ID: 1068281006

View in Genome Browser
Species Human (GRCh38)
Location 10:54869809-54869831
Sequence ATGTGCTAGTGGTTCTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 136}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068281006_1068281008 22 Left 1068281006 10:54869809-54869831 CCTTCACAGAACCACTAGCACAT 0: 1
1: 0
2: 1
3: 8
4: 136
Right 1068281008 10:54869854-54869876 AATACTGACACATTTTCACATGG No data
1068281006_1068281009 23 Left 1068281006 10:54869809-54869831 CCTTCACAGAACCACTAGCACAT 0: 1
1: 0
2: 1
3: 8
4: 136
Right 1068281009 10:54869855-54869877 ATACTGACACATTTTCACATGGG No data
1068281006_1068281010 24 Left 1068281006 10:54869809-54869831 CCTTCACAGAACCACTAGCACAT 0: 1
1: 0
2: 1
3: 8
4: 136
Right 1068281010 10:54869856-54869878 TACTGACACATTTTCACATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068281006 Original CRISPR ATGTGCTAGTGGTTCTGTGA AGG (reversed) Intronic
900425280 1:2575562-2575584 AAGTGATGGTGGTTATGTGAGGG + Intergenic
902232840 1:15038727-15038749 ATCTGCTATTGGTACTGTCACGG - Intronic
903702764 1:25262905-25262927 ATTTGTTAGTGTGTCTGTGAGGG - Intronic
903712031 1:25333231-25333253 ATTTGTTAGTGTGTCTGTGAGGG - Intronic
908466014 1:64396364-64396386 TTGTGTTAGTGGTACTGTGAGGG - Intergenic
909062905 1:70899678-70899700 TTATGCTAGTAGTTGTGTGAAGG + Intronic
911753684 1:101528315-101528337 AAGTGCTTGTGAGTCTGTGATGG + Intergenic
911996166 1:104769669-104769691 ATATGCTTGTGTTTTTGTGATGG - Intergenic
913611755 1:120515652-120515674 ATGTGATACTGGTGCTGTAAGGG - Intergenic
914579436 1:149006587-149006609 ATGTGATACTGGTGCTGTAAGGG + Intronic
918481983 1:184988449-184988471 ATCTGCTAGGGTGTCTGTGATGG + Intergenic
918851038 1:189690874-189690896 AGGTCCCAGTGGTTCTGAGAAGG + Intergenic
919364620 1:196641944-196641966 AAGTGCTGGTGGTTGTGTGAGGG + Intergenic
919702374 1:200643908-200643930 ATGTGCTTGTGGAACTGTGGGGG + Intronic
924787786 1:247216213-247216235 TTGTGTAAATGGTTCTGTGATGG + Intergenic
1063384793 10:5609399-5609421 ATGTGATAATGGTGCTGGGATGG - Intergenic
1063422064 10:5920875-5920897 AGGTGCTAGTGCTTCTGCCATGG + Intronic
1067814009 10:49457809-49457831 ATGTGTTTGTGGTTCTGTGATGG - Exonic
1068281006 10:54869809-54869831 ATGTGCTAGTGGTTCTGTGAAGG - Intronic
1068312570 10:55296652-55296674 ATGTATTAATGCTTCTGTGACGG - Intronic
1070959597 10:80489450-80489472 AGCTGCAACTGGTTCTGTGAGGG - Intronic
1073073884 10:100811380-100811402 ATTTGCTAGAGGTACTGTCAAGG + Intronic
1074498589 10:114002001-114002023 ATGTGCTAGATGTTATGTGCTGG - Intergenic
1078289874 11:9998290-9998312 ATGTAGAAGTGGTTCTGGGAGGG + Exonic
1081309836 11:41556313-41556335 ATGTGATGGTGGTTATATGATGG + Intergenic
1085610656 11:77945740-77945762 GTGGGCAGGTGGTTCTGTGATGG - Intronic
1086341926 11:85855604-85855626 GTGTGCTAGGGGCTGTGTGAGGG - Intronic
