ID: 1068286155

View in Genome Browser
Species Human (GRCh38)
Location 10:54938809-54938831
Sequence ACATCTCTCTAAGATCAGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068286155_1068286157 17 Left 1068286155 10:54938809-54938831 CCGCTCTGATCTTAGAGAGATGT 0: 1
1: 0
2: 0
3: 19
4: 163
Right 1068286157 10:54938849-54938871 ATAGAAAAACGTAAAGTTTCTGG No data
1068286155_1068286158 29 Left 1068286155 10:54938809-54938831 CCGCTCTGATCTTAGAGAGATGT 0: 1
1: 0
2: 0
3: 19
4: 163
Right 1068286158 10:54938861-54938883 AAAGTTTCTGGCTTTGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068286155 Original CRISPR ACATCTCTCTAAGATCAGAG CGG (reversed) Intronic
903337589 1:22635368-22635390 ACTTTGCTCTAAGATCAGAGTGG + Intergenic
907614728 1:55912632-55912654 ACTTCGCTCCAAGATCAGAGTGG - Intergenic
910178025 1:84452152-84452174 AAATCTCTCTCAGATCAGCCAGG - Intergenic
915758461 1:158286640-158286662 ACATATCAGTCAGATCAGAGAGG + Intergenic
915982038 1:160426307-160426329 ACATTTGTCTAAGACCACAGGGG - Exonic
916071317 1:161171725-161171747 ACATCCCTCTGAGAACAGTGAGG + Exonic
917680382 1:177360139-177360161 ACATATCTCTAAGAAGAAAGAGG + Intergenic
918612114 1:186504643-186504665 AAATTTCTCCAAGTTCAGAGTGG + Intergenic
919314030 1:195948498-195948520 ACCCCACTCTGAGATCAGAGCGG + Intergenic
919453919 1:197801156-197801178 ACCTTGCTCTGAGATCAGAGTGG - Intergenic
921706062 1:218323848-218323870 ACCTTGCTCTGAGATCAGAGCGG + Intronic
924239449 1:242027047-242027069 TCATCACTCTATGATCAGAGTGG + Intergenic
924765797 1:247031407-247031429 AATTCCCTCTAAGATCATAGGGG + Intergenic
1068093241 10:52458752-52458774 ACATCTTTCTAATCACAGAGAGG - Intergenic
1068286155 10:54938809-54938831 ACATCTCTCTAAGATCAGAGCGG - Intronic
1069249162 10:66246152-66246174 ACTTTCCTCCAAGATCAGAGTGG + Intronic
1070643459 10:78185406-78185428 ACATCTTTCTTGGCTCAGAGAGG - Intergenic
1072453146 10:95555181-95555203 GCATCTCTTTAAGATGTGAGGGG + Intronic
1073545866 10:104348222-104348244 ACCTCTGTCATAGATCAGAGAGG - Intergenic
1077012711 11:385955-385977 ACCCCACTCCAAGATCAGAGTGG - Intergenic
1077614205 11:3663442-3663464 ACATGGATTTAAGATCAGAGTGG - Intronic
1078184947 11:9044174-9044196 ACATCTCTCTAACATGATAGCGG - Intronic
1080773792 11:35366800-35366822 ACACCTCTCTTAAACCAGAGGGG - Intronic
1082750140 11:57006196-57006218 ACTTTGCTCTGAGATCAGAGTGG + Intergenic
1083088561 11:60176145-60176167 ACACCTCTCAAAGATGAGTGAGG + Intronic
1083103765 11:60337174-60337196 ACACCTCTCAAAGATGAGTGAGG - Intronic
1084719301 11:70894036-70894058 ACAACTCTTTACGAACAGAGAGG - Intronic
1085552264 11:77385440-77385462 GCATCTGTCTAAGATTACAGGGG + Intronic
1085802524 11:79603626-79603648 ACATCTCTTTATGTTCACAGTGG + Intergenic
