ID: 1068295436

View in Genome Browser
Species Human (GRCh38)
Location 10:55065406-55065428
Sequence CAACAGGACCTTTCTAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 268}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068295436_1068295440 -5 Left 1068295436 10:55065406-55065428 CCCTCCTTAGAAAGGTCCTGTTG 0: 1
1: 0
2: 0
3: 13
4: 268
Right 1068295440 10:55065424-55065446 TGTTGTATGACTCTACAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068295436 Original CRISPR CAACAGGACCTTTCTAAGGA GGG (reversed) Intronic
900777829 1:4598037-4598059 CAACAGGGCCTTTCGGAGGGTGG + Intergenic
905278320 1:36833393-36833415 CACCAGGACCTCTCTGAGGTGGG - Intronic
907237993 1:53064357-53064379 CAGCAGGAGCTTTCTAGGGATGG + Intronic
907279678 1:53339241-53339263 CATTAGGACCTTTCTGAGAAAGG - Intergenic
907769339 1:57444240-57444262 TAAAGGGACCTTGCTAAGGATGG - Intronic
909590853 1:77347421-77347443 CAACAGGACTTTTCTGAGAACGG - Intronic
914712038 1:150223361-150223383 AAAAAGGACCTTTATAAGAATGG - Intronic
915818550 1:158996347-158996369 CAAATGGCCCTTTGTAAGGAAGG - Intergenic
917382051 1:174422139-174422161 ACACAGGATCTTTCTAAGTACGG - Intronic
917390444 1:174530429-174530451 CAACAGCACTGCTCTAAGGAGGG - Intronic
918370825 1:183859832-183859854 TAACAAGACCTTTCCAAGGTAGG + Intronic
919252676 1:195078425-195078447 CAAAAGGAGGTTTCTAAGGAAGG - Intergenic
919760594 1:201095722-201095744 CAACAGGCCCTTTCACAGAATGG - Intronic
920316514 1:205079384-205079406 CAACATGACATTGCTGAGGAGGG - Intergenic
1062817593 10:512114-512136 CAACACGACATTGCTTAGGAAGG - Intronic
1065293770 10:24255905-24255927 CTACAGGATGTTTCTAAGTATGG + Intronic
1065686317 10:28288863-28288885 CATAAGGCCCTTTCTCAGGATGG - Intronic
1068295436 10:55065406-55065428 CAACAGGACCTTTCTAAGGAGGG - Intronic
1068484403 10:57638816-57638838 CCAAAGGACCTGTCTAAGGCTGG - Intergenic
1070564160 10:77590826-77590848 CAGCTGGACCTTTTTCAGGAGGG - Intronic
1075418642 10:122284573-122284595 CAAGAGGACTTTTCTGAGGCAGG + Intronic
1075922363 10:126224255-126224277 CTGCAGGACCTGTCTAAGAATGG - Intronic
1076620850 10:131786375-131786397 CAAGAGGAGCTTTCTCAAGAAGG + Intergenic
1077051166 11:567755-567777 CAACAGGACCATCCTCCGGAGGG - Intergenic
1079483633 11:20910555-20910577 TCACAGGACCTTTCTAAGCACGG - Intronic
1079990103 11:27237692-27237714 CACCAGAATCTTTCTCAGGAGGG - Intergenic
1081489283 11:43554871-43554893 CAAGAGAACCTATCTGAGGAGGG + Intergenic
1088758881 11:112910558-112910580 CACCAGCACCTTTCTATGGAAGG - Intergenic
1089123901 11:116162657-116162679 CAACAGGTCCTTTATTTGGAAGG + Intergenic
1089500885 11:118930537-118930559 GAACAGCACCTTCCTAGGGAAGG + Intronic
1090595006 11:128311387-128311409 TAATAGGACCTTTATAAGGGAGG - Intergenic
1093460035 12:19399640-19399662 CTACAGGATCTTCCTAAGGTAGG - Intergenic
1093727469 12:22531621-22531643 CAAATGGATCTCTCTAAGGAAGG - Intronic
1095196727 12:39328074-39328096 CAAGCAGGCCTTTCTAAGGACGG - Intronic
1097722686 12:63040740-63040762 CCACAGGGCCTTTCTGAGCATGG + Intergenic
1099994592 12:89764553-89764575 CACCAGGGCCTTTCAGAGGATGG + Intergenic
1104132110 12:125904239-125904261 CAACAGGACGTGTATATGGAGGG - Intergenic
1104242353 12:127002316-127002338 CAACATGCCCTTTCTAAGGTGGG + Intergenic
1106356091 13:28984759-28984781 TAACATGACATTCCTAAGGAAGG + Intronic
1108133029 13:47323722-47323744 AAGCAGGAACTGTCTAAGGAAGG - Intergenic
1112323895 13:98430701-98430723 CAACAGGAGCTCCTTAAGGAGGG - Intronic
1120628648 14:86860914-86860936 TAACAGGACCAATCCAAGGAAGG + Intergenic
1121824346 14:96998428-96998450 CCACAAGACCTTTCCAAGGAAGG - Intergenic
1124227702 15:27908972-27908994 CAAGTAGACCTTTCTAAGCATGG + Intronic
1124616385 15:31245319-31245341 AGAAAGGACCTTTCTTAGGAGGG + Intergenic
1130983202 15:88827073-88827095 CAGCAGGCCCTTCCTAAAGATGG + Intronic
1131106299 15:89737090-89737112 CAAAGGGGACTTTCTAAGGATGG + Intronic
1132216610 15:100067413-100067435 CACCATGACATTTCTAAGCACGG + Intronic
1134864609 16:17593558-17593580 GAACAGGACCTCACTAAGCAAGG - Intergenic
1135352559 16:21741336-21741358 CAAAGGGACCTTTTTAAAGATGG - Intronic
1135451047 16:22557458-22557480 CAAAGGGACCTTTTTAAAGATGG - Intergenic
1135856353 16:26014500-26014522 CACCAGGACCTATGTGAGGATGG - Intronic
1137229151 16:46546254-46546276 TAATAAGGCCTTTCTAAGGATGG - Intergenic
1137682369 16:50360831-50360853 CCAAAAGACCTTTCCAAGGAAGG - Intronic
1138408648 16:56820225-56820247 GAACAGTACCTTGCAAAGGAAGG + Intronic
1140274738 16:73498554-73498576 CAACAGCATCTTTTTAAAGAAGG + Intergenic
