ID: 1068260777

View in Genome Browser
Species Human (GRCh38)
Location 10:54578233-54578255
Sequence GTTTGAGGGCCCCTAATCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068260772_1068260777 5 Left 1068260772 10:54578205-54578227 CCTGCAGGAAGTTTTTGTGCCTT No data
Right 1068260777 10:54578233-54578255 GTTTGAGGGCCCCTAATCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068260777 Original CRISPR GTTTGAGGGCCCCTAATCTT GGG Intronic