ID: 1068265434

View in Genome Browser
Species Human (GRCh38)
Location 10:54642413-54642435
Sequence GATCTCACCTCGCTTACTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068265433_1068265434 3 Left 1068265433 10:54642387-54642409 CCTAAATGGACTAAGACAAGACA 0: 1
1: 4
2: 25
3: 130
4: 746
Right 1068265434 10:54642413-54642435 GATCTCACCTCGCTTACTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068265434 Original CRISPR GATCTCACCTCGCTTACTTC TGG Intronic
No off target data available for this crispr