ID: 1068295502

View in Genome Browser
Species Human (GRCh38)
Location 10:55067220-55067242
Sequence TTGTGGGGATGAAGGGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 912
Summary {0: 1, 1: 0, 2: 8, 3: 73, 4: 830}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068295502 Original CRISPR TTGTGGGGATGAAGGGAGGT TGG (reversed) Intronic
900391718 1:2436583-2436605 TTGGAGGGAGGAAGGGAGGAGGG - Intronic
900533687 1:3167012-3167034 TTCTGGGGATGGAGGGCAGTTGG - Intronic
900702904 1:4059008-4059030 TGGTGGGGCTGAGGGGAGGCTGG + Intergenic
901059293 1:6464721-6464743 TGGTGGGGGTGCAGGGAGATGGG + Intronic
901804818 1:11731869-11731891 TTGGGGGGATGCGGGGAGGTGGG - Intergenic
902070247 1:13728498-13728520 CTGTGGGGAAGAAGGGAGGGAGG + Intronic
902610577 1:17594841-17594863 TGGTGGGGATGAAATGAGATGGG + Intronic
903184950 1:21623565-21623587 TTCTGGGGCTGGAGGGTGGTGGG - Intronic
903359946 1:22770752-22770774 AGGAAGGGATGAAGGGAGGTTGG + Intronic
903549661 1:24149181-24149203 GTGTGGGGATGGAGGGAGGTGGG + Intergenic
903741808 1:25562736-25562758 TTGTGGGTGTGGTGGGAGGTGGG + Intronic
903976610 1:27154484-27154506 TTCTGGGGGTGGAGGGAGGCTGG + Exonic
904463061 1:30691929-30691951 TTATAGAGATGAATGGAGGTGGG - Intergenic
904498854 1:30902596-30902618 TTGGGGGGATGATGGGAGCAAGG + Intronic
904831218 1:33307696-33307718 AGGTGGGGATGGAGTGAGGTTGG - Intronic
905786826 1:40765114-40765136 TTGTGGGGAGGAAGGCAGCTGGG - Intronic
905790723 1:40787898-40787920 TGGGGAGGATGAAGGGAGATAGG - Intronic
905928723 1:41771277-41771299 TTTTGGGGGTGGGGGGAGGTGGG - Intronic
906158016 1:43625528-43625550 GTGTGACGATGAATGGAGGTGGG - Intergenic
906245566 1:44271081-44271103 TTGTGTGCATGAAGGGAAGAGGG - Intronic
906277103 1:44524446-44524468 TTGGGTGGAAGGAGGGAGGTGGG - Intronic
906307508 1:44729149-44729171 TTGTAGAGTTGAAGGGAGATGGG - Intergenic
906472614 1:46143912-46143934 AGAGGGGGATGAAGGGAGGTTGG - Intronic
906909516 1:49932689-49932711 TTGTGGGGAGGAAAGTGGGTTGG - Intronic
906979306 1:50611829-50611851 GTGTGGGTATGTGGGGAGGTTGG - Intronic
907778314 1:57540831-57540853 TAGGGGGAATGAAGAGAGGTGGG + Intronic
908344045 1:63213294-63213316 TTGTGGAGAGGTAGGGAGTTAGG - Intergenic
909101247 1:71352174-71352196 AGGAGGGGATGAAGAGAGGTTGG - Intergenic
909277275 1:73703767-73703789 TTGTGATGATTAAGTGAGGTTGG - Intergenic
909431062 1:75588260-75588282 GAGGGGGGAGGAAGGGAGGTGGG + Intronic
909814821 1:79978579-79978601 TGGTGGTGAAGAAGAGAGGTGGG - Intergenic
910373348 1:86542144-86542166 ATGGGAGGATGAAGAGAGGTTGG + Intergenic
910438107 1:87226111-87226133 TTGAGGAGCAGAAGGGAGGTAGG + Intergenic
910503287 1:87919254-87919276 CTGTGGGGAGTAAGGAAGGTAGG + Intergenic
912313700 1:108647526-108647548 TGGTGGGGAGGAGGTGAGGTGGG + Intergenic
914221350 1:145684780-145684802 GGGTGGGGATGAAGAGAGCTAGG - Intronic
914256296 1:145962790-145962812 TGTTGGGGCTGAGGGGAGGTCGG - Exonic
914473916 1:148007647-148007669 GGGTGGGGATGAAGAGAGCTAGG - Intergenic
