ID: 1068255569

View in Genome Browser
Species Human (GRCh38)
Location 10:54505355-54505377
Sequence GGGTTTTTAACTTAGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068255569_1068255573 -1 Left 1068255569 10:54505355-54505377 CCATGCTCCTAAGTTAAAAACCC 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1068255573 10:54505377-54505399 CTATTTGTCTGTGTGTAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068255569 Original CRISPR GGGTTTTTAACTTAGGAGCA TGG (reversed) Intronic
901600067 1:10416689-10416711 GGGTTTTTCTCTTACGGGCAGGG + Intronic
901947275 1:12713943-12713965 GGGTTTTTCTCTTACGGGCAGGG - Intergenic
912284723 1:108357071-108357093 GGGTTTCCAACTTAGGCACAGGG - Intergenic
915135043 1:153725529-153725551 GGTTTTTTAAAGTAGGAGCTGGG - Intergenic
916941500 1:169683286-169683308 GGGTTTTTCACTTGTGGGCAGGG - Intronic
918042388 1:180921194-180921216 GGGTTTTTCTCTTACGGGCAGGG + Intronic
922626872 1:227056246-227056268 GTGTTTTTTACTTTGAAGCAAGG - Intronic
923480752 1:234381026-234381048 TTGTTCCTAACTTAGGAGCAGGG + Intronic
1063430720 10:5985785-5985807 TGGCTTTTGACTTAGGAACAAGG + Intergenic
1064092524 10:12396861-12396883 GGGTTTTTAACTCAGTCGTAAGG + Intronic
1065107984 10:22409862-22409884 AGGTTTTGATCTTAGGATCAGGG - Intronic
1066512506 10:36117406-36117428 GGGTTTTTATCTCAGGGACAGGG - Intergenic
1068180311 10:53509767-53509789 GGTTATTTAACTTAGGATAATGG + Intergenic
1068255569 10:54505355-54505377 GGGTTTTTAACTTAGGAGCATGG - Intronic
1070606963 10:77905503-77905525 GTGTTTTTAACGTAGGGACAAGG - Intronic
1070797817 10:79227263-79227285 GGGTGTTTAACCTACCAGCAAGG - Intronic
1073004357 10:100311074-100311096 TGGTTTTTATATAAGGAGCATGG - Intronic
1078093257 11:8280766-8280788 GAGTTTTGAACTTGGGACCAAGG + Intergenic
1078427616 11:11264724-11264746 GGGTTTGTGTCTTTGGAGCAGGG + Intergenic
1081194303 11:40142407-40142429 GGATTTATAACTTTAGAGCAAGG + Intronic
1083386693 11:62316184-62316206 GGGTTTCTAATTTATAAGCAGGG - Intergenic
1083590412 11:63890359-63890381 GGGTTGGTGACTTTGGAGCAGGG + Intronic
1084164443 11:67368542-67368564 GGGATTTTAAGTGAGGACCAAGG + Intronic
1085489936 11:76906121-76906143 TAGTTTTTAACTTTGAAGCAAGG + Intronic
1087063057 11:94001270-94001292 GCCTTTTTAAATTAGTAGCAAGG - Intergenic
1087613295 11:100459657-100459679 GGGTTTTTAACTCAGAAGGATGG + Intergenic
1093904129 12:24669670-24669692 AGGTTTGTAGCCTAGGAGCAAGG + Intergenic
1100910614 12:99357397-99357419 GAGATTTAAACTCAGGAGCATGG - Intronic
1103280663 12:119755618-119755640 GGGCTTTTAGCCTAGCAGCAGGG - Intronic
1104225368 12:126827582-126827604 GGGTTTTTAAATGAGGATGAAGG + Intergenic
