ID: 1068253565

View in Genome Browser
Species Human (GRCh38)
Location 10:54476761-54476783
Sequence TGTGGTCATCTGTTATTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068253560_1068253565 20 Left 1068253560 10:54476718-54476740 CCTTCAGACTTCTAGAAACCTTT No data
Right 1068253565 10:54476761-54476783 TGTGGTCATCTGTTATTCTGTGG No data
1068253562_1068253565 2 Left 1068253562 10:54476736-54476758 CCTTTTCTACACTCCAGGTTCTT 0: 1
1: 0
2: 3
3: 28
4: 263
Right 1068253565 10:54476761-54476783 TGTGGTCATCTGTTATTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068253565 Original CRISPR TGTGGTCATCTGTTATTCTG TGG Intronic
No off target data available for this crispr