1086268322 11:85028654-85028676 ACTTTGCTCTAAAATCAGAGTGG + Intronic
1087047137 11:93851507-93851529 ATATGTCGCTAGGATCAGAGAGG + Intergenic
1091064813 11:132499642-132499664 TCAATTGTCTAAGATCAGAGAGG - Intronic
1091849556 12:3684278-3684300 AAATCTCTCTAGGACGAGAGTGG + Intronic
1091865759 12:3834772-3834794 AGAGCCCTCTTAGATCAGAGAGG + Intronic
1092503336 12:9069294-9069316 ACATATCTATAAAATCAGATTGG + Intronic
1093493075 12:19726399-19726421 ACTTCGCTCCAAGATCAGAGTGG + Intergenic
1094179768 12:27579910-27579932 ACATCACTCACATATCAGAGAGG - Intronic
1095826024 12:46531137-46531159 ACCACTCTCCAAGATCTGAGAGG - Intergenic
1097234317 12:57529145-57529167 ACAGCTGCCTAATATCAGAGGGG - Exonic
1097394935 12:59061756-59061778 ACATGATTCTAAGATCACAGTGG - Intergenic
1098321207 12:69245510-69245532 ATATCCCTCTCAGATAAGAGGGG + Intronic
1098804844 12:75010459-75010481 ACATGTGTGTAAGATCAGAAGGG + Intergenic
1099296502 12:80834589-80834611 ACATCTTTCTAAGTTCAGCCAGG - Intronic
1099392190 12:82095474-82095496 ACTGCTCTCTCAGATCACAGTGG - Intergenic
1100071458 12:90724635-90724657 ACATCTCTCTGAGTTTAGAAAGG + Intergenic
1100847820 12:98678736-98678758 GCTTTGCTCTAAGATCAGAGTGG - Intronic
1104680926 12:130751090-130751112 ACATCTATCTCTGAGCAGAGGGG + Intergenic
1108002289 13:45915326-45915348 ACCTCGCTCCAAGATCAGAGTGG - Intergenic
1110163482 13:72408059-72408081 GCATTTCTCTCAGAGCAGAGGGG + Intergenic
1110638700 13:77796277-77796299 ACCTCTGTCAAAGATCAGATGGG - Intergenic
1111096024 13:83516907-83516929 ACACCTCTCGGAGAGCAGAGGGG - Intergenic
1111761128 13:92466418-92466440 AAATGTCTCTGAGATCAGACAGG - Intronic
1113016407 13:105833072-105833094 ACAGCTCTCAAAGATAAGGGTGG + Intergenic
1114349648 14:21835963-21835985 ACTTTGCTCTGAGATCAGAGTGG + Intergenic
1116222603 14:42108305-42108327 ACTACTCTCTCAGATCACAGTGG - Intergenic
1116516292 14:45810640-45810662 ACATCTTTCTAAGTTGAGACAGG + Intergenic
1116541633 14:46108273-46108295 ACTTTTCTCCCAGATCAGAGTGG + Intergenic
1116741298 14:48758445-48758467 AGTTCTCTCTCAGAGCAGAGTGG + Intergenic
1117202930 14:53411108-53411130 ACATCTCTCTAGGAACACACAGG - Intergenic
1128428816 15:67571668-67571690 ACATCTTTATAAGATCAGCAAGG + Intronic
1130028384 15:80289797-80289819 ACCTCTCACTGAGACCAGAGCGG + Intergenic
1131951635 15:97687870-97687892 ACATCACCCTAAGCTCAGTGGGG + Intergenic
1137692832 16:50441343-50441365 ACTTTGCTCTGAGATCAGAGTGG - Intergenic
1143214162 17:5211703-5211725 AAATCTCTCTAAGAAGAAAGGGG + Intronic
1146359087 17:32159595-32159617 ACCTCGCTCTGAGATCAGAACGG - Intronic
1150140585 17:62725221-62725243 TCATCTCACTAGGGTCAGAGGGG - Intronic
1151752158 17:76045562-76045584 ATATGTTTCCAAGATCAGAGGGG - Intronic
