ID: 1068294107

View in Genome Browser
Species Human (GRCh38)
Location 10:55045012-55045034
Sequence ATGTGTTTACAGAATGAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 319}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068294107_1068294108 11 Left 1068294107 10:55045012-55045034 CCATACTCATTCTGTAAACACAT 0: 1
1: 0
2: 2
3: 15
4: 319
Right 1068294108 10:55045046-55045068 CATTTTTACAAAATCTCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068294107 Original CRISPR ATGTGTTTACAGAATGAGTA TGG (reversed) Intronic
902867868 1:19292391-19292413 ATGTGTTTGGAAAATGAGTAAGG + Intergenic
907057383 1:51382875-51382897 CTGGCTTCACAGAATGAGTATGG - Intronic
907155821 1:52332849-52332871 GTGTGTGTACAGAATGATGATGG + Exonic
907654070 1:56324426-56324448 ATGTGGTAACAGAACAAGTAAGG - Intergenic
908335222 1:63115861-63115883 AGGTGTATAAAGAATGATTAAGG - Intergenic
909125640 1:71665427-71665449 ACATGTTTATAGAATGAATATGG - Intronic
909285039 1:73805528-73805550 ATGAAATTACAGAATGAGCATGG + Intergenic
909645262 1:77909840-77909862 TTGTCTTTATAGAATGAGTTGGG - Intronic
911241032 1:95466950-95466972 CTGTCTTTGCAGAATGAGTTTGG + Intergenic
912001420 1:104839855-104839877 ATCTGTATACAGAAAGAGAAAGG + Intergenic
913462965 1:119108189-119108211 CTGGGTTCACAGAATGAGTTTGG + Intronic
916856051 1:168751268-168751290 CTATGTTTACTGAATGAGGAGGG - Intergenic
916919252 1:169445636-169445658 ATGTCCTTATAGAATGAGTCAGG + Intronic
917639353 1:176968105-176968127 ATGGGGTTACAGAATGATGAAGG - Intronic
917673274 1:177294586-177294608 CTGTCTTTATAGAATGAGTTAGG + Intergenic
917909195 1:179623941-179623963 ATGTATTTATAGAATGAGTTGGG - Intronic
918691356 1:187484053-187484075 ATTTGTTTCCAGGATGAATATGG - Intergenic
918772247 1:188576227-188576249 ATGTTTTTAGAAAGTGAGTAGGG - Intergenic
918819902 1:189239685-189239707 ATGTGTGTACAGATTGAGGTAGG + Intergenic
921437146 1:215136837-215136859 ACGTGTTTACAAAAAGATTATGG - Intronic
921538928 1:216388212-216388234 ATGTGTCTTCAGATTGAGAAGGG + Intronic
921726745 1:218532883-218532905 ATGTGTGTTAAGATTGAGTAAGG + Intergenic
923996352 1:239499380-239499402 ATGTGCTTACTGAATTAATAAGG - Intronic
924012411 1:239680059-239680081 ATGTTTTTACACAAAGAGAAGGG - Intronic
1063192825 10:3713810-3713832 ATGTGTCTTCAGATTGAATAAGG + Intergenic
1063631902 10:7741867-7741889 CTGAGTGTACAGAATGAGGAAGG - Intronic
1063865640 10:10362641-10362663 ATGTGCTTAAAGAATAAATAGGG + Intergenic
1064470480 10:15630192-15630214 ATGTTTGTGCAGAATGAGAATGG - Intronic
1064497580 10:15929651-15929673 ATGTGTTGACAGAATTGGGAAGG - Intergenic
1065241625 10:23711073-23711095 ATGTGCATACAGAAGGAGTGAGG + Intronic
1066545338 10:36493874-36493896 ATGTCTTTACTGATTGATTAAGG + Intergenic
1068294107 10:55045012-55045034 ATGTGTTTACAGAATGAGTATGG - Intronic
1069167802 10:65185658-65185680 GTGTGATCATAGAATGAGTAGGG + Intergenic
1069190935 10:65488809-65488831 ATGGCTTTATAGAATGAGTTAGG - Intergenic
1070960130 10:80492997-80493019 CTTGGTTTACAGAATGAGAATGG + Intronic