1107536376 13:41338950-41338972 GGATTTTTAACTTTCGAGGAAGG + Intronic
1108196673 13:48001951-48001973 GGGTTTTTCTCTTACGGGCAGGG + Intergenic
1111174635 13:84579029-84579051 GGGTTTTTCTCTTATGGGCAGGG - Intergenic
1111816691 13:93162805-93162827 GGGTTTTTATCTGAAGAACAGGG - Intergenic
1117226761 14:53669160-53669182 TGGTTATTAACTTAGTAACATGG + Intergenic
1119674566 14:76544237-76544259 TGGTTTTAAAGATAGGAGCAGGG - Intergenic
1120009814 14:79400895-79400917 GTGTTCCTAACTTATGAGCAGGG + Intronic
1121702772 14:95968449-95968471 GGGTTTTTCTCTTACGGGCAGGG - Intergenic
1123501740 15:20891521-20891543 GAGTTTTTACCTTAAAAGCATGG + Intergenic
1123558992 15:21465220-21465242 GAGTTTTTACCTTAAAAGCATGG + Intergenic
1123595222 15:21902501-21902523 GAGTTTTTACCTTAAAAGCATGG + Intergenic
1125499339 15:40229007-40229029 GGCTTTCTAGCTTAGGGGCATGG + Intergenic
1202967341 15_KI270727v1_random:192379-192401 GAGTTTTTACCTTAAAAGCATGG + Intergenic
1140317331 16:73911870-73911892 GGTTTTGTAACTGAGGAGCAGGG - Intergenic
1143548090 17:7611894-7611916 TGGTTTTTAACTCAGGAACAGGG + Intronic
1144591657 17:16529162-16529184 GAGTTTATAACCAAGGAGCAGGG - Intergenic
1153439592 18:5101775-5101797 GGATTTATAACAAAGGAGCAGGG + Intergenic
1153614673 18:6923542-6923564 GGGTTTCTAGCCAAGGAGCAGGG - Intergenic
1156337462 18:36184249-36184271 GAGTTGTTAACCTGGGAGCAAGG + Intergenic
1157277356 18:46320982-46321004 TGGATTTTGACTTAGGAGAAGGG + Intergenic
1157735664 18:50046505-50046527 AGGTTTTTAACTTAGGTCCATGG + Intronic
1157810614 18:50692866-50692888 GGGTTTTGAACTCATGAGTAAGG + Intronic
1158383786 18:56966158-56966180 GGATTTATAACCAAGGAGCAGGG + Intronic
1159880471 18:73854093-73854115 TGTTTTTTAACCTAGGAGTAGGG + Intergenic
1160601957 18:80020548-80020570 GGAGTTTTAACTTAGGCTCAAGG - Intronic
1160871368 19:1279355-1279377 GGGTTCCTTACTTGGGAGCAAGG - Intergenic
927012198 2:18915574-18915596 GGGCTTTTAGATGAGGAGCAAGG - Intergenic
927133891 2:20082801-20082823 GGGTTTTTCTCTTACGGGCAGGG - Intergenic
938872562 2:135495721-135495743 GTGATTTTAATTTAGGAGGATGG + Intronic
940462689 2:153987053-153987075 GTGGTTTGAACTTAGGAGCAAGG + Intronic
944548519 2:200822641-200822663 GGGTTTTTCATTGATGAGCAGGG - Intronic
945813612 2:214577146-214577168 GGGTTTTTAGGGCAGGAGCATGG - Exonic
948030735 2:234815401-234815423 GGGTCATGAACTTAGGAGCCAGG + Intergenic
948234363 2:236376843-236376865 AGGTTTTTAACCTACTAGCAAGG - Intronic
1169531586 20:6490703-6490725 ATGTTTTTAACTTTGGGGCAAGG + Intergenic
1169620732 20:7503856-7503878 GTATTTTTATCTTAGCAGCAAGG - Intergenic
1169893558 20:10478707-10478729 GGATTTTTTACTGAGGGGCAAGG - Intronic
1170618114 20:17970456-17970478 GTTTTTTTAACTTACTAGCAAGG + Intronic
