ID: 1068253560

View in Genome Browser
Species Human (GRCh38)
Location 10:54476718-54476740
Sequence AAAGGTTTCTAGAAGTCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068253560_1068253561 -10 Left 1068253560 10:54476718-54476740 CCTTCAGACTTCTAGAAACCTTT No data
Right 1068253561 10:54476731-54476753 AGAAACCTTTTCTACACTCCAGG No data
1068253560_1068253563 2 Left 1068253560 10:54476718-54476740 CCTTCAGACTTCTAGAAACCTTT No data
Right 1068253563 10:54476743-54476765 TACACTCCAGGTTCTTTTTGTGG No data
1068253560_1068253565 20 Left 1068253560 10:54476718-54476740 CCTTCAGACTTCTAGAAACCTTT No data
Right 1068253565 10:54476761-54476783 TGTGGTCATCTGTTATTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068253560 Original CRISPR AAAGGTTTCTAGAAGTCTGA AGG (reversed) Intronic
No off target data available for this crispr