ID: 1068286402

View in Genome Browser
Species Human (GRCh38)
Location 10:54942275-54942297
Sequence AACCCACATCTCCCTCAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 193}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068286402_1068286404 -4 Left 1068286402 10:54942275-54942297 CCATTCTGAGGGAGATGTGGGTT 0: 1
1: 0
2: 0
3: 11
4: 193
Right 1068286404 10:54942294-54942316 GGTTGTGGTGCCAATGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068286402 Original CRISPR AACCCACATCTCCCTCAGAA TGG (reversed) Intronic
901762457 1:11479708-11479730 GACCCAGATATCCCTCAGAGGGG - Intronic
902416406 1:16242416-16242438 CACCCACCCCTCCCTCAGCATGG + Intergenic
904031162 1:27534095-27534117 AACCCAGATCTCAGGCAGAAGGG + Intronic
904816582 1:33206746-33206768 AACACACATCTCTCCCAAAATGG + Intergenic
905837852 1:41143944-41143966 AAACCAAATCTCCGTCAGCATGG - Intronic
906935151 1:50208272-50208294 AACCCACCTCTCCCTGCCAAAGG - Intergenic
907345368 1:53773810-53773832 CACCCACAACTCCCCCAGACTGG + Intronic
907458998 1:54594161-54594183 AATCCACAGCTCCCTGAGGAAGG + Intronic
908706396 1:66961065-66961087 TACCCACACCTTACTCAGAAAGG + Intronic
910785467 1:90993231-90993253 AACTCTCATCTGCTTCAGAATGG + Intronic
911221308 1:95250420-95250442 AACTCACCATTCCCTCAGAAAGG + Intergenic
914847970 1:151293271-151293293 ACACCACATCTCCCTCAGTAAGG + Intronic
915270498 1:154750177-154750199 CACACACTTTTCCCTCAGAAGGG + Intronic
915332594 1:155122533-155122555 TCCCCACATCCCACTCAGAAGGG - Intergenic
915400040 1:155615559-155615581 AACCCGCACCTACCTCAGCAGGG + Intergenic
915417246 1:155751754-155751776 AACCCGCACCTACCTCAGCAGGG + Exonic
916227040 1:162498356-162498378 AACCCGCTTCTCCCGCAGAAGGG - Intronic
917197968 1:172486414-172486436 ACCACACAACTGCCTCAGAAAGG + Intergenic
918316706 1:183328494-183328516 GATCACCATCTCCCTCAGAAAGG - Intronic
919946673 1:202324329-202324351 AACCCAAATGTCCATCAGAAGGG - Intergenic
920409528 1:205749171-205749193 AACCCGCACCTCCCTGAGTACGG + Intronic
920460062 1:206132575-206132597 AACACACATCACTCTCTGAAAGG + Intergenic
921376105 1:214475535-214475557 AATGCACATCTCCCAAAGAAGGG - Intronic
922375749 1:224962990-224963012 AACACATATCTCACTCAGACTGG - Intronic
922916657 1:229263546-229263568 AAGCCTCATCTCACTCACAATGG - Intergenic
924831602 1:247601462-247601484 AACCCACAGCTGGCTCTGAAGGG + Intergenic
1062946775 10:1467508-1467530 AAGCCACATCTGGCTCAGGATGG + Intronic
1065603310 10:27391737-27391759 ATCCCTCAACTCCCTCAGGAAGG - Intergenic
1066259894 10:33719422-33719444 AACCCACAGCTGCTTCAGGATGG - Intergenic
1068286402 10:54942275-54942297 AACCCACATCTCCCTCAGAATGG - Intronic
1073693222 10:105834858-105834880 ACCCCACAACTCCCACAGATGGG - Intergenic
1074816964 10:117149580-117149602 ACTCCACATCTTCCTCAGAAAGG - Intergenic
1075208846 10:120473578-120473600 AAACCATATCAGCCTCAGAAGGG - Intronic
1075867973 10:125743860-125743882 ATCCCACATCTTCCTCACACAGG - Intronic
1076003451 10:126930198-126930220 AACCCACAAGTCCATCACAAGGG - Intronic
