ID: 1068279866

View in Genome Browser
Species Human (GRCh38)
Location 10:54854667-54854689
Sequence CCTGATGATCAGCTGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068279866_1068279871 7 Left 1068279866 10:54854667-54854689 CCTCTCTGCAGCTGATCATCAGG No data
Right 1068279871 10:54854697-54854719 CCCAGCTCTGGCTGATCCCAGGG No data
1068279866_1068279869 6 Left 1068279866 10:54854667-54854689 CCTCTCTGCAGCTGATCATCAGG No data
Right 1068279869 10:54854696-54854718 GCCCAGCTCTGGCTGATCCCAGG No data
1068279866_1068279874 17 Left 1068279866 10:54854667-54854689 CCTCTCTGCAGCTGATCATCAGG No data
Right 1068279874 10:54854707-54854729 GCTGATCCCAGGGCTTTTATGGG No data
1068279866_1068279873 16 Left 1068279866 10:54854667-54854689 CCTCTCTGCAGCTGATCATCAGG No data
Right 1068279873 10:54854706-54854728 GGCTGATCCCAGGGCTTTTATGG No data
1068279866_1068279868 -5 Left 1068279866 10:54854667-54854689 CCTCTCTGCAGCTGATCATCAGG No data
Right 1068279868 10:54854685-54854707 TCAGGACATCTGCCCAGCTCTGG No data
1068279866_1068279877 28 Left 1068279866 10:54854667-54854689 CCTCTCTGCAGCTGATCATCAGG No data
Right 1068279877 10:54854718-54854740 GGCTTTTATGGGCCTCAGAGTGG 0: 65
1: 173
2: 206
3: 195
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068279866 Original CRISPR CCTGATGATCAGCTGCAGAG AGG (reversed) Intronic
No off target data available for this crispr