1072015616 10:91343550-91343572 ATTTGTTTACTGAATGACTCTGG - Intergenic
1072912092 10:99511480-99511502 ATTTGTTTACAAAATTTGTATGG - Intergenic
1075528274 10:123203952-123203974 AAATATTGACAGAATGAGTAAGG + Intergenic
1076001041 10:126913301-126913323 ATGTTTTTGTAGCATGAGTAGGG + Intronic
1076278048 10:129222124-129222146 ATGTGTATACAGGATGTGTGTGG - Intergenic
1077858362 11:6152011-6152033 ATGTGCTCACAGTATGAGTGGGG + Intergenic
1078330874 11:10418991-10419013 ATATGTTTACAGGATTAGAAAGG - Intronic
1079237238 11:18699335-18699357 ACTTGTTTACAAAATGAGGAAGG - Intronic
1080070820 11:28084525-28084547 ATGTTTCTACATAATGAGTTAGG - Intronic
1081021513 11:37954245-37954267 ATGTGTTTATAAAATGAATATGG + Intergenic
1081049483 11:38319827-38319849 CTGGCTTTACAGAATGAGTTTGG - Intergenic
1081292672 11:41345970-41345992 ATGTTTTTCCAGAATTTGTAGGG + Intronic
1081547079 11:44079163-44079185 ATGTGATAACAGCATCAGTAGGG - Intronic
1082677495 11:56124800-56124822 CTGTGTTTCCAGAATATGTAAGG - Intergenic
1082932896 11:58627536-58627558 TTGTTTTTACAAAATGAGTTAGG - Intergenic
1084337532 11:68469173-68469195 ATTTGTTTACAGATTGGCTATGG - Intronic
1086432957 11:86753563-86753585 CTGTGTTTACAGAATCAATGAGG - Intergenic
1087263682 11:96039092-96039114 ATGTTTTTAAAGAATTAGTCAGG + Intronic
1087924570 11:103904366-103904388 ATGGGTCTACAGAAAGAGTAGGG - Intergenic
1088981253 11:114866200-114866222 TTGTGCTTACAAAATGTGTATGG - Intergenic
1089474629 11:118748893-118748915 ATTTGTTTTCAGAATGAGATGGG - Exonic
1091097512 11:132838021-132838043 ATTTGTTTACAGATTGCATACGG + Intronic
1093064352 12:14640992-14641014 ATGTGGTTACAGACAGATTAGGG + Intronic
1093371740 12:18374620-18374642 AAGTGTTTACAGAGTGTGCATGG - Intronic
1094045732 12:26164526-26164548 ATTTGTTTAGAGAAAGAGTCTGG - Intronic
1094087514 12:26609704-26609726 ATGTGGTTAGAAAATGAGAAGGG + Intronic
1094336401 12:29360767-29360789 ATTAGTTTACAGAAAGAGAAGGG + Intronic
1094444994 12:30519778-30519800 ATCTGTTTACACAACCAGTAAGG + Intergenic
1095512778 12:42971436-42971458 ATGTGTTTAAAGAAATAATAAGG + Intergenic
1095815697 12:46420200-46420222 ATGAGTTTATAGAATAAGTTAGG - Intergenic
1096399418 12:51292810-51292832 ATTTGTTTACAGTTTGAGAACGG - Intronic
1097354343 12:58584826-58584848 ATGTGTTTCCAGAAGGATTTAGG + Intronic
1097629818 12:62046694-62046716 ATGTGTTTGCTGATTTAGTAAGG - Intronic
1099813578 12:87617781-87617803 CTTTGTTTAGAGATTGAGTATGG - Intergenic
1099994214 12:89759487-89759509 ATTTGCTTACAAAATGATTAAGG + Intergenic
1100649222 12:96566539-96566561 ACGTGGATACAGATTGAGTAGGG + Intronic
1102653744 12:114462657-114462679 CTGAGGTTACAGAATGAGAACGG - Intergenic
1102738497 12:115185104-115185126 ATGTGTTTCCATAGTGAATAAGG + Intergenic
1103870454 12:124087440-124087462 ATGTGTTTACATACTGCCTATGG - Intronic
1104121697 12:125806076-125806098 AAATATTTACAGAATGAGTGAGG - Intergenic
1104448159 12:128849355-128849377 ATTTGTTGTCAGAATGATTAAGG - Intergenic
1105240680 13:18607121-18607143 CTGTCTTCATAGAATGAGTATGG - Intergenic