1172303551 20:33865898-33865920 GAGTTTTTACATCAGGAGCAGGG - Intergenic
1173441176 20:43077637-43077659 GTGTTTTTAGATTATGAGCATGG - Intronic
1173830162 20:46078506-46078528 GGCTTTTTTACTTAGAGGCAAGG + Intronic
1177647712 21:23920762-23920784 GGGTTTTTAAGTTAAGATAATGG - Intergenic
1179147853 21:38784278-38784300 GGGTTTCTAATTTAATAGCATGG + Intergenic
1182386809 22:29950315-29950337 GGGTTTTTTCCTTAGGAGATAGG + Intronic
952143038 3:30500792-30500814 GGGGTTTTACCCTATGAGCAAGG - Intergenic
952225161 3:31367553-31367575 AGGTTTATCACTTTGGAGCATGG - Intergenic
952379928 3:32796632-32796654 GGGTTTTTCTCTTACGGGCAGGG + Intergenic
953531891 3:43746853-43746875 GGGGATTTAAATTGGGAGCAAGG + Intergenic
954473588 3:50722067-50722089 GGGGTTTTTACTTAAGTGCATGG + Intronic
956850242 3:73222136-73222158 TGATTTTTAACTTGGTAGCACGG + Intergenic
957674933 3:83354347-83354369 GGGTTTTTCTCTTACGGGCAGGG + Intergenic
957800443 3:85072360-85072382 GGGTTTTTAAAATAGGAGACTGG - Intronic
959334941 3:105052319-105052341 CTGTTTTTAACATAGCAGCAAGG + Intergenic
959941338 3:112085045-112085067 GGTTTTTTAACCAAGGAGCAAGG - Intergenic
960355317 3:116645412-116645434 GGGTTTTTCATTGATGAGCAGGG + Intronic
964305799 3:155338374-155338396 AGGTGTTTACCTTAGTAGCAGGG - Intergenic
967051241 3:185786543-185786565 GGGTTTTTCTCTTACGGGCAGGG - Intronic
969195481 4:5560134-5560156 GGGTTTGTTACTTACAAGCAGGG - Intronic
974497160 4:62646930-62646952 AGTTTTTTAACTTAGGATAATGG + Intergenic
976271565 4:83235644-83235666 GGGTTTTTCTCTTATGGGCAGGG - Intergenic
978264293 4:106804044-106804066 GGATTTATAACTGAGGAACAGGG - Intergenic
978275494 4:106944492-106944514 GGGTTTTAAACCTGGGATCAGGG - Intronic
980313433 4:131164814-131164836 GGGTATTTAACCTAGGAGGTTGG + Intergenic
981932669 4:150207948-150207970 GGGATTATAACCAAGGAGCAGGG + Intronic
982350110 4:154406184-154406206 GGGTGTTTACCATAGGACCATGG - Intronic
984471625 4:180183055-180183077 GGGTCTTCAATTTAGTAGCAGGG + Intergenic
986134305 5:4959854-4959876 GGGTTTATGACGAAGGAGCAGGG + Intergenic
987695199 5:21319630-21319652 GGAATTTTGACTTAGAAGCAAGG + Intergenic
987970926 5:24943002-24943024 GGGTTAGTAACATAGGAACAAGG + Intergenic
994173735 5:96687047-96687069 GGGATTTTTAGCTAGGAGCAGGG + Intronic
994299438 5:98129214-98129236 AGGTTTGTAGCTTAGAAGCAAGG - Intergenic
994325504 5:98441143-98441165 GGGTTGTTATCTTGGGGGCAGGG - Intergenic
996918236 5:128735806-128735828 GGGTTTTTCTCTTAGTGGCAGGG - Intronic
999837917 5:155394427-155394449 GGGTTATTAAAATTGGAGCATGG - Intergenic
1004415536 6:15420801-15420823 GGGTTTTTGCCTGAGTAGCAGGG - Intronic
1005015950 6:21375715-21375737 GGCTTTTTATCAGAGGAGCAGGG + Intergenic