1076451257 10:130558386-130558408 TACCCACATTTCCCTCCGAGAGG - Intergenic
1077670291 11:4151290-4151312 AACCCATCTGTCCCTCAGAGAGG + Intergenic
1078983291 11:16562715-16562737 CTCCCACTTCTCCCGCAGAATGG + Intronic
1080462265 11:32465571-32465593 AACCTACATGTCCATCAAAAGGG - Intergenic
1083365510 11:62139461-62139483 TGCTCACATCTCCCTGAGAAGGG + Intronic
1083571866 11:63765431-63765453 CACCCACACCTCCCCCAGACTGG + Intronic
1085879051 11:80444025-80444047 AAACCAAATCTGACTCAGAAAGG + Intergenic
1088334464 11:108688116-108688138 AACCCAAATGTCCATCAGTAGGG - Intronic
1088626313 11:111732992-111733014 GACCCACATCTGCCTCCTAAGGG - Intronic
1088803935 11:113333469-113333491 ACACCAAATCTCCTTCAGAAAGG - Intronic
1092079761 12:5706011-5706033 ATCCCGAATCTCCCCCAGAAGGG - Intronic
1092119690 12:6035160-6035182 AAGCCACATCTACCTGAGATTGG + Intronic
1092358170 12:7814258-7814280 AAGCCACCTCTCCCTCAACAAGG - Exonic
1092371622 12:7921355-7921377 AAGCCACCTCTCCCTCAACAAGG - Exonic
1092744686 12:11662213-11662235 ATCCCACATCTCTCCCAGCAGGG - Intronic
1094686058 12:32715989-32716011 AACTCACATATTCCTCAGATGGG + Intronic
1095128356 12:38508519-38508541 AACCCTCATCTCCCTGGGATAGG + Intergenic
1095988862 12:48019842-48019864 AACCCGAATGTCCATCAGAAGGG - Exonic
1101967199 12:109289968-109289990 AAACCACATCTCTCTAAGGAAGG + Intronic
1102058982 12:109918148-109918170 AATCCACATCTCCCACATACAGG + Intronic
1103022811 12:117549975-117549997 AACCCACATCTGTGTCTGAACGG + Intronic
1103682031 12:122701835-122701857 TTCCCACATCTGCCTCAGACTGG - Exonic
1103683779 12:122715296-122715318 TTCCCACATCTGCCTCAGACTGG - Exonic
1104055232 12:125225008-125225030 ATCCCACACCTCCACCAGAAAGG - Intronic
1105743354 13:23352172-23352194 AATCCACATCCACCTTAGAAAGG + Intronic
1105972615 13:25444294-25444316 AACCTACATATCCATCAGCAGGG - Intronic
1106466701 13:30020099-30020121 AACCCACATGCTCCTCAGAGTGG + Intergenic
1107138680 13:36974054-36974076 AACCTGCATCTCCATCCGAAGGG + Intronic
1107735093 13:43391065-43391087 TCCCCACAGCTCCCCCAGAACGG + Intronic
1108697135 13:52912467-52912489 AACCAACATCTCCCTCAACTGGG - Intergenic
1110646541 13:77892049-77892071 AACCCAGACCTGCCTCAGGAAGG - Intergenic
1111995717 13:95164461-95164483 AACCAACTTTTCCTTCAGAACGG + Exonic
1112228150 13:97561318-97561340 CACACACATCACCCTCACAAAGG - Intergenic
1114388836 14:22283857-22283879 AAGCCTCATTTCCCACAGAAAGG + Intergenic
1117958605 14:61141961-61141983 AGACAACATCTCCCCCAGAAAGG - Intergenic
1122258535 14:100498733-100498755 ACCCCACCTATCCCTCAGCAAGG - Intronic
1123403092 15:20005169-20005191 AACCCACATCTGGATCAGGACGG - Intergenic
1123512431 15:21011823-21011845 AACCCACATCTGGATCAGGACGG - Intergenic
1124431119 15:29609282-29609304 AACCCACATATCCATCAATAGGG - Intergenic
1126763578 15:51991857-51991879 AACCCAGATCTCAGTAAGAATGG - Intronic
1127388386 15:58485779-58485801 AGCCCACCTCTCCCTCAGTGTGG - Intronic
1128376393 15:67079329-67079351 AACTCCCATCTCTGTCAGAAAGG - Intronic