1107251421 13:38367956-38367978 ATTTGTTTACAGCAAGAGGATGG - Intergenic
1107296954 13:38919537-38919559 CTGTCTTTATAGAATGAGTTAGG + Intergenic
1108345742 13:49545424-49545446 CTGTGTTTAGACAGTGAGTAAGG - Intronic
1110877133 13:80523788-80523810 TTGGCTTTGCAGAATGAGTAAGG + Intergenic
1112071165 13:95852026-95852048 ATGTGTTTACAGACTAAATAGGG - Intronic
1112811773 13:103226409-103226431 ATTTGTTTACAGAACGAATATGG - Intergenic
1114886297 14:26855962-26855984 ATTTGGTTACAAAGTGAGTATGG + Intergenic
1115415677 14:33130556-33130578 ATGTGATTACAAAATTAGAATGG - Intronic
1117824922 14:59691569-59691591 GTGTCTTTATAGAATGAGTTAGG - Intronic
1118623588 14:67636295-67636317 ATATGATTACATGATGAGTAAGG - Intronic
1118701466 14:68438005-68438027 ATGTGTCTGTACAATGAGTAGGG + Intronic
1119119530 14:72061427-72061449 ATGTGTTTGCATAATGAAGAAGG + Intronic
1120243514 14:81978241-81978263 ATGTGTTTATTGCATGATTATGG + Intergenic
1122619275 14:103045244-103045266 ATGTTTTTAGAGAATGATGAGGG + Intronic
1122670880 14:103371188-103371210 ATGTTTTTAAAGAATGAGCCAGG + Intergenic
1123480161 15:20623878-20623900 ATGTGTTCACAGAATGATTATGG + Intergenic
1123637843 15:22376485-22376507 ATGTGTTCACAGAATGATTATGG - Intergenic
1124814228 15:32972627-32972649 ATGAGTCTACAGATTGACTAGGG - Intronic
1126279633 15:46929827-46929849 CTGACTTTACAGAATGAGTTAGG + Intergenic
1130350536 15:83087799-83087821 ATGTGTTCACATAATCAGTCTGG - Intergenic
1131008272 15:88996265-88996287 ATATATTTACAGAATGTGCAGGG + Intergenic
1131663041 15:94539050-94539072 ATGTGTTTACATACTGTGAAAGG + Intergenic
1135350047 16:21721203-21721225 ATGTGTTTTCAGAATGGGCGTGG - Intronic
1138733551 16:59223857-59223879 ATTTGTTTACAGAATTACTTTGG + Intergenic
1138916728 16:61473289-61473311 CTGACTTCACAGAATGAGTACGG - Intergenic
1138984361 16:62309579-62309601 ATGAGTTCACATAATGATTAAGG + Intergenic
1140060944 16:71569166-71569188 GTTTGTTTTCAGAATGACTAGGG - Intronic
1141814115 16:86397793-86397815 ATGTGTCTACAGATTGGGTGGGG + Intergenic
1143001699 17:3798786-3798808 ATGTGACTGCAGAATGAGTCAGG + Intronic
1143741058 17:8954400-8954422 CTGTGTTTTCAGAGGGAGTAAGG - Intronic
1144900485 17:18584209-18584231 ATGTGTTTCAACAATGAGTTTGG + Intergenic
1145054585 17:19692671-19692693 TTGGCTTTACAGAATGAGTTTGG - Intronic
1145403315 17:22563856-22563878 AGGGGTTTAAAGAAAGAGTAGGG - Intergenic
1146665301 17:34698374-34698396 ATGTATTTATAGAATGACTTTGG + Intergenic
1148393974 17:47294110-47294132 AAGTGTTATCAGAATGATTAGGG + Intronic
1148749292 17:49935465-49935487 GTGTGTTTACAGGCTGAGGAGGG + Intergenic
1149079518 17:52637320-52637342 ATTTTTTTAAAGAATGAATAAGG + Intergenic
1153067897 18:1067476-1067498 CTGGTTTTACAGAATGAGTTGGG + Intergenic
1154448200 18:14451968-14451990 CTGTCTTCATAGAATGAGTATGG + Intergenic
1156544669 18:37952204-37952226 ATTTGTTTACATATTGTGTATGG - Intergenic
1159824797 18:73194306-73194328 ATGTGCTTCCAGAATGTGTTGGG + Intronic
1161803432 19:6428652-6428674 ATATATTTACATAATAAGTAAGG + Intronic
