ID: 1068260772

View in Genome Browser
Species Human (GRCh38)
Location 10:54578205-54578227
Sequence AAGGCACAAAAACTTCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068260772_1068260776 4 Left 1068260772 10:54578205-54578227 CCTGCAGGAAGTTTTTGTGCCTT No data
Right 1068260776 10:54578232-54578254 AGTTTGAGGGCCCCTAATCTTGG No data
1068260772_1068260773 -10 Left 1068260772 10:54578205-54578227 CCTGCAGGAAGTTTTTGTGCCTT No data
Right 1068260773 10:54578218-54578240 TTTGTGCCTTTCAAAGTTTGAGG No data
1068260772_1068260777 5 Left 1068260772 10:54578205-54578227 CCTGCAGGAAGTTTTTGTGCCTT No data
Right 1068260777 10:54578233-54578255 GTTTGAGGGCCCCTAATCTTGGG No data
1068260772_1068260774 -9 Left 1068260772 10:54578205-54578227 CCTGCAGGAAGTTTTTGTGCCTT No data
Right 1068260774 10:54578219-54578241 TTGTGCCTTTCAAAGTTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068260772 Original CRISPR AAGGCACAAAAACTTCCTGC AGG (reversed) Intronic