1130938489 15:88489403-88489425 ACTCCATATCCCCCTCAGAAAGG - Intergenic
1130996873 15:88908937-88908959 TCCCCACATCTCCCTGAGGAGGG + Intronic
1132949018 16:2549956-2549978 AACACACATCAGCCTCAGATGGG + Intronic
1132965570 16:2652171-2652193 AACACACATCAGCCTCAGATGGG - Intergenic
1134017719 16:10901050-10901072 AACCCACGTGTCCCTTAGCAAGG - Intronic
1134389125 16:13802669-13802691 AACCCAGATGTCCATCAGTAGGG + Intergenic
1134839137 16:17387398-17387420 ACCCCCCACCTCCCTCAGCAGGG + Intronic
1135468347 16:22706729-22706751 AACCCACCTCTACCTCCCAAAGG - Intergenic
1135573864 16:23569992-23570014 AACCTACATATCCATCAGTAAGG - Intronic
1141409819 16:83825413-83825435 AACCCACAGCTCCAACAGCAGGG + Intergenic
1143733842 17:8896768-8896790 TACCCACATCACCCTCAGCATGG - Intronic
1147463343 17:40590051-40590073 AACCCACAGGTCACTCGGAATGG - Intergenic
1148177438 17:45579458-45579480 CACCTACACCTCCCTAAGAATGG - Intergenic
1152266465 17:79297635-79297657 GACCCCCATCTCCCTGGGAAAGG - Intronic
1203192955 17_KI270729v1_random:206375-206397 AACCCAGGTCTCCCAAAGAATGG - Intergenic
1203202319 17_KI270730v1_random:5810-5832 AACCCAGGTCTCCCAAAGAATGG - Intergenic
1153797210 18:8634728-8634750 TACCCACACCTCCCTGATAAGGG + Intronic
1156766932 18:40667852-40667874 AACACAAATCTCCCTCTCAAAGG - Intergenic
1159739593 18:72149973-72149995 AACCCAAATGTCCATCAGTAGGG - Intergenic
1160314602 18:77830187-77830209 TACCCACACCTCACTCAAAATGG + Intergenic
1160825354 19:1077753-1077775 CACCCCCATCTCTCTCAGCAAGG - Intronic
1161021408 19:2013367-2013389 AACCCACTTCTTTCCCAGAAAGG + Intronic
1161059950 19:2209863-2209885 GACCCACATCCCCCTAAGCATGG - Intronic
1162979649 19:14230389-14230411 AACCCAAACCCCCTTCAGAAGGG + Intergenic
1167427496 19:49436973-49436995 ATCCTCCATCTCCCTCAGACCGG + Intronic
926572395 2:14543996-14544018 AACCCCCAGTTACCTCAGAATGG + Intergenic
931185705 2:59948996-59949018 ACCCCACATCTCACTCATAAGGG - Intergenic
931507010 2:62939823-62939845 AAACCATATCTTCCTCAAAATGG - Intronic
933647590 2:84825133-84825155 AACTCACATCTGCCTGAGGAAGG + Intronic
933941166 2:87246196-87246218 CACCCACAGCTCTTTCAGAATGG - Intergenic
935363174 2:102264961-102264983 AACCCACACCTCTCTCTGTATGG + Intergenic
936351974 2:111719816-111719838 CACCCACAGCTCTTTCAGAATGG + Intergenic
939120546 2:138110975-138110997 AACCCACTCTTCCCTCACAATGG - Intergenic
941362513 2:164569728-164569750 AAACCAAAAATCCCTCAGAATGG + Intronic
943661992 2:190568924-190568946 AATCCGTATCTCCCACAGAAGGG + Intergenic
945464175 2:210147545-210147567 ATTCCACTTCTCCCACAGAAAGG + Intronic
1172813981 20:37671980-37672002 AAAGCACAGCTCCCTCAGATTGG + Intergenic
1173422323 20:42913298-42913320 CTCCCTCTTCTCCCTCAGAAGGG - Intronic
1173653395 20:44682268-44682290 GACACACATCTGCCTGAGAATGG + Intergenic
1174034994 20:47663363-47663385 GACCCAGACCTCTCTCAGAAAGG - Intronic
1174729059 20:52896651-52896673 AACCTACATGTCCATCAGCAAGG + Intergenic
1175293542 20:57894001-57894023 AACCCCCTTCAGCCTCAGAATGG - Intergenic
1178581387 21:33841467-33841489 AGACCACATCACCCTCAGAGAGG + Intronic