1162624168 19:11870682-11870704 TAGTCTTTACAGAATAAGTAAGG - Intronic
1163929184 19:20372308-20372330 AAGTACTTACAGAATGAGGAAGG + Intergenic
1165366343 19:35369087-35369109 CTGTTTTTGTAGAATGAGTAGGG - Intergenic
1166070676 19:40385596-40385618 ATGCTTTCACAGAATGATTAGGG - Intronic
1166808801 19:45503004-45503026 ATGTGTTGAGAAAATGACTAGGG + Intergenic
925121858 2:1424793-1424815 ATGACTTTACAGAAGGAGCACGG - Intronic
925121887 2:1425183-1425205 ATGACTTTACAGAAGGAGCATGG - Intronic
925121909 2:1425494-1425516 ATGACTTTACAGAAGGAGTACGG - Intronic
925121938 2:1425962-1425984 ATGACTTTACAGAAGGAGCATGG - Intronic
925121974 2:1426508-1426530 ATGACTTTACAGAAGGAGCATGG - Intronic
925121979 2:1426586-1426608 ATGACTTTACAGAAGGAGCATGG - Intronic
925121983 2:1426664-1426686 CTGTCTTTACAGAAGGAGCATGG - Intronic
925624101 2:5825175-5825197 ATTTGTTTTCAGAATGCCTAAGG + Intergenic
927630774 2:24772169-24772191 ATGTGTTGAATGAGTGAGTAAGG - Intergenic
928561452 2:32491209-32491231 AGGTGTTTTCAGAATCAGAAGGG + Intronic
928810740 2:35221800-35221822 ATGTGTTTTTAAAATGAGAAAGG - Intergenic
929084275 2:38152800-38152822 ACTTGTTTACAGTATGAGAATGG - Intergenic
929727772 2:44448602-44448624 CTTTTTTTACAGAATTAGTAAGG - Intronic
931195518 2:60048900-60048922 ATGTGGGCAGAGAATGAGTATGG - Intergenic
931585351 2:63820547-63820569 ATGTGTTTAAAGAATGAGATAGG - Intronic
932804606 2:74772518-74772540 ATTTGTTGACTGAATGAATAGGG + Intergenic
934141103 2:89048542-89048564 ATGTGTTTAGATCATGAGTGTGG + Intergenic
934228133 2:90152000-90152022 ATGTGTTTAGATCATGAGTGTGG - Intergenic
934670667 2:96210251-96210273 ATGTGGCTACAGAATCAGTCCGG - Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936749269 2:115621510-115621532 AAGTGTTTACAGAAAGTGAAAGG - Intronic
937017475 2:118619071-118619093 ATGTGTTGAAAGGATGAATAGGG + Intergenic
938003396 2:127766291-127766313 ATGTGCTTATAGAAACAGTAAGG + Intronic
939939955 2:148337282-148337304 ATGTTTTTACATAAAGAATATGG + Intronic
940137908 2:150460025-150460047 ATGTGATTTCAGAATGGGAAAGG - Intergenic
941189172 2:162355245-162355267 ATGTGTTCTTAGCATGAGTAAGG - Intronic
941253960 2:163204350-163204372 ATATCTTTAAAGAATGAGTAAGG + Intergenic
941449523 2:165643110-165643132 ATGTGTTAAATGAATGAGTGGGG - Intronic
941980707 2:171453461-171453483 ATGAAATTACAAAATGAGTAAGG + Intronic
943196182 2:184753240-184753262 ATGTATTTACAAAATGAGGCTGG + Intronic
943739528 2:191396301-191396323 ATTGGTTTCCAGAAGGAGTATGG + Intronic
944199720 2:197093073-197093095 ATGTATTTAAAGAATGAGGGAGG - Intronic
944509949 2:200454704-200454726 ATGTGTTTTTAGAAGGAGAAAGG + Intronic
944721304 2:202425479-202425501 ATCTGTTTACACATTGAGTTGGG + Intronic
944886492 2:204067849-204067871 ATTTGGTTACAACATGAGTAAGG - Intergenic
945229731 2:207573579-207573601 ATGTCTTTAGAAAATTAGTAGGG + Intronic
945696268 2:213109028-213109050 ATGTGCTTTAAGAATGATTATGG - Intronic
946008537 2:216545959-216545981 ATGTGTTTATAGATTGCTTACGG + Intronic
