCACCTGCTTTTTGG + Intergenic
1139978942 16:70837678-70837700 ACTGTCTGTTACCTTCATTTTGG + Exonic
1140255714 16:73334402-73334424 TCTATTTGTCCTCAGCATTTAGG - Intergenic
1142996881 17:3765792-3765814 TCTATCTGCCACCAGGATCTGGG + Intronic
1143151363 17:4809124-4809146 TCTCTCTGTTGCCTGCATCTCGG - Exonic
1145961153 17:28887201-28887223 TCTATATGTCACGTGCCCTTGGG - Intronic
1146551682 17:33785777-33785799 TCTCTCTGGCCCCTGCAATTTGG - Intronic
1146553712 17:33804749-33804771 TTTATCAGTCTCCTGGATTTGGG + Intronic
1147878612 17:43639449-43639471 TCCATTTGGCACCTTCATTTTGG + Intergenic
1149596287 17:57866635-57866657 TCTCTCTGCCCCCTTCATTTGGG + Intronic
1150346222 17:64406551-64406573 TCTTTCTCTAACCTGCCTTTTGG - Intronic
1155674504 18:28413467-28413489 TCTCTTTGTCACCTACATTGGGG - Intergenic
1155753907 18:29465597-29465619 TCTATCAGTAACCTCCATTATGG - Intergenic
1156695223 18:39758060-39758082 TCTATCATTTATCTGCATTTAGG - Intergenic
1156703252 18:39849788-39849810 TCTTGCTGACACCTTCATTTCGG + Intergenic
1158555088 18:58468423-58468445 TCTTTGTATCACTTGCATTTTGG + Intergenic
1159174369 18:64814530-64814552 ACTATGTGACACTTGCATTTAGG - Intergenic
1162302316 19:9850838-9850860 TCTCTCTGTCCTGTGCATTTTGG + Intergenic
1164410826 19:28003399-28003421 TCTCCCTGCCACCTGCATTACGG + Intergenic
1164515776 19:28934096-28934118 TCTCCCTGCCACCTGCATTACGG + Intergenic
1165609817 19:37141685-37141707 TCTCTCTGTCTCCTGCACCTAGG - Intronic
1165972452 19:39643376-39643398 TCAACCTGTCACCTACATTAGGG - Intergenic
1168266349 19:55225686-55225708 TCCATCCATGACCTGCATTTAGG - Intergenic
1168266364 19:55225784-55225806 TCCATCCATGACCTGCATTTAGG - Intergenic
1168266369 19:55225831-55225853 TCTATCCATGACCTGCATTTAGG - Intergenic
925010904 2:485512-485534 TCTTAGTGTCACCTCCATTTTGG - Intergenic
925175155 2:1778017-1778039 TCTGTCTGTCACTTTCCTTTTGG + Intergenic
925809211 2:7682381-7682403 TCTCTCTGTTACAAGCATTTGGG + Intergenic
925883339 2:8370779-8370801 TTTACCCCTCACCTGCATTTAGG - Intergenic
926392777 2:12410867-12410889 TCTATCATTGACCGGCATTTGGG + Intergenic
928336337 2:30401629-30401651 TCTATCTGTCAGCTCCAAGTTGG - Intergenic
932050585 2:68394053-68394075 TCTATCTATACTCTGCATTTTGG + Intronic
933836682 2:86251524-86251546 TCCACCTGTCCACTGCATTTAGG + Intronic
935129258 2:100249110-100249132 GCTATCTGTGCCCTGGATTTGGG + Intergenic
937768582 2:125692011-125692033 TCTATGTGTCATCTGCAATTAGG - Intergenic
939247789 2:139647246-139647268 TCTATCATTCACTGGCATTTCGG + Intergenic
939874545 2:147562609-147562631 TCCATCTGTCTCCTGGGTTTAGG - Intergenic
940122516 2:150282547-150282569 TCTTCCTGACACCTGCATGTGGG + Intergenic
942962199 2:181844395-181844417 TATATCTATCTCCTTCATTTAGG - Intergenic
943492177 2:188568519-188568541 TATATATGTCATCTGAATTTGGG - Intronic
943775148 2:191757374-191757396 TCTGTTTCTCAGCTGCATTTTGG + Intergenic
944322972 2:198369731-198369753 CCTATCTGTCCCCTGCACCTGGG - Intronic
944674414 2:202023316-202023338 TCGATCCGTCACCTCCCTTTGGG + Intergenic
946707532 2:222473242-222473264 CCTAGCTGACACCTTCATTTTGG - Intronic
947067590 2:226246563-226246585 CCTATTGGTTACCTGCATTTTGG - Intergenic
1170730536 20:18971057-18971079 TCATTCTCGCACCTGCATTTGGG - Intergenic
1171336697 20:24391958-24391980 TCCATCTGACACCTGCTTCTTGG - Intergenic