914687209 1:149991217-149991239 TTGTGGGGTTGGTGGGAGGTGGG - Intronic
914932383 1:151946880-151946902 CTGTGGTGGTCAAGGGAGGTGGG + Intergenic
915088208 1:153403255-153403277 TTGTGTGTATGAAGGAAGGAAGG + Intergenic
915096679 1:153467565-153467587 TTGTGCGTATGAAGGAAGGAAGG - Intergenic
915268241 1:154733818-154733840 TGTTGGGGATGAAGGGAGGGAGG - Intronic
915300966 1:154951435-154951457 CTGTGGGAAGGAAGGGAGGCGGG - Intronic
916437908 1:164793591-164793613 TTGTGGGGAGGATGGGATGGGGG - Intronic
916521844 1:165570356-165570378 TTGAGGAAATGTAGGGAGGTGGG - Intergenic
916726551 1:167528732-167528754 TTGGGGGGAGGAAGGGATGCTGG - Intergenic
916840205 1:168592642-168592664 ATGTGGGGGTAAAGGGAGGAAGG + Intergenic
917174060 1:172211922-172211944 TTATGAGGATGAAGGAGGGTTGG + Intronic
917226656 1:172790787-172790809 ATGTGGGGATAAATGGAGGAGGG + Intergenic
917261037 1:173169753-173169775 CAGTGGGGATGAAGAGAGGTTGG + Intergenic
917535734 1:175873072-175873094 GTGGGGGGCTGAAGGGAGGAGGG - Intergenic
918133502 1:181649105-181649127 TTGAGGGTTTTAAGGGAGGTAGG - Intronic
918914959 1:190623075-190623097 TTGTGGGGGGTGAGGGAGGTGGG + Intergenic
919157302 1:193782605-193782627 GGCAGGGGATGAAGGGAGGTTGG + Intergenic
919595745 1:199559991-199560013 GTGGGGGGATGGAGAGAGGTTGG + Intergenic
920074628 1:203327322-203327344 TCGTGGGGATTGAGGGACGTGGG - Intergenic
920274032 1:204790574-204790596 CAGTGGGGATGAAGGGAACTAGG - Intergenic
920829827 1:209454073-209454095 ATGTAGGGATGAAGAGGGGTTGG - Intergenic
920966394 1:210704962-210704984 TTGTGGGGTTGAAGGTTGGGAGG + Intronic
921070909 1:211656876-211656898 CTATGGGGCTGATGGGAGGTGGG - Intergenic
921479281 1:215645184-215645206 TTGTGGGCATGAAGGGAGAAAGG + Intronic
922084302 1:222331271-222331293 TTGTGAGGATTAAATGAGGTAGG - Intergenic
922818857 1:228470519-228470541 ATGCGGGGAGGAAGGGGGGTGGG + Intergenic
922907754 1:229187711-229187733 CTGTAGGGATGAAGAGAAGTAGG - Intergenic
923156221 1:231281664-231281686 TTGATGGGAGGAAGGGAGGAGGG - Intergenic
924839588 1:247694877-247694899 TTGTGGGGTTGGGGGGAGGTGGG - Intergenic
924852045 1:247840344-247840366 TTGTGGGAAGGAAGGGAGGGAGG - Intergenic
1062833790 10:623448-623470 CTGTGGGGCTGAGGGGAGGAGGG + Intronic
1062951679 10:1508221-1508243 TCCTGGGGATGGATGGAGGTCGG - Intronic
1063775697 10:9261227-9261249 ATGTGGGCATGAAGTGAGGAGGG - Intergenic
1064906920 10:20357085-20357107 GTGTGGGGAGGTAGGGAGGCAGG - Intergenic
1065087366 10:22192512-22192534 TTGTGAGGCTGAGGTGAGGTGGG - Intergenic
1065501787 10:26390530-26390552 CGGAGGGGATGAAGAGAGGTTGG + Intergenic
1065980966 10:30896652-30896674 TTGTGGGGAGGAGGGGAGGCCGG + Intronic
1065994542 10:31045206-31045228 TGGGAGGGATGAAGAGAGGTTGG - Intergenic
1066391203 10:34978591-34978613 TTGTAGGGATGGAGGGACATGGG + Intergenic
1067085157 10:43234335-43234357 TTGGGGGGATGAGCGGAGGGAGG - Intronic
1067172866 10:43922289-43922311 GTTTGGGGAGGAAGGGAGGAAGG - Intergenic
1067353036 10:45494490-45494512 TGGTGGGGACAAAGGGAGATAGG - Intronic