1142799401 17:2336209-2336231 CGAAAGGCCCTTTCTAAGGTGGG - Intronic
1145119024 17:20239507-20239529 CAACATGACCTTCCATAGGAAGG + Intronic
1145418984 17:22751874-22751896 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145419665 17:22761389-22761411 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145419989 17:22815965-22815987 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145420161 17:22818345-22818367 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145420758 17:22826676-22826698 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145421100 17:22831433-22831455 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145421274 17:22833813-22833835 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145421625 17:22838571-22838593 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145421802 17:22840950-22840972 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145421969 17:22843330-22843352 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145422145 17:22845708-22845730 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145422323 17:22848087-22848109 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145422497 17:22850466-22850488 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145422673 17:22852845-22852867 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145422845 17:22855224-22855246 CAACCTGAGCTTTCAAAGGAAGG - Intergenic
1145423020 17:22857602-22857624 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145423192 17:22859981-22860003 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145423882 17:22869497-22869519 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145424052 17:22871876-22871898 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145424221 17:22874255-22874277 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145424395 17:22876634-22876656 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145424573 17:22879013-22879035 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145424751 17:22881392-22881414 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145425091 17:22886150-22886172 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145425257 17:22888529-22888551 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145425433 17:22890908-22890930 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145425608 17:22893287-22893309 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145425778 17:22895665-22895687 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145425953 17:22898043-22898065 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145426123 17:22900422-22900444 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145426299 17:22902802-22902824 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145426639 17:22907558-22907580 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145426806 17:22909938-22909960 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145427145 17:22914699-22914721 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145427314 17:22917078-22917100 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145427487 17:22919457-22919479 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145427661 17:22921837-22921859 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145427833 17:22924215-22924237 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145428005 17:22926594-22926616 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145428177 17:22928973-22928995 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145428350 17:22931352-22931374 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145428526 17:22933732-22933754 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145428697 17:22936111-22936133 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145428869 17:22938491-22938513 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145429043 17:22940871-22940893 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145429215 17:22943250-22943272 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145429391 17:22945629-22945651 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145429558 17:22948008-22948030 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145429732 17:22950386-22950408 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145430079 17:22955143-22955165 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145430252 