1172839849 20:37896170-37896192 TCTTGCTGGCACCTTCATTTTGG + Intergenic
1174120896 20:48264669-48264691 TCTAGCTGACACCTTGATTTTGG - Intergenic
1174976887 20:55345752-55345774 ACTCTGTCTCACCTGCATTTAGG + Intergenic
1177803964 21:25855917-25855939 TCCATCTGCAAGCTGCATTTTGG - Intergenic
1179063758 21:38004863-38004885 TCAGTTTGTCAGCTGCATTTTGG - Intronic
1179482257 21:41685756-41685778 TCTTCCTGTCTCCTGCATCTGGG + Intergenic
1180461275 22:15567389-15567411 TCTATCAGTGACGGGCATTTGGG - Intergenic
1182105296 22:27684906-27684928 TCTGTCTGTTTCCTGCTTTTAGG + Intergenic
1182192557 22:28477907-28477929 TTTGTCTGTCTCCTGCATCTTGG - Intronic
949972961 3:9426856-9426878 GCTATATGTCACCTCCAATTGGG + Intronic
951023962 3:17811057-17811079 CCTATCTTTCACCTGGATTCTGG - Intronic
954123786 3:48516901-48516923 TGTCTTTGTCACCTGCATCTGGG - Intergenic
956533711 3:70251828-70251850 TCTATGAGTCAGCTGCAGTTTGG - Intergenic
956645712 3:71453704-71453726 TCTAAATGTCATCAGCATTTTGG - Intronic
956971317 3:74530287-74530309 TCTTTCTGGCACCTCCCTTTGGG - Intergenic
957218200 3:77348707-77348729 ACTATCTGTCACCTGAATTATGG + Intronic
963589206 3:147235236-147235258 TCTATCATTCACAGGCATTTGGG + Intergenic
967431111 3:189386222-189386244 TGTACCTTTCCCCTGCATTTTGG + Intergenic
970245088 4:14052827-14052849 TCAACCTGTCACCTACATTAGGG - Intergenic
970989669 4:22198124-22198146 TCTATCATTCACGAGCATTTGGG + Intergenic
970990634 4:22209399-22209421 TCTCACTGCCACCTGCGTTTGGG + Intergenic
971515112 4:27475903-27475925 CCTATCTGTCTCCTTAATTTGGG - Intergenic
975133649 4:70852720-70852742 TCTAACAGTCACCATCATTTTGG - Intergenic
977644174 4:99393266-99393288 TCTTTATTTCACCTTCATTTTGG - Intergenic
979435392 4:120682861-120682883 TTTATTTGTCATCTGCATATAGG - Intergenic
980253161 4:130344310-130344332 TATATCTGTCACCACCACTTCGG - Intergenic
982700645 4:158657305-158657327 GTTACCTGTCACCTGCACTTTGG - Intergenic
984265319 4:177491685-177491707 TCTATCTCTCACCTGAATGATGG - Intergenic
986290453 5:6395330-6395352 TCTGTTTGTCACCTGCAGTGAGG + Intergenic
989459791 5:41684098-41684120 TCTAGCTGCTACCTACATTTTGG - Intergenic
990241312 5:53819275-53819297 TCTACCTGTCAACTGCTTTGGGG - Intergenic
992800666 5:80292876-80292898 TCTATCTCTCATCTGCATCTTGG + Intergenic
993707448 5:91187055-91187077 TCTATTTTTCCCCTGTATTTGGG + Intergenic
994656443 5:102599828-102599850 TCTATTGGTCAGCTGCATATAGG - Intergenic
995400963 5:111741160-111741182 CGTATCTGTCTCCTGCAATTAGG + Intronic
995446680 5:112252509-112252531 TCAATCTGACTCCTGCCTTTGGG - Intronic
996143001 5:119937693-119937715 TGTATTTTTCACCTGCATTGTGG + Intergenic
996277795 5:121688713-121688735 TCATTCTGACACCTGGATTTTGG - Intergenic
999481874 5:151956165-151956187 TCTATCTGGCATCTCCTTTTCGG + Intergenic
1001392010 5:171387293-171387315 TCTCTCTGGCACCTGAACTTTGG + Intronic
1001458858 5:171890454-171890476 TCTCTCTGTCACCTGCCTCCTGG - Intronic
1002719803 5:181251515-181251537 TCTATCTTTCCCCTTCCTTTGGG + Intergenic
1003133470 6:3415297-3415319 TCTACATGTCACGTGGATTTTGG - Intronic
1010133555 6:72523619-72523641 TCTAATTCTCACCTGCATTTGGG + Intergenic
1014819816 6:125975331-125975353 TTTATCTATTACCTGCATATAGG + Intronic
1017362135 6:153587122-153587144 TCAATGTTACACCTGCATTTTGG - Intergenic