1156143023 18:34139685-34139707 ACAAATAACTAAGATCAGAGCGG - Intronic
1157091484 18:44642067-44642089 CCATGTCTCTGAGAACAGAGAGG + Intergenic
1157851004 18:51050679-51050701 ACACCTTTCTAAGATGACAGTGG - Intronic
1158966835 18:62629466-62629488 ACATCTTTATAAGCTTAGAGTGG - Intergenic
1159386337 18:67729832-67729854 ACATATCTTTAATATCAGGGTGG + Intergenic
1160270032 18:77375320-77375342 GCATCTCTCAATGATCAGAATGG + Intergenic
1163677965 19:18664883-18664905 ACCTCTCTCTAAAATCAGAAGGG - Intronic
1164109820 19:22145613-22145635 ACTTCTCTATAAGATCACAAGGG - Intergenic
1164287976 19:23839281-23839303 AGAACTCTCTCAGATCACAGTGG - Intergenic
1164858385 19:31543050-31543072 GCATTTCTCTAAGCTCAGAGGGG + Intergenic
1165474734 19:36024036-36024058 ACTTGTCTCTGAGAGCAGAGGGG + Intronic
1167235043 19:48309159-48309181 ACCCCTCTCTGAGATCAGAGTGG - Intronic
925711267 2:6743109-6743131 ACATCTCTGAAAAATCAGAGAGG - Intergenic
925939470 2:8802268-8802290 AGATCACTCCAAGATCAGAGTGG + Intronic
926646971 2:15300710-15300732 ACATCTCTCTCCGCTCAGTGTGG - Intronic
926822557 2:16868998-16869020 ACATTTCTCTAAAAGCAGATAGG - Intergenic
929410968 2:41697123-41697145 ACTTCACTCTAATTTCAGAGTGG + Intergenic
931805247 2:65797746-65797768 AAATCTCCCCGAGATCAGAGGGG - Intergenic
933507369 2:83195382-83195404 ACATCACTCTCACATCAGAAAGG + Intergenic
937976155 2:127583251-127583273 AAATCACTCTCAGATCAGACAGG - Intronic
939396601 2:141638482-141638504 ACATCTGTCTAGGAGCAGTGAGG + Intronic
939396651 2:141639087-141639109 ACATCTGTCTAGGAGCAGTGAGG + Intronic
940711263 2:157165583-157165605 ACATTGCTCTGAAATCAGAGTGG + Intergenic
942153509 2:173103324-173103346 ACACCTCTCTCAGATCAGTGAGG + Intronic
946722408 2:222623930-222623952 ACATCTGTGTAGGAGCAGAGGGG - Intronic
947327344 2:228992778-228992800 ACCTTGTTCTAAGATCAGAGTGG + Intronic
1168949616 20:1787694-1787716 CCATCACTCTAAGATCAGCCAGG - Intergenic
1169607617 20:7340201-7340223 ACAACCCTCTGGGATCAGAGAGG - Intergenic
1171570762 20:26249209-26249231 ACCTCTCTCTAAGATGAAAAAGG - Intergenic
1176364150 21:6022478-6022500 ACATCACTCAACTATCAGAGTGG + Intergenic
1177497325 21:21906561-21906583 ATTTCTCTCTAATAGCAGAGAGG - Intergenic
1178724286 21:35037327-35037349 ACATCTCTCTCAGTTCTGATGGG + Intronic
1179759368 21:43516067-43516089 ACATCACTCAACTATCAGAGTGG - Intergenic
1180572922 22:16746225-16746247 ACCTCTCTCTAAGATGAAAAAGG - Intergenic
1184869501 22:47226274-47226296 ACTTTGCTCCAAGATCAGAGTGG + Intergenic
949399629 3:3652256-3652278 ACATCTCTTTCACATCACAGGGG + Intergenic
950610371 3:14123141-14123163 AGATCTCTCTTAGTTCGGAGAGG - Intronic
951650433 3:24945793-24945815 ACTTCTCTCTAAAGTCAGTGAGG + Intergenic
954371242 3:50170573-50170595 GCCTCTCTCTGAGATCAGAACGG + Intronic