946296604 2:218788775-218788797 ATGTGTTAACAGAATGGGAGTGG - Intronic
947459640 2:230292657-230292679 AAGTGTATACAGACTGAGGATGG + Exonic
947469943 2:230392098-230392120 AAGTGTATACAGACTGAGGATGG + Exonic
948294702 2:236851940-236851962 AGGTGATTAGAGAATGAGGAGGG + Intergenic
1169347195 20:4838172-4838194 ATGTGGTGATAGATTGAGTATGG + Intergenic
1170054743 20:12189260-12189282 CTGGATTTACAGAATGAGTCAGG - Intergenic
1172436074 20:34929761-34929783 ATGTGTTCACTGCATGAGTAAGG - Intronic
1173322854 20:42004870-42004892 ATGTATTTATAGAATCATTAAGG - Intergenic
1173633598 20:44535207-44535229 ATGGGATGACAGGATGAGTAAGG + Intronic
1173719406 20:45241061-45241083 ATGTGTTCAGAGAATGAATCAGG - Intergenic
1174896900 20:54459039-54459061 AGGTCTCTACAGAATGAGGAGGG + Intergenic
1177322990 21:19546093-19546115 CTGGGTTTACAGAAAGATTAAGG + Intergenic
1177647761 21:23921505-23921527 ATGAGTTTACAGATTGACTGGGG - Intergenic
1179302688 21:40126593-40126615 ATGTGATTAGAGAATGATTAGGG + Intronic
1183989900 22:41590683-41590705 ATGTGTGGACAGAAGGAATAAGG - Intergenic
1185165607 22:49260537-49260559 ATGTGTTGGCACCATGAGTATGG - Intergenic
949322055 3:2822357-2822379 ATGTGTTGATAGAATCAATAGGG - Intronic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
952198464 3:31100675-31100697 ATTTGTTTACATAATGTCTATGG - Intergenic
953475332 3:43201190-43201212 AAGTTTTTAAAGAATGAGGAAGG - Intergenic
956020026 3:64924298-64924320 AGGTGTTTACAGGAGGAGTGAGG + Intergenic
956058090 3:65321906-65321928 ATTTGTTTAAAGAATGCATATGG - Intergenic
957563296 3:81853943-81853965 ATATATGCACAGAATGAGTAAGG + Intergenic
958193683 3:90215267-90215289 ATATGTTTAATGACTGAGTATGG + Intergenic
958418354 3:93903744-93903766 ATTTGTTTACAAAATGCATATGG + Intronic
958562187 3:95760313-95760335 CTGACTTTACAGAATGAGTTAGG - Intergenic
959094695 3:101941238-101941260 AAGTGTTCAGAGCATGAGTAAGG - Intergenic
961190068 3:124952658-124952680 ATGTGTTCACAGGGGGAGTAGGG + Intronic
963254410 3:143130551-143130573 ATGTCTTTACAGAATGTCTGGGG + Intergenic
963944831 3:151134523-151134545 AGGTATTTGCAGTATGAGTAGGG + Intronic
966644500 3:182228944-182228966 ATGTGCTTGAAAAATGAGTAAGG + Intergenic
966707110 3:182928231-182928253 CTGTCTTCACAGAATGAGTTTGG - Intergenic
967395395 3:189002871-189002893 ATGTGCTTAAAAAATAAGTAAGG - Intronic
967734109 3:192934035-192934057 AGATATTTACAGAAGGAGTATGG + Intergenic
970152207 4:13101587-13101609 ATGAGTTCACAGGATGAGCAGGG + Intergenic
970347626 4:15168923-15168945 AGGTCTTAAAAGAATGAGTAAGG + Intergenic
970397797 4:15687789-15687811 ATATTTTTACAGAATTAGAAAGG + Exonic
971277263 4:25210144-25210166 TTGAGTTTACAGAAAGAATAGGG + Intronic
971837929 4:31793259-31793281 ATGTGTATACATTATGAGTGGGG - Intergenic
971906320 4:32731316-32731338 TAGTGTTTACAGAATGAATGTGG - Intergenic
972092367 4:35303283-35303305 ATGTTTTTGCAGAATAAATATGG - Intergenic
972662022 4:41125581-41125603 ATCTGTTTTCAAAATGGGTAGGG - Intronic
973720094 4:53714715-53714737 ATGTGTTGGGGGAATGAGTAGGG + Intronic