17:22957522-22957544 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145430426 17:22959902-22959924 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145430603 17:22962281-22962303 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145430778 17:22964661-22964683 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145430949 17:22967043-22967065 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145431126 17:22969422-22969444 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145431476 17:22974182-22974204 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145431818 17:22978941-22978963 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145431994 17:22981320-22981342 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145432168 17:22983700-22983722 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145432339 17:22986079-22986101 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145432510 17:22988461-22988483 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145432861 17:22993225-22993247 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145433031 17:22995604-22995626 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145433205 17:22997983-22998005 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145433457 17:23001540-23001562 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145434158 17:23011058-23011080 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145434335 17:23013438-23013460 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145434508 17:23015817-23015839 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145434681 17:23018197-23018219 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145435023 17:23022955-23022977 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145435360 17:23027714-23027736 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145435705 17:23032473-23032495 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145435870 17:23034852-23034874 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145436040 17:23037231-23037253 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145436389 17:23041991-23042013 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145436565 17:23044370-23044392 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145436729 17:23046750-23046772 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145436901 17:23049130-23049152 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145437073 17:23051509-23051531 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145437247 17:23053890-23053912 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145437420 17:23056269-23056291 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145437771 17:23061027-23061049 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145437940 17:23063404-23063426 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145438111 17:23065783-23065805 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145438621 17:23072921-23072943 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145438963 17:23077685-23077707 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145439302 17:23082443-23082465 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145439469 17:23084822-23084844 CAACATGAACTTTTAAAGGAAGG - Intergenic
1145439643 17:23087201-23087223 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145439896 17:23090772-23090794 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145440066 17:23093151-23093173 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145440240 17:23095528-23095550 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145440406 17:23097907-23097929 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145440585 17:23100288-23100310 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145441098 17:23107426-23107448 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145441273 17:23109805-23109827 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145441450 17:23112187-23112209 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145441623 17:23114566-23114588 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145441794 17:23116946-23116968 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145441968 17:23119325-23119347 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145442321 17:23124085-23124107 