1068280935 10:54868910-54868932 TTTTGGAGAGGAAGGGAGTTGGG - Intronic
1068295502 10:55067220-55067242 TTGTGGGGATGAAGGGAGGTTGG - Intronic
1069098227 10:64286522-64286544 TTGTGTGGTAGAAAGGAGGTGGG - Intergenic
1070191032 10:74112315-74112337 TTTAGGGGATGAAGAGAGATGGG + Intronic
1070338526 10:75475967-75475989 ATGTGGGAAAGAAGGGAGGGCGG - Intronic
1071129213 10:82371947-82371969 TTGTGGGGGTGTTGGGAGGAGGG - Intronic
1071294119 10:84206871-84206893 CTGTGGGGCTGAGGGTAGGTGGG + Intronic
1071603498 10:86970266-86970288 TGGTGGGGCTGGAGGGAGGCGGG + Intronic
1071603741 10:86971169-86971191 TTGTGGGGACGAAGCGGAGTCGG + Intronic
1071755445 10:88533608-88533630 TTGTGAGGATGGAGTGAAGTGGG + Intronic
1071872370 10:89809330-89809352 ATTTGAGGATGAAGGGAGATTGG + Intergenic
1073133980 10:101209404-101209426 TTGTGAGGATTAAGTGAGTTAGG - Intergenic
1073583154 10:104685821-104685843 TTGTGGGGACAAAGGGAAGAGGG - Intronic
1073895270 10:108148977-108148999 TTGTGGGGTTGAATGGATGTAGG + Intergenic
1074017904 10:109553342-109553364 TTGTGGGGAGGAGGTGAGGTTGG - Intergenic
1074041164 10:109790658-109790680 ATCTGGGAATGAAGAGAGGTTGG + Intergenic
1074360464 10:112821174-112821196 TTGTTTGGATGAAGGGAAGGAGG - Intergenic
1074476936 10:113781835-113781857 CTGTGGGGTTGAAGAGAGGCAGG - Intronic
1075656289 10:124163315-124163337 TAATGGGGATGGAGGGAGGGAGG + Intergenic
1075804333 10:125174628-125174650 TGGTGGGGATGGTGGGAGGAGGG - Intergenic
1075956048 10:126524235-126524257 ATGTGGTCATGAAGGGAGGAAGG - Intronic
1076118909 10:127920668-127920690 TGGCGGGGCTGAAGGGAGGTTGG + Intronic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1077078773 11:713356-713378 CTGTGGTGATGAAGGCAGGCAGG - Intronic
1077283129 11:1754401-1754423 TGGAGGGGATGAAGGGATGGAGG + Intronic
1077283158 11:1754496-1754518 ATGTGGGGATGGAGGGATGGAGG + Intronic
1077340373 11:2023745-2023767 GTGTGTGGGTGCAGGGAGGTGGG + Intergenic
1077342069 11:2030641-2030663 TTCTGGGGCTCAAGGGAGCTGGG - Intergenic
1077428774 11:2503536-2503558 TTGTGGGGTTGGGGGGAGGGGGG + Intronic
1077472211 11:2769391-2769413 TTGGGAGGATGGAGGGAGGCTGG + Intronic
1078124429 11:8546573-8546595 TGGGGGGGATGAAGAGAGGTTGG - Intronic
1078197309 11:9146696-9146718 TTGTGGGTATGCAGGGAGGGAGG + Intronic
1078397890 11:10998083-10998105 CTGGGAGGAGGAAGGGAGGTTGG - Intergenic
1078617956 11:12882403-12882425 TTGTGGGGAAGGAGACAGGTAGG - Intronic
1078789651 11:14529499-14529521 TGGTGGTGATGATGGGAGTTGGG - Intronic
1079070310 11:17339496-17339518 TTGTGGGGGTGGGGGGAGGGGGG - Intronic
1079947021 11:26756839-26756861 CTGTGGGGTTGAGGAGAGGTTGG - Intergenic
1082739488 11:56894858-56894880 TTGTGAGGATGAAGGTGGGAGGG - Intergenic
1083143147 11:60738167-60738189 TTATGGGGATGAAGAGAGAAAGG - Intronic
1083173583 11:60936494-60936516 TTGTGGGGCTGGGGGGAGGTGGG - Exonic
1083677579 11:64335147-64335169 CTGTGGGGAGGAGGGGAGGCTGG - Intergenic
1084067885 11:66715802-66715824 CTGTGGTCATGAAGGGAAGTGGG - Intronic