973980281 4:56303039-56303061 ATGTGTATAAAGAAGGAGTCTGG + Intronic
974178828 4:58359452-58359474 ATGTATTAGCAGAATGAGAAAGG + Intergenic
974886281 4:67821748-67821770 ATGTTCTTACAGAATAATTAAGG + Exonic
975061066 4:70000851-70000873 GTGTGTATACAGTATGGGTATGG + Exonic
976661788 4:87547359-87547381 ATGTGTTATTACAATGAGTAAGG - Intergenic
977597898 4:98903765-98903787 ATGTTTACACAGAATGATTAAGG + Intronic
978376047 4:108076750-108076772 ATCTGTTTAAAGAATGATAATGG + Intronic
978543170 4:109840999-109841021 ATTTGTTTCCAGATTGAGTTTGG - Intronic
979913784 4:126404801-126404823 ATTTCTGTACAGAAGGAGTAGGG - Intergenic
981477788 4:145205770-145205792 CTTTATTTACACAATGAGTATGG - Intergenic
981666910 4:147238835-147238857 ATGAGTTCTCATAATGAGTAAGG - Intergenic
982132256 4:152240239-152240261 ATTTGTTCCCAGAATGAGTCGGG - Intergenic
983315542 4:166128218-166128240 ATGTGTTTTTAAAATGAGTTTGG + Intergenic
983872859 4:172842271-172842293 ATGTGTTTAGAGAGTGGCTAAGG - Intronic
983918110 4:173314201-173314223 ATGTGTTTGTAGACTGAGTTTGG + Intronic
984683796 4:182642961-182642983 ACGTGTTGACAGAATGTGTTGGG - Intronic
985980729 5:3460987-3461009 CTGTGTTTTCAGAATGAAAAGGG + Intergenic
988273714 5:29053090-29053112 CAGAGTTTACAGAATAAGTATGG - Intergenic
988721141 5:33880468-33880490 GTGTGTTTACAGATTGTCTATGG - Intronic
988918946 5:35923018-35923040 GTGGGTTTAGAGAATGAGAAGGG - Intronic
989504491 5:42211322-42211344 ATGTCTTTGTAGAATGAGTTTGG + Intergenic
989951640 5:50306598-50306620 ATGTGTTCATAAAATGAGTTAGG - Intergenic
990283928 5:54280665-54280687 ATGTGTGTACAAAATGCTTAAGG - Intronic
990374785 5:55158654-55158676 ATGTGTTTCCAGAAAGTGCAGGG - Intronic
990532174 5:56684978-56685000 ATGTGTTTAGAGATTCTGTAAGG + Intergenic
990849607 5:60187923-60187945 ATGTGTTTTCAAAATGAATGAGG + Intronic
991258389 5:64640352-64640374 GTGTTTTTAAAGAATGAATATGG + Intergenic
991973118 5:72160040-72160062 ATGTGTTTTCAAACTGAGCAAGG + Intronic
992400469 5:76406623-76406645 ATGTGTTTTCAGAATTAATTTGG - Intronic
993087469 5:83381084-83381106 ATGTGTTTATAAAATATGTATGG - Intergenic
994127641 5:96186854-96186876 CTGGCTTTACAGAATGAGTTAGG + Intergenic
994945816 5:106389560-106389582 ATTTGTTTACATATTGATTATGG + Intergenic
995274734 5:110265278-110265300 ATTACTTTACAGAATGGGTATGG - Intergenic
995900191 5:117056542-117056564 ATGTCTTTATAGAATGAAGAAGG - Intergenic
999344843 5:150807939-150807961 TTGTTTTTAATGAATGAGTAAGG - Intergenic
1000222043 5:159223634-159223656 GTGTGTTTACAGAAGGCGAAAGG - Intergenic
1000868907 5:166550551-166550573 AAATGTTTGTAGAATGAGTAAGG - Intergenic
1003858218 6:10297158-10297180 ATGAGATGACAGAATGAGGAGGG - Intergenic
1004018713 6:11756644-11756666 ATGTGTTTATACAAAGATTATGG + Intronic
1004201375 6:13551230-13551252 ATGTGTTTACATATTGTGTTGGG + Intergenic
1005792933 6:29326013-29326035 ATTTGTTTTCAGAATGAGGCGGG - Intergenic
1007036133 6:38675514-38675536 ATGAATTTAAAGAATGAGCAAGG + Intergenic
1008727023 6:54434060-54434082 ATATGTTTCCAAAATGAATAGGG - Intergenic