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145442496 17:23126465-23126487 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145442666 17:23128846-23128868 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145442839 17:23131229-23131251 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145443008 17:23133608-23133630 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145443255 17:23137181-23137203 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145443772 17:23144318-23144340 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145443945 17:23146699-23146721 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145444296 17:23151460-23151482 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145444472 17:23153839-23153861 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145444645 17:23156218-23156240 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145444997 17:23160977-23160999 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145445173 17:23163358-23163380 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145445346 17:23165737-23165759 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145445520 17:23168116-23168138 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145445694 17:23170496-23170518 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145445868 17:23172877-23172899 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145446037 17:23175256-23175278 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145446208 17:23177635-23177657 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145446387 17:23180014-23180036 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145446556 17:23182393-23182415 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145446726 17:23184769-23184791 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145446895 17:23187149-23187171 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145447238 17:23191907-23191929 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1145447407 17:23194288-23194310 CAACCTGAACTTTCAAAGGAAGG - Intergenic
1146567477 17:33925584-33925606 CAACCCAACCTTTCTAAGGTAGG - Intronic
1147454246 17:40526273-40526295 CAAAAGCCACTTTCTAAGGATGG + Intergenic
1156519929 18:37713628-37713650 CACCAGCACCATTGTAAGGAAGG - Intergenic
1160043957 18:75369848-75369870 CAACAAGACCTTTCTATCAAAGG - Intergenic
1164656622 19:29926576-29926598 AAACAGAACATTTCTAAGGCTGG - Intronic
1166743173 19:45126361-45126383 CAACAGCACCTTCCCAGGGAGGG - Intronic
1167224484 19:48228501-48228523 AAACAGAGCCATTCTAAGGAAGG + Intronic
1167782882 19:51611855-51611877 CAGCAGGACCTTTCTATTCAAGG + Intergenic
925834921 2:7935188-7935210 CACCAGGACCTAATTAAGGATGG - Intergenic
926369669 2:12167390-12167412 CATCAGGAGCATTCTTAGGAAGG - Intergenic
931417312 2:62093241-62093263 CAATAGGACCTTTTAAAGTATGG - Intronic
932149478 2:69356545-69356567 CAAAAGCACCTTCCTAGGGAGGG + Exonic
934944768 2:98532075-98532097 CCACAGGTCCTTTCAAAGGATGG + Intronic
935891622 2:107685229-107685251 CAAAAGGACTCTTGTAAGGATGG - Intergenic
936650147 2:114416787-114416809 CAACATGACTATTCTAAGGGAGG - Intergenic
937886736 2:126904793-126904815 TAACCGGACCTTTCTCAGGGCGG - Intergenic
938528244 2:132157308-132157330 AAACAGGACCATTCTGATGAAGG - Exonic
941609165 2:167639262-167639284 CAACATGACATTTCTTAGGCTGG - Intergenic
946164814 2:217857545-217857567 CCACGGGTCCTTCCTAAGGAGGG - Intronic
947071486 2:226292429-226292451 CCACATGAGCTTTGTAAGGATGG + Intergenic
947749047 2:232523456-232523478 GAACAGGACCTCTCTAGGGCGGG - Exonic
1169112848 20:3044661-3044683 CATCAGTTCCCTTCTAAGGAAGG + Exonic
1169239120 20:3959973-3959995 AAACAGGATCTTTCTTAGCAAGG + Intronic
1172478965 20:35259837-35259859 CAACAGGACCCTGCTAATGAAGG + Intronic
1173453739 20:43188234-43188256 CTACAGCACCATTCTAAAGATGG - Intronic
1176515930 21:7783396-7783418 CAACAGAATTTTTCCAAGGACGG - Intergenic
1178649958 21:34413408-34413430 CAACAGAATTTTTCCAAGGACGG - Intergenic
1180179299 21:46110955-46110977 AAACAGGACTTTGATAAGGAGGG - Intronic
1183015749 22:34985022-34985044 CAATAGGACATTTCTAAATAAGG - Intergenic
1184992243 22:48178658-48178680 CAGCAGGACCTTCCTATGGAGGG - Intergenic
949937345 3:9126209-9126231 GAACAGGACCATTGTGAGGAGGG - Intronic
952483628 3:33787546-33787568 CAGCACGACCTTTCGCAGGATGG - Intergenic
955927211 3:64019279-64019301 CAAAAGGTACTTTCTAAGGGTGG - Exonic
956878891 3:73490709-73490731 AAAAATGACCTTTCTAATGAAGG + Intronic