1084726006 11:70942515-70942537 ATGTGGGGGTGTTGGGAGGTGGG - Intronic
1085059975 11:73436749-73436771 TTGAGGAGAGGCAGGGAGGTTGG - Intronic
1085338585 11:75716780-75716802 CAGTGGGGCAGAAGGGAGGTGGG + Intergenic
1085365139 11:75934365-75934387 TGGTGGGGAGGAAGTGAGGATGG + Intronic
1085830995 11:79900864-79900886 TGGCTGGGATGAAGAGAGGTTGG + Intergenic
1086731830 11:90259561-90259583 ATTTGAGGATGAAGGGAGGAAGG + Intergenic
1086913199 11:92496700-92496722 TTGTTGGGTTGAAGGAAGGAAGG + Intronic
1086971585 11:93086458-93086480 GTGTGGGAATTAAGGGAGATGGG + Intergenic
1087324783 11:96708360-96708382 TTGTGAGGGTGATGGGAGGGTGG + Intergenic
1087888681 11:103511447-103511469 TTGTGGGGTTGGGGGGAGGGGGG - Intergenic
1088038877 11:105351884-105351906 TTGTGTATATGAAGGGAGGTAGG - Intergenic
1088090493 11:106033165-106033187 AAGAGGGGTTGAAGGGAGGTAGG + Intergenic
1088818021 11:113434606-113434628 GTGTGGGGATGTGGGGAGGTGGG + Intronic
1088926538 11:114308513-114308535 GTATGGGGAGGAAGGGAGGGAGG - Intronic
1089240495 11:117074331-117074353 TTGTGGGGCTGTAGGGAAGTGGG - Intronic
1089387765 11:118079316-118079338 CTGTGGGGATGGAAGGAGGTAGG - Intronic
1089580350 11:119477795-119477817 GTCTGGGGGTGAAGAGAGGTGGG + Intergenic
1090349883 11:126101193-126101215 TGGTGGGGTTGAGGGGAGTTGGG + Intergenic
1090393076 11:126402083-126402105 TTGGGGGAAAGAGGGGAGGTAGG + Intronic
1090537585 11:127661297-127661319 TTGTGGGGAAGAGTGGAAGTGGG - Intergenic
1202823358 11_KI270721v1_random:78934-78956 GTGTGTGGGTGCAGGGAGGTGGG + Intergenic
1202825055 11_KI270721v1_random:85830-85852 TTCTGGGGCTCAAGGGAGCTGGG - Intergenic
1091524434 12:1284035-1284057 AGAGGGGGATGAAGGGAGGTTGG - Intronic
1092233606 12:6791970-6791992 TTGAGGGGATGAGGGAAGGAGGG + Intronic
1092674595 12:10901505-10901527 TTGTGGGGAGCAAGGTGGGTGGG - Intronic
1092793104 12:12086414-12086436 GAGTGGGGAAGAGGGGAGGTGGG - Intronic
1092855767 12:12672387-12672409 TTGTGTGAATGTAGGGAGGTAGG - Intronic
1092997921 12:13967816-13967838 TTGCAGGCATGAGGGGAGGTGGG + Intronic
1093124111 12:15307503-15307525 TGGTGGGGGTGTGGGGAGGTGGG - Intronic
1094202432 12:27807668-27807690 TCATGGGGATGTGGGGAGGTGGG - Intergenic
1094343999 12:29446253-29446275 TTGTAGGGATGAAAGGAAGGAGG + Intronic
1095589351 12:43886779-43886801 TTCTGGGGATGGAGGGTGGGAGG - Intronic
1096021708 12:48330484-48330506 TTCTGGGGAGGAAGGCATGTTGG + Intergenic
1096107039 12:49002362-49002384 TTGTGCATATGAAGGGAGATGGG - Exonic
1096715301 12:53487429-53487451 CTGTGGGAATGAAGGAAGGAGGG + Intronic
1096806530 12:54144344-54144366 TTGTGGGGCTGAAGAGAGGGAGG - Intergenic
1096978913 12:55717281-55717303 TTGGAAGGGTGAAGGGAGGTGGG - Intronic
1097160966 12:57046477-57046499 TTCTGGGACTGAATGGAGGTTGG + Intronic
1097248558 12:57620055-57620077 TTGCGCAGATGAGGGGAGGTGGG - Exonic
1098177280 12:67805954-67805976 TGGTGGGGAAGGAGGGAGGGAGG - Intergenic
1098776147 12:74620259-74620281 TTGTGGGGAAGGAGGGATGAGGG - Intergenic
1098807481 12:75037775-75037797 GTGTGGGGATGTGGGGATGTGGG + Intergenic