1010278830 6:74000575-74000597 ATGTGTTAACATCATGAGTTTGG - Intergenic
1011033996 6:82953723-82953745 ATGTGTTGACTGAATGAATGGGG - Intronic
1011138178 6:84122201-84122223 CTGTATTTATAGAATGAGTTTGG - Intergenic
1011208305 6:84925768-84925790 ATGTGTTCATAGAAGGAGAAAGG + Intergenic
1011421141 6:87174782-87174804 ATGTGTATATAGTATGAATAGGG + Intronic
1012007748 6:93735651-93735673 ATGAGTATATAGAATGAGTAGGG - Intergenic
1012483550 6:99694580-99694602 ATGTCATTACATAATGAGAAAGG + Intergenic
1013276580 6:108591073-108591095 ATCTGTTTGAAGCATGAGTAAGG + Intronic
1013765992 6:113574924-113574946 ATGTGGTTGCAGAAAGAGAAAGG - Intergenic
1013977649 6:116095354-116095376 AAGTATTTACAGAATCAGGAAGG + Intergenic
1016527144 6:145014609-145014631 ATCTGTTGACAGAGTAAGTATGG + Intergenic
1018191525 6:161313553-161313575 AAGTGCTTACAGAATCAGGAAGG - Intergenic
1018484401 6:164226573-164226595 ATATTTGTGCAGAATGAGTAAGG + Intergenic
1018621791 6:165735738-165735760 ATATTTAAACAGAATGAGTACGG - Intronic
1018896018 6:168017822-168017844 CTTTGTTTACAGACTGTGTATGG - Intronic
1018990874 6:168672772-168672794 ATGTGTTTTCAGATGGAGTGAGG + Intronic
1021083674 7:16393558-16393580 TGGAGTTTACAGATTGAGTAGGG - Intronic
1021459036 7:20864857-20864879 GTGTGTTCACAGAAAGAGTGAGG - Intergenic
1022898043 7:34772830-34772852 CTGTTTTTACACAATGAGAAAGG - Intronic
1023183933 7:37513972-37513994 ATGAGTTAGAAGAATGAGTAAGG - Intergenic
1024445761 7:49476622-49476644 CTGGTTTCACAGAATGAGTAAGG + Intergenic
1024801035 7:53078751-53078773 CTGTTTTTACAGATTGAATAGGG - Intergenic
1026976047 7:74499113-74499135 AGGTGTTGAGTGAATGAGTAGGG + Intronic
1027299620 7:76817456-76817478 ATGAAAATACAGAATGAGTAAGG + Intergenic
1028773320 7:94652282-94652304 AGGTGTTTACAGAATATGGAAGG + Intronic
1030274538 7:107706196-107706218 ATTTGTTTACAAAATAAGTTTGG + Intronic
1030604791 7:111628705-111628727 CTGGTTTTACAGAATGAGTTAGG + Intergenic
1030799727 7:113834990-113835012 AAATGTATACAGAAAGAGTAAGG - Intergenic
1030853628 7:114522674-114522696 ATGTAGTTACAGAATTATTAAGG + Intronic
1030977392 7:116143752-116143774 ATATGTTTGCAGAAGGAGTAGGG - Intronic
1033636705 7:143218623-143218645 TTGTGTTCACAGAAGGAGTTTGG - Intergenic
1034300688 7:150012849-150012871 ATGTGTTTGCAGGATGAGGCTGG + Intergenic
1035116528 7:156529228-156529250 ATGTGAATATAGACTGAGTATGG + Intergenic
1036467020 8:9008083-9008105 CTGTATTAATAGAATGAGTAAGG + Exonic
1039104584 8:33976459-33976481 ATGTGTGGTCAGAATGAGTTAGG + Intergenic
1039120415 8:34140000-34140022 GTGTGGGTATAGAATGAGTATGG + Intergenic
1040350685 8:46563993-46564015 CTTTGTTTACAGAATGACTTTGG + Intergenic
1041740998 8:61156305-61156327 CTGAGGTTACAGAATGAATAGGG - Intronic
1042841100 8:73124669-73124691 AGGTGCTTAATGAATGAGTAGGG - Intergenic
1043287195 8:78547548-78547570 ATGGTTTTACAGAATGATTTTGG - Intronic
1043809956 8:84727053-84727075 GTGTGTTTAGAGAATGAAGAGGG + Intronic
1044879001 8:96702772-96702794 ACTTGTTTACAGAAGGAGAAAGG - Intronic