1178860562 21:36285638-36285660 TGCCCACATCTGCCTCAGAGAGG + Intronic
1179388213 21:40961903-40961925 AACCCACAGGCCCCTCAGGAAGG - Intergenic
1179415665 21:41196450-41196472 AACCCACGTGTGCCTCAAAAGGG + Intronic
1180079839 21:45481616-45481638 AGCCCAAATTCCCCTCAGAATGG - Intronic
1181390443 22:22576629-22576651 TCCCCACTTCTCCCTTAGAAGGG - Intergenic
1181787690 22:25238817-25238839 AACCTACATGTCCATGAGAAGGG + Intergenic
1181819425 22:25463852-25463874 AACCTACATGTCCATGAGAAGGG + Intergenic
1183486963 22:38093434-38093456 AACCCACAGCTCCCTCCTGAGGG + Intronic
1183950712 22:41351201-41351223 GACCCCCATCTCCCTCAACAGGG - Intronic
950569438 3:13790925-13790947 AGCACACAGCTCCTTCAGAAGGG - Intergenic
952243038 3:31553369-31553391 AACCCAAATGCCCTTCAGAAGGG + Intronic
952271076 3:31831968-31831990 AACCCAAATGTCCGTCAGCATGG + Intronic
952863823 3:37837699-37837721 AACCTAAATTTCCCTCAAAAGGG - Intergenic
953249576 3:41232196-41232218 ACCCCAGATGTCCATCAGAATGG - Intronic
954100388 3:48367901-48367923 AACTCCCATCTCCCTCTGATGGG + Intergenic
959219888 3:103504369-103504391 GACCCAAATGTCCCTCAGAAAGG + Intergenic
959308338 3:104697175-104697197 AGCTCACATCTCCCTGAGACTGG + Intergenic
959823670 3:110767575-110767597 AAGCCACATCTCCCTCTCTAAGG + Intergenic
963406584 3:144871373-144871395 AACCCACATCTAACAGAGAATGG - Intergenic
964138148 3:153368488-153368510 AGCAAACATCTCCCTGAGAATGG + Intergenic
967333834 3:188320486-188320508 AAACCACATCTCCAATAGAAAGG + Intronic
968770192 4:2500494-2500516 GACCAACACCTCCCTCAGGAGGG - Intronic
970692588 4:18636632-18636654 AACACAGATCTCCCTGGGAATGG - Intergenic
970999304 4:22304160-22304182 TTCCCACAGCTCCCTCAGTAGGG - Intergenic
971153806 4:24061544-24061566 AACTCACTTCTCCCTCAAAGAGG + Intergenic
972132617 4:35857412-35857434 AACACAGAGCACCCTCAGAAAGG - Intergenic
973757207 4:54087078-54087100 ACCCCACATCTTCCTGAGAGAGG - Intronic
976440312 4:85065752-85065774 AACCCACATTTACCTGATAAAGG - Intergenic
977256049 4:94741165-94741187 ATTCCACATCTCACTCAGATTGG + Intergenic
978000551 4:103552652-103552674 AATACACATCTACCTCACAAAGG - Intergenic
978454611 4:108874599-108874621 AAACCACATTTCCCTGATAATGG - Intronic
979968233 4:127103134-127103156 AACCCTAATCTACCTCACAAAGG + Intergenic
981915932 4:150033293-150033315 CACACCCATCTCCCTCTGAAAGG + Intergenic
982464395 4:155712416-155712438 AACCCAAATATCCTTCAGTAGGG - Intronic
984484979 4:180356418-180356440 AAGACACATCAGCCTCAGAAGGG + Intergenic
988536266 5:32072003-32072025 AACCTCCATGTACCTCAGAACGG - Intronic
989386026 5:40855432-40855454 AATCCCCATGTCCCTCAGGAGGG + Intronic
991642686 5:68770482-68770504 TCTCCCCATCTCCCTCAGAAAGG + Intergenic
992805525 5:80333319-80333341 AACCCAAATGTCCATCAGCAGGG - Intergenic
997494868 5:134314547-134314569 AACCCACATGTCCATCAACAGGG + Intronic
1000402136 5:160841014-160841036 ATGCCAAATCTCCCTCAGTAAGG - Intronic
1002774714 6:318798-318820 AACCCACATATTCAGCAGAAGGG + Intronic
1003037805 6:2660245-2660267 AACACACAAGTCCCTGAGAATGG - Intergenic
1005783747 6:29220534-29220556 TACCCACATCTTCCTCAAAGAGG - Intergenic
1007746299 6:44045637-44045659 AACACACTTATCCCTCAGAGGGG + Intergenic
1007925826 6:45648912-45648934 ATCTCACTTTTCCCTCAGAATGG + Intronic
1008002988 6:46380183-46380205 AAAACACACCCCCCTCAGAAAGG + Intronic
1008551536 6:52637272-52637294 AACCCAAATGTCCATCAGCAGGG + Intergenic
1013162134 6:107554985-107555007 ATCACAGATTTCCCTCAGAAGGG - Intronic
1017260602 6:152381695-152381717 AACCCATATTTCCCTCAAAGTGG + Intronic
1019188823 6:170238292-170238314 ACTCCACAGCTTCCTCAGAAAGG + Intergenic
1020596537 7:10213683-10213705 ACCCCACATGTCCATCAGGATGG + Intergenic
1022799201 7:33759646-33759668 GGCCCTCATCTCCCCCAGAATGG + Intergenic
1024196398 7:47063737-47063759 ATCCCATATCTCCATCTGAAGGG + Intergenic
1024209914 7:47194377-47194399 AACCCCCCACTACCTCAGAATGG + Intergenic
1027800883 7:82747521-82747543 GACCCACATGTCACTCAGGATGG + Intergenic
1029113719 7:98226097-98226119 CACCCACATCTGTCTCAGAGAGG - Intronic
1029536524 7:101160685-101160707 AGCCCACAGCTCACTCCGAAAGG - Exonic
1030887595 7:114957603-114957625 CATCCACATCTCCCTCTCAAAGG - Intronic
1031634973 7:124091539-124091561 AACAAACTTCTCTCTCAGAAAGG + Intergenic
1032162223 7:129519687-129519709 AAACCACATCTCTCCCAGCAAGG - Intergenic
1035357400 7:158284701-158284723 TACCCACACCTCCCGCAGGAAGG + Intronic
1037435374 8:18857186-18857208 GGCCCACATCCCCCTGAGAACGG + Intronic
1045111954 8:98944810-98944832 AACACTCACCTCCCGCAGAAAGG - Exonic
1046864963 8:119137612-119137634 AACCCAGATATCTATCAGAAGGG - Intergenic
1048630358 8:136235557-136235579 AACCCAAATCTTCCTCAAAATGG - Intergenic
1051988012 9:23114018-23114040 AACCCACATGACACACAGAAAGG + Intergenic
1052324188 9:27199276-27199298 AACCTACATCTCCCTCTAAAAGG - Intronic
1054887942 9:70219484-70219506 AACCCAGATCTTCCTGGGAAGGG + Intronic
1054904924 9:70406392-70406414 AATCCCCATCTCTCTGAGAAAGG + Intronic
1055260955 9:74433011-74433033 AACCCACGTCTCCCTCACTAGGG - Intergenic
1057913945 9:99041376-99041398 CAGCCACATCTGCCTCAAAAAGG - Intronic
1057992631 9:99786609-99786631 ACCCCAAATATCCCTCAAAAGGG + Intergenic
1059194149 9:112354980-112355002 CACCCACATCTCCCAAAGACAGG - Intergenic
1059744860 9:117190028-117190050 AACTCACATCTCCCAGAGGAAGG - Intronic
1061452390 9:130675349-130675371 CAGCCCCATCTCCCCCAGAAGGG - Intronic
1062001044 9:134215814-134215836 AACCCAGATGTCCCTCAGCTGGG + Intergenic
1186714428 X:12235220-12235242 CAGCCACATCTCCCCCAGAAGGG - Intronic
1187802992 X:23085830-23085852 AAGTCACATCTACTTCAGAATGG - Intergenic
1190642247 X:52492144-52492166 AATCCACATATTCTTCAGAAGGG - Intergenic
1190645426 X:52520723-52520745 AATCCACATATTCTTCAGAAGGG + Intronic
1193998671 X:88399866-88399888 CACCCATATCTCACTCAGGAAGG + Intergenic
1194960656 X:100231693-100231715 AACCCAAATGTCCCTCAATAGGG + Intergenic
1195769707 X:108337425-108337447 AACCCATCACTCCATCAGAAAGG + Intronic
1196485123 X:116197507-116197529 AAACCAGATCTCCTTGAGAAAGG + Intergenic