1018791017 6:167147782-167147804 TCTGTCAGTCAGCTGAATTTAGG + Intronic
1019310609 7:358942-358964 TCTCTCTGTCCCCTGCCCTTCGG + Intergenic
1023713039 7:43014824-43014846 ACTACCTGGCACCTGCATCTGGG - Intergenic
1024391545 7:48818501-48818523 TCTATCTGTCACCCAAATTGGGG - Intergenic
1027905991 7:84182740-84182762 TCAGTCTTTCACCTTCATTTAGG - Intronic
1028149019 7:87350839-87350861 TTTACCTGTCACCTGAATTTGGG + Intronic
1030112258 7:106036917-106036939 CCTATGTGTCACCTGCACTGGGG + Intergenic
1030365416 7:108640397-108640419 TATATTTGACACCTTCATTTCGG - Intergenic
1030766343 7:113414328-113414350 TGTGTCTGTCTGCTGCATTTTGG + Intergenic
1031608443 7:123796286-123796308 TCCTTCTGTCACTTGGATTTAGG + Intergenic
1032415424 7:131732050-131732072 ACTATTTGACACCTCCATTTAGG + Intergenic
1032619020 7:133508692-133508714 TGTACCTGTCTCCTCCATTTGGG + Intronic
1033331513 7:140420726-140420748 GCTGTCTGTGACCTGCATTCTGG + Intronic
1035302639 7:157907389-157907411 TCTCCCTGTCCCCTGCATGTGGG + Intronic
1035302694 7:157907594-157907616 TCTCCCTGTCCCCTGCATGTGGG + Intronic
1036615410 8:10383799-10383821 GCTTGCTGTCACCTTCATTTTGG + Intronic
1037495688 8:19438448-19438470 TTTCTATGTCACCTGCATTTAGG + Intronic
1037834513 8:22208229-22208251 TGTTTCTGGGACCTGCATTTAGG - Intronic
1038105735 8:24431828-24431850 TCTATTTATCATCTTCATTTTGG - Intergenic
1044492707 8:92838779-92838801 TCTTTATTTCACCTTCATTTTGG + Intergenic
1045365811 8:101475161-101475183 TCTCTCTGTCACTTGCTTTAGGG + Intergenic
1046763774 8:118047798-118047820 TTCACCTGTCACCTACATTTAGG + Intronic
1047669585 8:127130448-127130470 TCTATCTGTCAACTGCTGTTTGG + Intergenic
1048134116 8:131729475-131729497 TCTGTCTGTCTCTTGAATTTTGG - Intergenic
1050025010 9:1324638-1324660 TCTATGGGTCACCCCCATTTTGG - Intergenic
1050706706 9:8408045-8408067 TGTGTCTGTCACCAGCAATTAGG - Intronic
1055851909 9:80642091-80642113 TCTATCATTCACGGGCATTTGGG - Intergenic
1056789007 9:89613329-89613351 TCTATCGCTCACCTGCAGCTGGG + Intergenic
1058238359 9:102522786-102522808 TCTACCATTCACGTGCATTTAGG + Intergenic
1058702465 9:107612433-107612455 TCTGTCTGTCATCAGGATTTGGG + Intergenic
1058828014 9:108792462-108792484 TCTCTCTGCCAGCTGCATATGGG - Intergenic
1060019989 9:120120892-120120914 TCGTACTGTCACCTGCATTATGG + Intergenic
1061022809 9:128027122-128027144 TGTAAGTGTCACTTGCATTTAGG + Intergenic
1062278748 9:135742726-135742748 TCCATCTGTCTCCCGCATTCTGG + Intronic
1185782099 X:2856805-2856827 TCTATCTATCACCTCTATCTAGG + Intronic
1186280174 X:7984417-7984439 TCATTCTGTCACTTGCATATTGG + Intergenic
1186353220 X:8761591-8761613 TCGTTCTGTCACTTGCATATTGG - Intergenic
1188938468 X:36207386-36207408 TCTACCTGTCTTCTGCAGTTAGG - Intergenic
1189959612 X:46311923-46311945 TTGAGCTGTCACATGCATTTTGG + Intergenic
1191090702 X:56617376-56617398 TCTATCATTCATGTGCATTTGGG + Intergenic
1193733035 X:85124677-85124699 TCTTTCTGCCCACTGCATTTTGG + Intergenic
1193992846 X:88329555-88329577 TCTAGCTGACACCTGGATTTTGG + Intergenic
1194739578 X:97556788-97556810 TCTTTCTATCCCCAGCATTTAGG - Intronic
1195143448 X:101987619-101987641 TCTGTGTGTCACCTTGATTTTGG + Intergenic
1198674449 X:139117425-139117447 TCTATCTGTCATCTATATATTGG + Intronic
1200324332 X:155222161-155222183 TCTATCTGTAACCTCCCTGTAGG - Intronic