1086788802 11:91007825-91007847 ATGTGATTGTGGTTATGTGGTGG + Intergenic
1086932235 11:92705605-92705627 ATGTGGTGGTGGTGGTGTGATGG + Intronic
1087636967 11:100712665-100712687 ATGTGCGTGTGTTTGTGTGAGGG + Intronic
1090771268 11:129921631-129921653 AGGTGGTAGTGGTTTTGTGCTGG + Intronic
1091314806 11:134606813-134606835 AAGTGTGTGTGGTTCTGTGAGGG + Intergenic
1093886273 12:24465069-24465091 ATGTGCCAGTAATTGTGTGAAGG + Intergenic
1097861455 12:64522520-64522542 AGGTGCTAGTGTTTATGTGTGGG - Intergenic
1100232154 12:92619411-92619433 ATTTGCTAGTGGTTCATTAAGGG - Intergenic
1106116946 13:26825938-26825960 ATGTGCAAGATGTTCTCTGAAGG - Intergenic
1108434277 13:50386444-50386466 AGGTGCTAGAGCTGCTGTGAGGG - Intronic
1111436488 13:88216438-88216460 ATGTGAAAGTGGTTTTGGGATGG + Intergenic
1113571038 13:111358158-111358180 ATGTGCTTGTGGTATTGTGTGGG + Intergenic
1115341058 14:32293297-32293319 CTATGTTAGTGGTTCTTTGATGG - Intergenic
1117446026 14:55804659-55804681 AGGTGCAAGTGTTTCTGTGGAGG - Intergenic
1117462888 14:55963861-55963883 ACATCCTAGTGGTTCTGTCAGGG - Intergenic
1118127589 14:62925613-62925635 ATGTGCCAGGGGTGCTGAGATGG - Intronic
1121956798 14:98220865-98220887 ATGGGTTAGTGGTACTGTAAAGG - Intergenic
1129037669 15:72660512-72660534 ATTGGGTAGTTGTTCTGTGAAGG + Intronic
1129212218 15:74076713-74076735 ATTGGGTAGTTGTTCTGTGAAGG - Intronic
1129398179 15:75264366-75264388 ATTGGGTAGTTGTTCTGTGAAGG + Intronic
1129401790 15:75288647-75288669 ATTGGGTAGTTGTTCTGTGAAGG + Intronic
1129729347 15:77921031-77921053 ATTGGATAGTTGTTCTGTGAAGG - Intergenic
1130343549 15:83020462-83020484 ATATGCTACTGCTTTTGTGAAGG + Intronic
1135065190 16:19303794-19303816 ATTTGCTAGTGTTTTTGAGATGG + Intronic
1135982543 16:27159568-27159590 AGGTGGGAGTGGCTCTGTGAGGG - Intergenic
1138814168 16:60185268-60185290 TTGTGATGGTGGTTATGTGAAGG + Intergenic
1147540149 17:41350619-41350641 AACTGCAACTGGTTCTGTGAGGG - Exonic
1147543701 17:41382098-41382120 AACTGCAACTGGTTCTGTGAGGG - Exonic
1150504968 17:65689478-65689500 ACATGCTTGTGGTTCTGTGCTGG - Intronic
1150930424 17:69578927-69578949 ATGTGCTGATGTTTCTGGGAAGG - Intergenic
1150999903 17:70362946-70362968 ATAGGCTAGTTGGTCTGTGATGG + Intergenic
1158196535 18:54892354-54892376 CTGTGTTAGTGTCTCTGTGAGGG - Exonic
1158489254 18:57895143-57895165 ATTTCCTCGTGGTTCTGAGATGG - Intergenic
1158633513 18:59136520-59136542 ATGCTCCAGTGGTTCTGTGCAGG + Intergenic
1159424138 18:68261920-68261942 ATTTGCTAGGGGTTCTCTGGAGG + Intergenic
1162578118 19:11511129-11511151 AAGAGCCAGTGGTTCTGAGATGG - Intronic
1164830073 19:31313574-31313596 ATATGCCAGTGCCTCTGTGAGGG + Intronic
1168434168 19:56304319-56304341 TTATGCTAGTGGTTCTGAAACGG + Intronic
926321445 2:11750964-11750986 ATGTGCCATTGGGTCTTTGAAGG + Intronic
