ID: 1068253561

View in Genome Browser
Species Human (GRCh38)
Location 10:54476731-54476753
Sequence AGAAACCTTTTCTACACTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068253560_1068253561 -10 Left 1068253560 10:54476718-54476740 CCTTCAGACTTCTAGAAACCTTT No data
Right 1068253561 10:54476731-54476753 AGAAACCTTTTCTACACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068253561 Original CRISPR AGAAACCTTTTCTACACTCC AGG Intronic
No off target data available for this crispr