ID: 1068254901

View in Genome Browser
Species Human (GRCh38)
Location 10:54497004-54497026
Sequence CTGGACCATAGTGCTTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068254892_1068254901 19 Left 1068254892 10:54496962-54496984 CCCACGCCTCACTGCAGTGCACT 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1068254901 10:54497004-54497026 CTGGACCATAGTGCTTTTGTTGG No data
1068254893_1068254901 18 Left 1068254893 10:54496963-54496985 CCACGCCTCACTGCAGTGCACTC 0: 1
1: 0
2: 1
3: 20
4: 173
Right 1068254901 10:54497004-54497026 CTGGACCATAGTGCTTTTGTTGG No data
1068254894_1068254901 13 Left 1068254894 10:54496968-54496990 CCTCACTGCAGTGCACTCTCCTG 0: 1
1: 0
2: 4
3: 33
4: 329
Right 1068254901 10:54497004-54497026 CTGGACCATAGTGCTTTTGTTGG No data
1068254897_1068254901 -6 Left 1068254897 10:54496987-54497009 CCTGCAGTCCCCTGGCACTGGAC 0: 1
1: 0
2: 2
3: 24
4: 248
Right 1068254901 10:54497004-54497026 CTGGACCATAGTGCTTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068254901 Original CRISPR CTGGACCATAGTGCTTTTGT TGG Intronic
No off target data available for this crispr