926578072 2:14604670-14604692 ATTTGCTAGTGTTTCTCAGAGGG + Intergenic
931767860 2:65472803-65472825 CAGTGCTAGTGGTGCTGGGATGG + Intergenic
938702202 2:133889617-133889639 ATGTGCTAACAGTTCTGTGATGG - Intergenic
942509766 2:176685442-176685464 ATGTGTTTGTGTTTCTGAGATGG - Intergenic
942821847 2:180123894-180123916 ATCTGCTGGTGGTTCTGAGAAGG - Intergenic
944036934 2:195305810-195305832 ATTTCCCAGTGGTTCTTTGATGG - Intergenic
944446633 2:199798454-199798476 AAGTGCTACAGGTTCTGTGGAGG + Intronic
947653096 2:231803793-231803815 ATGAGTTTGTGGCTCTGTGAAGG + Intronic
948301721 2:236912574-236912596 AGGTGCTGGGGGTTCTGGGAAGG - Intergenic
1174293209 20:49524025-49524047 ATGTGCAAGTGGGTGTGTGCAGG - Intronic
1177442566 21:21145951-21145973 ATGTGCCAGCTCTTCTGTGAAGG - Intronic
1183718364 22:39547595-39547617 TTGTGCTTGTGTTTGTGTGAGGG + Intergenic
1184771459 22:46599103-46599125 GTGTGCTAGGGGTTCTGTCAAGG - Intronic
1185090255 22:48763555-48763577 ATTTTCTAGTGGTTCTGCTAAGG - Intronic
949146569 3:708291-708313 ATGTGCTAAAGGGTCTGAGAAGG - Intergenic
949230230 3:1742400-1742422 ATTTGCATCTGGTTCTGTGAAGG - Intergenic
952093754 3:29923305-29923327 ATGTGCTAGTTTATCTGTGATGG - Intronic
957364204 3:79200947-79200969 ATGTGCTAATGGTTCTGAATAGG + Intronic
966620587 3:181958997-181959019 ATATGCTAGTGGTTGTGTAGTGG + Intergenic
969893901 4:10285069-10285091 ATATTCTAGTGCTTCTGTGGTGG + Intergenic
970215805 4:13759023-13759045 ATTTTCTGGTGGTTCTGTGAGGG + Intergenic
971071595 4:23099662-23099684 ATGTTCTAGTGGGTTTATGATGG + Intergenic
978849339 4:113314457-113314479 ATGTACTAGGGGTTTTGTTATGG - Intronic
983731482 4:170999325-170999347 ATGTGCCACTGTTTCTTTGAAGG + Intergenic
985023209 4:185713131-185713153 ATGAGCTAGAGGTGCAGTGAGGG - Intronic
988129662 5:27086365-27086387 ATTTGTTAGTGTTTCTGTAAAGG - Intronic
988905105 5:35779700-35779722 ATGAGTTTGTGTTTCTGTGAGGG + Intronic
989154904 5:38335237-38335259 ATGTGCCAGTGTTTCTAGGATGG - Intronic
990118150 5:52414526-52414548 ATGTACAAGTGGTTATCTGAGGG - Intergenic
990590681 5:57260272-57260294 ATCTGCTGCTGCTTCTGTGAGGG + Intronic
990689441 5:58346953-58346975 ATGAGCTCCTGATTCTGTGATGG - Intergenic
990843819 5:60113891-60113913 AGGTACTACTGGTGCTGTGAGGG - Intronic
992537003 5:77716960-77716982 ATCTGCTGGGGGTTCTGAGAAGG + Intronic
993692317 5:91017379-91017401 ATGTACCAGTGGATCTGTGGGGG + Intronic
996327214 5:122288530-122288552 GTGTGTGAGTGGTCCTGTGATGG + Intergenic
996819592 5:127611849-127611871 ATGTCCTAGTGGAGATGTGAAGG + Intergenic
997121419 5:131176964-131176986 AGGTGCTAGTAGAACTGTGAGGG - Intronic
997122163 5:131186006-131186028 ATTTGTCAGTGGTTCTGTAAAGG + Intronic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
1000086762 5:157894464-157894486 ATGAGTTAGTGGTTGTGTCAGGG - Intergenic