957516196 3:81255109-81255131 CAACAGGACAGTTTAAAGGATGG + Intergenic
960641557 3:119829099-119829121 AAACAGGGCATATCTAAGGAAGG - Intronic
960767573 3:121152954-121152976 GAAAAGGAATTTTCTAAGGAAGG - Intronic
964753807 3:160076715-160076737 AAACAGTACCTGTCAAAGGATGG - Intergenic
964885979 3:161482954-161482976 CAACAGGACCTTTTTCAGCCTGG - Intergenic
967541230 3:190669989-190670011 AAACAGGACCATTATAAGGGAGG + Intergenic
969326215 4:6445778-6445800 CAAGAGGTGCTTTCTAAGCAGGG + Intronic
971733993 4:30422289-30422311 TACCAGGACCTATTTAAGGATGG + Intergenic
980038805 4:127915428-127915450 AATGAGGAACTTTCTAAGGATGG - Intergenic
983003235 4:162446900-162446922 TCATAGGACCTTTCTGAGGATGG - Intergenic
986930455 5:12813157-12813179 CAACATAACCTTTAAAAGGATGG + Intergenic
991434254 5:66580249-66580271 CAAAATGAACATTCTAAGGAGGG + Intergenic
991550329 5:67828479-67828501 CAACAGAATATTTCTAAGGCTGG - Intergenic
991706720 5:69365539-69365561 CAACAGTAGCTTTCTTAGCATGG + Exonic
993936998 5:94016858-94016880 CAAAAGGACTTGTCTAAGTAGGG + Intronic
997900219 5:137756443-137756465 CATCAGGTCTTTTTTAAGGATGG + Intergenic
998919984 5:147057306-147057328 AAACAGCACCTTACTTAGGATGG - Intronic
999138684 5:149342107-149342129 GAACAGGGCCCTTCTAAGCATGG - Intergenic
999508723 5:152225480-152225502 AAAGAGGCCCTTTCCAAGGATGG + Intergenic
1000381007 5:160629256-160629278 CCACAGGAGCTCTCTAGGGACGG + Intronic
1001014144 5:168125577-168125599 GAACAGAACCTTTCTCAGGAAGG - Intronic
1001171696 5:169425383-169425405 GAACAGAACCTTTCCCAGGAAGG - Intergenic
1001861879 5:175062952-175062974 CAACAAGACCTTTAACAGGAGGG - Intergenic
1003484034 6:6560051-6560073 CAAGAGACCCTTTGTAAGGACGG - Intergenic
1004349913 6:14882094-14882116 GAACAGACCCTTTCCAAGGATGG + Intergenic
1004429398 6:15530214-15530236 CCACAGCACCTTTCTTAGGGAGG - Intronic
1004777309 6:18862210-18862232 CAACAGGCCCTTTCAGAGAAAGG + Intergenic
1005411377 6:25551028-25551050 CAACAGGACATTTTTAACAAAGG - Exonic
1006115957 6:31776367-31776389 GTCCCGGACCTTTCTAAGGAGGG + Intronic
1008276235 6:49547838-49547860 GAACAGAATCTTTGTAAGGAGGG + Intergenic
1010776956 6:79898021-79898043 CAACAGTATTTTTCTAAGAAAGG - Intergenic
1012278877 6:97305013-97305035 AAACAGGAGTTCTCTAAGGAAGG + Intergenic
1013478213 6:110529310-110529332 CAGCAGGACTTCTCAAAGGAAGG - Intergenic
1017190479 6:151648344-151648366 CAGCAAGACCTATCCAAGGAGGG - Intergenic
1017531071 6:155292499-155292521 CATCATGCCCTTTCTGAGGAAGG - Intronic
1021330619 7:19334759-19334781 CAACTTGATCTTTCTAAGGATGG - Intergenic
1024127969 7:46320250-46320272 AAACAGGACTTTTCTCAGGCAGG + Intergenic
1028145239 7:87313845-87313867 CACCAAGACCTTTCTGAAGAAGG + Intergenic
1028479315 7:91287306-91287328 CAGCATGGCCTTGCTAAGGAAGG - Intergenic
1029513809 7:101013367-101013389 CAGCATGAACTTTCTCAGGAAGG - Intronic
1031096118 7:117423042-117423064 CAAAAGGACATTTCAAAGGCAGG + Intronic
1032338590 7:131049537-131049559 CAACATGATCTTTCTAATGAAGG - Intergenic
1034245500 7:149641206-149641228 CGACAGCACTTGTCTAAGGAGGG - Intergenic
1038468201 8:27786232-27786254 CAAAAGGATCTTTTTAAAGAAGG + Intronic
1040077311 8:43249814-43249836 AAACATGAACTTTTTAAGGATGG - Intergenic
1043287064 8:78545841-78545863 AAACATGCCCTTTCCAAGGAAGG - Intronic
1046835168 8:118792726-118792748 CATCATGACCTTTCTAAGTTAGG + Intergenic
1047664526 8:127076147-127076169 CAGCAAGTCCTTTCTAAGAAGGG - Intergenic
1047875307 8:129130275-129130297 CAACTGGACTTCTCTATGGAGGG - Intergenic
1048887155 8:138917770-138917792 CACCAGGATTTTTATAAGGAGGG - Intergenic
1050136376 9:2469796-2469818 CAACAGGTCCTGCCCAAGGATGG - Intergenic
1053361141 9:37487341-37487363 CAACATGACCTCACCAAGGAAGG - Intronic
1055889996 9:81113860-81113882 CAAGTGCACCTTTCTAGGGATGG - Intergenic
1058695373 9:107554530-107554552 CCACAAGACCCTTCTAAGAAGGG - Intergenic
1059744057 9:117183045-117183067 CAAGAAGGCCTTTCTGAGGAAGG - Intronic
1060325406 9:122609829-122609851 CAGGAGGACCTGTCTAGGGAAGG - Intergenic
1188410675 X:29868437-29868459 CAGCAGGACATTCCTATGGATGG + Intronic
1189750954 X:44222283-44222305 GAACAGGCTCTATCTAAGGAGGG + Intronic
1189995487 X:46633281-46633303 GAACAGGAGATTTCTAAGAAAGG + Intronic
1191693575 X:63965270-63965292 CAAAAAGACATTTCTAATGATGG - Intergenic
1192616197 X:72625260-72625282 CACCAGGACCTTCTTGAGGATGG - Intronic
1197586274 X:128352166-128352188 CAACAGGGCCTGTCAGAGGATGG + Intergenic
1199172125 X:144744456-144744478 CAATAGGACCTTTTGAAGTACGG + Intergenic
1199730601 X:150628497-150628519 GAACAGTGCCTTTCTAAGCATGG + Intronic