1005555685 6:26980207-26980229 GGAATTTTGACTTAGAAGCAAGG - Intergenic
1007084193 6:39131686-39131708 GGGTTTTTCTCTTATGGGCAGGG + Intergenic
1007084873 6:39136244-39136266 GGGTTTTTCTCTTACGGGCAGGG + Intergenic
1008298388 6:49805346-49805368 TGGGTCTTAACTTGGGAGCAGGG - Intergenic
1009380788 6:63026289-63026311 GGATTTATAACCAAGGAGCAGGG + Intergenic
1010027091 6:71231407-71231429 AGGTTTGTAGCTTAGGAGCTAGG + Intergenic
1014296820 6:119628532-119628554 GGGGTTTGAGCTTAGGAACAAGG - Intergenic
1015110095 6:129582965-129582987 GGGTTTATAAATTGGGAGAAAGG - Intronic
1016674415 6:146747644-146747666 GGATTTTTACATTAGGAGCAAGG + Intronic
1017859038 6:158378397-158378419 GGGTTTCTATCTTGGGAGCATGG + Intronic
1018478355 6:164166004-164166026 GGGTTTTTAACTGAGTAGTCAGG - Intergenic
1022660136 7:32359225-32359247 GGATTTATAACCAAGGAGCAGGG - Intergenic
1023309812 7:38873849-38873871 GAGTTTTGGACTTAGGAGGAGGG + Intronic
1026388540 7:69876644-69876666 GGGTTTGTATCCTAGGAGTAGGG + Intronic
1026495585 7:70899095-70899117 GGGTATTTATCTCAGGAGTATGG - Intergenic
1027354930 7:77345690-77345712 GGGGTTTTCTCTTATGAGCAGGG - Intronic
1028590188 7:92485015-92485037 GGGGTTTTCTCTTAGGGGCAGGG + Intergenic
1030943725 7:115689797-115689819 TTGTTTTTAACTTAGGCACAAGG + Intergenic
1036140800 8:6206459-6206481 GGGTTTTAAATTTTGGAGTAGGG - Intergenic
1036592087 8:10177907-10177929 GTTTTCTTAACTTAGGACCAAGG - Intronic
1037715943 8:21400423-21400445 GGATTTTTAATTTAGGAAGAAGG - Intergenic
1038710830 8:29943622-29943644 GGGTTTTTTAATGAGGAGCATGG - Intergenic
1039226867 8:35397885-35397907 GGGCTTTGATCTTAAGAGCAAGG - Intronic
1042785344 8:72539251-72539273 GTGTTTTTAATTTAAGGGCATGG + Intronic
1050317236 9:4414936-4414958 GGGATTTAAGCTAAGGAGCAGGG - Intergenic
1054607498 9:67197528-67197550 GGGATTTTAACGTAGGTGCCTGG - Intergenic
1055136136 9:72831273-72831295 GAGTTTTAAAGTTAGGAGTAAGG - Intronic
1058537567 9:105977896-105977918 GGATTTATAACCGAGGAGCAGGG + Intergenic
1058998478 9:110323437-110323459 GGCTATTTAAATTAGGTGCAGGG + Intronic
1059829055 9:118071942-118071964 TGGGTTTTAACTTAAGAGAAGGG - Intergenic
1189547378 X:42055771-42055793 GGGTTTTAAAATTAGGAGCTTGG + Intergenic
1191882501 X:65856973-65856995 GGATTTATATCTTAGCAGCAGGG - Intergenic
1194011124 X:88563176-88563198 GGTTTTTTCACTTAGGATAATGG - Intergenic
1196862618 X:120041994-120042016 GGGTTTTTCTCTTATGGGCAGGG - Intergenic
1196880484 X:120194350-120194372 GGGTTTTTCTCTTATGGGCAGGG + Intergenic
1197796100 X:130299835-130299857 GGGTTCTGCACCTAGGAGCATGG + Intergenic
1197977014 X:132176520-132176542 GAGATTTTAAATTATGAGCAGGG + Intergenic