1001296000 5:170499426-170499448 AAGTGGTAGTGTTGCTGTGAGGG - Intronic
1003403461 6:5809666-5809688 ATGTGCTTGTGGATGTGTGCAGG + Intergenic
1005905039 6:30255048-30255070 CTGTGCTTCTGGGTCTGTGATGG + Intergenic
1010169655 6:72960200-72960222 TTGTGCTAGTGATACTGTGATGG - Intronic
1013805803 6:113994405-113994427 ATGTGTTAGAAATTCTGTGATGG - Intronic
1025842448 7:65163306-65163328 GTGGGCAGGTGGTTCTGTGATGG + Intergenic
1025880597 7:65532663-65532685 GTGGGCAGGTGGTTCTGTGATGG - Intergenic
1025892840 7:65669941-65669963 GTGGGCAGGTGGTTCTGTGATGG + Intergenic
1026107862 7:67435162-67435184 ATGTGCAGGTGCTTCTGTGTGGG + Intergenic
1027483346 7:78727275-78727297 ATGCGCTATTAGCTCTGTGATGG + Intronic
1028647904 7:93119174-93119196 TTATTCTGGTGGTTCTGTGAGGG + Intergenic
1029905858 7:104092994-104093016 AAGTGTTAGCGGTTCTGCGAAGG + Intergenic
1031845035 7:126795309-126795331 ATGAGATAGTGGAGCTGTGATGG - Intronic
1032871625 7:135991961-135991983 ATGTGCTAGTGGTGGGGTGGGGG + Intergenic
1033399293 7:141006747-141006769 TTGTGGCAGTGTTTCTGTGAGGG - Intronic
1035653548 8:1287721-1287743 ATGTGTGTGTGGTTCTGTTAGGG + Intergenic
1036983601 8:13499745-13499767 ATGCACTAGTGTTTCTGTGCTGG + Exonic
1040790705 8:51225513-51225535 AGGTGCAAGAGGTTCTGAGATGG + Intergenic
1045316311 8:101046627-101046649 ATGTGCAAGCTGTTCTGTTATGG + Intergenic
1045881556 8:107046259-107046281 ATGTGATAGTAGTTCTGTTCAGG + Intergenic
1047031996 8:120891965-120891987 ATGTGTGTGTAGTTCTGTGAGGG + Intergenic
1052865585 9:33462977-33462999 GTGTGCACGTGGTTCTGTGTGGG - Intronic
1053371097 9:37562355-37562377 TTGTGTGAGTGGATCTGTGAGGG + Intronic
1055649744 9:78395662-78395684 ATGTGCTAGTGGATATGTTTGGG + Intergenic
1056902405 9:90612257-90612279 ATGTGCTTCTGGTTGTCTGATGG + Exonic
1060672991 9:125486746-125486768 ATGTGCAAGAGGCTCTGAGATGG - Intronic
1203370351 Un_KI270442v1:297900-297922 ATGGCCTAGTAGATCTGTGAGGG - Intergenic
1187239989 X:17503601-17503623 CAGTGCTAGTGGTTCTGAGCTGG - Intronic
1190183689 X:48217002-48217024 ATGTGCTAGCTATTCTGTTATGG + Intronic
1190438158 X:50448467-50448489 ATGAGTTAGTGTTTCTGTGTAGG - Intronic
1192745737 X:73936533-73936555 TTGTGCTAGGGGTTCTGTCCAGG + Intergenic
1193242018 X:79181581-79181603 AGGTGGTAGTGGTCTTGTGAAGG + Intergenic
1194155101 X:90378449-90378471 ATTTCCTAGTGTGTCTGTGAGGG - Intergenic
1194543800 X:95206532-95206554 CTGTGTTAGTGGGTCTATGAAGG - Intergenic
1195437808 X:104865333-104865355 GTGTGCTTCTGGTTGTGTGAAGG + Intronic
1195601263 X:106751514-106751536 AAGTCCTGGTGGTTCTGTGCTGG + Intronic
1196825870 X:119739769-119739791 ATGTGCTGGGGGTTTTGTGCAGG - Intergenic
1196898860 X:120363735-120363757 ATATGGTAGTGGGTGTGTGATGG - Intronic
1197449827 X:126598442-126598464 ATGTGTGAGTGATTCCGTGAAGG + Intergenic
1200501453 Y:3955385-3955407 ATTTCCTAGTGTGTCTGTGAGGG - Intergenic