1045593459 8:103626343-103626365 ATGTGTATAAAAAATGAATAGGG + Intronic
1045993452 8:108336831-108336853 ATGTATTTTCAGGATGATTATGG - Intronic
1047425397 8:124740824-124740846 ATCTGTTTGCAGGATGAGCAGGG + Intergenic
1048663084 8:136629598-136629620 ATGTGGTTTCAGAATTGGTATGG + Intergenic
1048742807 8:137580699-137580721 GTGTGTTTAGAGAAAGATTACGG - Intergenic
1051054797 9:12972205-12972227 ATTTGTTTACAGAAAGACTGAGG + Intergenic
1051310904 9:15770703-15770725 AGCTGTTTAATGAATGAGTAAGG + Intronic
1051455270 9:17248241-17248263 CTGTCCTTACAGAATGAGTTAGG + Intronic
1052041683 9:23746440-23746462 GAGCGTTTTCAGAATGAGTAAGG + Intronic
1052900688 9:33792242-33792264 ATCTGTTTGCAGAATGATAAAGG + Intronic
1053148582 9:35728580-35728602 ATGTGTGTATAGAGAGAGTAAGG - Intronic
1053449762 9:38183306-38183328 ATGAGTTTACAGCAGGAATAAGG - Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055042462 9:71889910-71889932 ATTTTTTTAAAAAATGAGTATGG - Intronic
1055891155 9:81125294-81125316 ATCTGTTTAGTGAATGAATATGG + Intergenic
1056400434 9:86222525-86222547 TTGTGGTTTCTGAATGAGTATGG - Intronic
1058822734 9:108747594-108747616 ATGTGGTTTCAGAATAATTATGG + Intergenic
1058895128 9:109393745-109393767 ATGTGTTTGCAGTTTGAATAGGG + Intronic
1060552187 9:124490925-124490947 CTTTGTTCACTGAATGAGTAAGG + Intronic
1203466112 Un_GL000220v1:89029-89051 CTGTCTTTACATAATGATTAAGG + Intergenic
1185769699 X:2756375-2756397 TAGTGTTTACATAATCAGTAGGG + Intronic
1186388721 X:9136733-9136755 AAGTCTTTGCAGAACGAGTAGGG - Intronic
1187544836 X:20239444-20239466 ATGTAGCTAGAGAATGAGTATGG + Intronic
1188039554 X:25356272-25356294 ATGTCTTTAAAGAATGGCTAGGG + Intergenic
1189079481 X:37955448-37955470 CTGTGTTTGCAAAATGAGTGAGG + Intronic
1189244543 X:39553353-39553375 ATTTGTTTACATATTGAATAGGG + Intergenic
1191016540 X:55814844-55814866 ATATGAATACAGAATGAGAATGG - Intergenic
1191603642 X:63038758-63038780 CTGTTTTTATAGAATGAGTTAGG + Intergenic
1191729906 X:64322409-64322431 CTGTTTTTATAGAATGAGTTTGG + Intronic
1192725114 X:73741777-73741799 ATGTGTTTAGAGAACCAGCATGG - Intergenic
1193337574 X:80308101-80308123 ATGCATTTAAAGACTGAGTAAGG + Intergenic
1193623264 X:83783390-83783412 TTTTTTTTACAGAATTAGTATGG - Intergenic
1195464009 X:105159604-105159626 ATGTGTTTCCAGAATGTGTTTGG - Intronic
1195505797 X:105655346-105655368 ATATGTATACAGAATGAGATGGG - Intronic
1196150250 X:112365722-112365744 ATGGGATTACAGAAAGAGCACGG - Intergenic
1196292523 X:113960146-113960168 ATGTGTTTACAAAGTGAGCAAGG + Intergenic
1197010460 X:121555776-121555798 ATGAGTTTACAGTAGGTGTATGG - Intergenic
1198828582 X:140724780-140724802 CTGTGTGTATGGAATGAGTATGG - Intergenic
1199572512 X:149281374-149281396 ATTTGTTTACATGTTGAGTATGG + Intergenic
1200711594 Y:6489614-6489636 ATGTACTTACAGAATCAGGAAGG + Intergenic
1201022339 Y:9672365-9672387 ATGTACTTACAGAATCAGGAAGG - Intergenic
1201300818 Y:12503255-12503277 TAGTGTTTACATAATCAGTAGGG - Intergenic
1201492488 Y:14557418-14557440 CTGAGTTTACAGAAAGAGTGGGG + Intronic