956941759 3:74170339-74170361 ACATGGCTCTAAGATGAAAGAGG - Intergenic
957104769 3:75872693-75872715 ACCTCTCTCTAAGATGAAAAAGG + Intergenic
958195183 3:90235149-90235171 CCATGCCTCTAAGATCAGAGTGG - Intergenic
958418599 3:93906554-93906576 CCATGCCTCTAAGATCAGAGTGG - Intronic
960182374 3:114595711-114595733 ACAGATCTCTAAGATAAGACTGG + Intronic
967078850 3:186030248-186030270 ACATCTCTCTAACCTCAGCCAGG + Intergenic
969482999 4:7456792-7456814 TCATCTCTCGACGATCAGTGTGG + Intronic
970358859 4:15286398-15286420 ACAAATCACTAATATCAGAGGGG + Intergenic
970533587 4:17006539-17006561 GCATTTCCCCAAGATCAGAGGGG - Intergenic
972128517 4:35801065-35801087 ACTTTGCTCTGAGATCAGAGTGG - Intergenic
978042073 4:104079268-104079290 TCATCTGTATAAGAACAGAGAGG + Intergenic
978149436 4:105415479-105415501 ACTTCACTCCAAAATCAGAGTGG + Intronic
979938026 4:126722258-126722280 AAAACTCTCTAAGATGAGGGAGG - Intergenic
980306359 4:131065452-131065474 ACCTTGCTCCAAGATCAGAGAGG + Intergenic
981400757 4:144311321-144311343 AGCTCTCTCTCAGATCACAGTGG - Intergenic
981749457 4:148079909-148079931 ACCTCTTTCCAAGATCAGAAGGG + Exonic
983961944 4:173765140-173765162 ATATTTCTCCAAGACCAGAGAGG - Intergenic
984255130 4:177381848-177381870 ACCGCACTCTAATATCAGAGTGG + Intergenic
984322794 4:178214125-178214147 TCATCTCGCAAAGATCAGAGAGG + Intergenic
988225291 5:28404805-28404827 ACCCCGCTCCAAGATCAGAGCGG - Intergenic
990016309 5:51066514-51066536 AGAAATCACTAAGATCAGAGTGG + Intergenic
993409608 5:87557261-87557283 ACATTTCTATATGATTAGAGAGG + Intergenic
999434676 5:151554123-151554145 CCTTCTCTCTAAGAATAGAGGGG + Intronic
1000094413 5:157958563-157958585 AAAAATCTGTAAGATCAGAGAGG - Intergenic
1000554683 5:162712079-162712101 ACAACTCTGTAAGATCCAAGTGG + Intergenic
1000860708 5:166452873-166452895 ACATCTCTCTAGGATGACAGTGG + Intergenic
1002960279 6:1907839-1907861 ACATCTCCCACAGATAAGAGGGG - Intronic
1006220444 6:32484755-32484777 ACTCCACTCTGAGATCAGAGTGG - Intergenic
1009713787 6:67360868-67360890 CCATCTCACTAAAATCAGAATGG + Intergenic
1011515803 6:88151320-88151342 CCATCTCTCTAAGCTAAGACAGG + Intronic
1018685298 6:166299382-166299404 ATATCTTTCTAAAATCACAGTGG + Intergenic
1019795926 7:3048715-3048737 ACTTCTCTCTGGGATCACAGAGG - Intergenic
1021000955 7:15329550-15329572 ACATTTCTCTTCTATCAGAGAGG + Intronic
1022127038 7:27368556-27368578 ACAACTTGCTCAGATCAGAGAGG - Intergenic
1022166393 7:27767497-27767519 ACATTTCTTTAAGATAAGAGAGG - Intronic
1022753786 7:33261826-33261848 ACATGTCTCTCAGAACAGAAAGG - Intronic
1023608972 7:41955412-41955434 ACATTTATCTAAGCTCAAAGGGG + Intergenic
1024024492 7:45399416-45399438 ACTTCGCTCCAAAATCAGAGCGG - Intergenic
1024425721 7:49224613-49224635 ACAGGCCTCTAAGATCTGAGGGG - Intergenic
