ID: 1068253383

View in Genome Browser
Species Human (GRCh38)
Location 10:54473046-54473068
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068253381_1068253383 -9 Left 1068253381 10:54473032-54473054 CCTAAATGCAGGTGACAGATAGA 0: 1
1: 0
2: 2
3: 11
4: 205
Right 1068253383 10:54473046-54473068 ACAGATAGACCTCAGTGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr