ID: 1068288764

View in Genome Browser
Species Human (GRCh38)
Location 10:54973947-54973969
Sequence GTGCCTTTATTTACTAAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068288763_1068288764 2 Left 1068288763 10:54973922-54973944 CCAAATGTAGATAAGTATACTAC 0: 1
1: 0
2: 0
3: 9
4: 117
Right 1068288764 10:54973947-54973969 GTGCCTTTATTTACTAAATCAGG No data
1068288762_1068288764 3 Left 1068288762 10:54973921-54973943 CCCAAATGTAGATAAGTATACTA 0: 1
1: 0
2: 1
3: 18
4: 226
Right 1068288764 10:54973947-54973969 GTGCCTTTATTTACTAAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068288764 Original CRISPR GTGCCTTTATTTACTAAATC AGG Intronic
No off target data available for this crispr