1024465048 7:49703416-49703438 ACAACTATCTTAGATCAGAAGGG + Intergenic
1024695410 7:51851526-51851548 ACATCCCTGAGAGATCAGAGAGG + Intergenic
1027128314 7:75572957-75572979 ACTTTGCTCTAAGATCAGAGTGG - Intronic
1028821610 7:95217977-95217999 AGAAATCACTAAGATCAGAGTGG - Intronic
1028962943 7:96770077-96770099 TTATCTCTCTAAGAGGAGAGAGG - Intergenic
1032658395 7:133955861-133955883 ACTTTGCTCTGAGATCAGAGTGG + Intronic
1032728471 7:134614279-134614301 ACAGCTCTCCAAGATCTGGGTGG - Intergenic
1039265492 8:35819119-35819141 ACAAATAACTAAGATCAGAGAGG + Intergenic
1039490893 8:37946785-37946807 CCATCTCTCTAGGATCTGCGGGG - Intergenic
1041492410 8:58449084-58449106 ACATCTCTCTGACACCAGTGTGG + Exonic
1041812531 8:61927558-61927580 TCATCTCTCTAAAATAAAAGAGG - Intergenic
1042196878 8:66238466-66238488 ACTTTGCTCTAAGATCAGAATGG + Intergenic
1042856543 8:73273366-73273388 ACTTTGCTCTAAAATCAGAGTGG - Intergenic
1043391185 8:79793927-79793949 ATATCACTCACAGATCAGAGGGG + Intergenic
1043735084 8:83731246-83731268 ACCTGTCTCTTAGATCGGAGAGG + Intergenic
1046622079 8:116538616-116538638 CCATCTCACTAAAATCACAGAGG + Intergenic
1047159450 8:122361164-122361186 TCATCTCTCTCAGATCAGTTTGG + Intergenic
1048604985 8:135958526-135958548 GCATCTCACTAAGATCATTGAGG + Intergenic
1050419328 9:5446906-5446928 ATATCTCTCTCAGAGCAGAAAGG + Intergenic
1050483911 9:6114346-6114368 ACTTTGCTCTAAGATCAGAGTGG - Intergenic
1052025473 9:23569248-23569270 ACATGGCTCTAAAACCAGAGAGG + Intergenic
1053586197 9:39461781-39461803 CCATCTCTGTAAGAACTGAGAGG - Intergenic
1054580110 9:66903450-66903472 CCATCTCTGTAAGAACTGAGAGG + Exonic
1055068672 9:72145029-72145051 ACTTCTCTCCTAGATAAGAGAGG + Intronic
1057972682 9:99572625-99572647 AGATCACTCTAAGAGCAGTGTGG + Intergenic
1058284468 9:103158866-103158888 ACCTCACTCTCAGATCACAGTGG - Intergenic
1059831876 9:118105158-118105180 AAATTTCTCTGAGATCAGATCGG + Intergenic
1186976342 X:14910061-14910083 ACATATCACTAAGGACAGAGAGG - Intronic
1188899978 X:35719905-35719927 AAATTTCTCTGAGAGCAGAGTGG + Intergenic
1189023843 X:37370812-37370834 ACTTTGCTCTGAGATCAGAGTGG - Intronic
1190802045 X:53798423-53798445 AACTTTCTCTAAGATCAGTGGGG - Intergenic
1193364888 X:80620434-80620456 AGAAATATCTAAGATCAGAGTGG - Intergenic
1194520632 X:94914806-94914828 ATATCTCTCTAAGCTAAAAGTGG - Intergenic
1197378321 X:125709481-125709503 ACTTTGCTCCAAGATCAGAGTGG - Intergenic
1197535209 X:127678845-127678867 ACAACTCTCCAAGATCACAAGGG - Intergenic
1198434519 X:136603235-136603257 GCCTCTCTCTTTGATCAGAGAGG + Intergenic
1198542948 X:137659731-137659753 AGATCTATCTAAGATCATTGAGG + Intergenic
1198591199 X:138184539-138184561 TAATTTCTCTAAGTTCAGAGGGG + Intergenic