1098807487 12:75037783-75037805 ATGTGGGGATGTGGGGGGGTGGG + Intergenic
1099506728 12:83486794-83486816 TTAGGGAGATGAAGAGAGGTTGG - Intergenic
1100198518 12:92273987-92274009 TTGTGAAGATGAAGGCAGGAAGG - Intergenic
1100370716 12:93966752-93966774 GTGGAGGGATGAAGGGAGGGAGG - Intergenic
1100551982 12:95654599-95654621 ATGTGGGGATGATGGGATGATGG + Intergenic
1100552026 12:95654791-95654813 ATGTTGGGATGATGGGATGTTGG + Intergenic
1100552057 12:95654919-95654941 ATGTTGGGATGATGGGATGTGGG + Intergenic
1100552081 12:95655015-95655037 ATGTTGGGATGATGGGATGTTGG + Intergenic
1100552085 12:95655031-95655053 ATGTTGGGATGATGGGATGTTGG + Intergenic
1100552113 12:95655151-95655173 ATGTTGGGATGATGGGATGTTGG + Intergenic
1100552120 12:95655175-95655197 ATGTTGGGATGATGGGATGTGGG + Intergenic
1100552146 12:95655279-95655301 ATGTTGGGATGATGGGATGTTGG + Intergenic
1100552150 12:95655295-95655317 ATGTTGGGATGATGGGATGTTGG + Intergenic
1100552161 12:95655343-95655365 ATGTTGGGATGATGGGATGTTGG + Intergenic
1100552167 12:95655367-95655389 ATGTTGGGATGATGGGATGTTGG + Intergenic
1100552188 12:95655447-95655469 ATGTGGGGATGTTGGGATGTTGG + Intergenic
1100552198 12:95655487-95655509 ATGTTGGGATGATGGGATGTTGG + Intergenic
1100726514 12:97414561-97414583 TTGGAGGGAGGAAGGGAGGAAGG - Intergenic
1101045679 12:100803326-100803348 TCTTTGGGAGGAAGGGAGGTAGG + Intronic
1101204582 12:102473484-102473506 TTTTGGGCATGAAGGTATGTTGG + Intronic
1101761324 12:107661193-107661215 AGGTGGGGGTGGAGGGAGGTGGG - Intergenic
1102220188 12:111188957-111188979 TTCTGGGGGTAAAGGGAGGGAGG - Intronic
1102442555 12:112974863-112974885 TTGTGGGCAGGAGAGGAGGTGGG - Intergenic
1102496155 12:113320785-113320807 TTGTGGGGAGGCTGGGAGATAGG - Intronic
1102647256 12:114411875-114411897 TTGAGGAGGTGAAGGGAGGTAGG + Intergenic
1102894523 12:116588003-116588025 TTGTGGGGAGTCAGTGAGGTGGG + Intergenic
1103237966 12:119389743-119389765 TTGTGGAAGTGATGGGAGGTGGG - Intronic
1103288328 12:119822047-119822069 TTTTGGTGATGGAGGGAGGTTGG - Intronic
1103561659 12:121796051-121796073 TTGTGGTGATGGAGGGGGGCTGG + Intronic
1103605050 12:122079762-122079784 TTGTGGGGATGGAGTGAGATAGG + Intronic
1103908324 12:124338834-124338856 TTGTGGGGATGAGTGGATGGAGG - Intronic
1104274965 12:127318308-127318330 CTGTGGGGATGCAGTGAGGATGG - Intergenic
1104615793 12:130267476-130267498 GTGGGGAGATGAAGAGAGGTTGG - Intergenic
1104731754 12:131108989-131109011 AGGTGGGGATGGGGGGAGGTGGG + Intronic
1105004107 12:132710614-132710636 TTGTGGGGACGCCGGGAGGGCGG - Intergenic
1105738675 13:23298961-23298983 GTGTGGTGAGGATGGGAGGTGGG + Intronic
1105818306 13:24057226-24057248 TTGTGGGGTTGGGGGGAGGGGGG - Intronic
1105911622 13:24873678-24873700 GTGGGGGGATGAAGAGAGGTTGG - Intronic
1106478777 13:30120784-30120806 TGGTGGGGATGTAGGAATGTTGG + Intergenic
1106830430 13:33575500-33575522 CTGTGGTGATGTTGGGAGGTGGG + Intergenic
1106998715 13:35519903-35519925 GTGTGGGGATAAAGAGAGTTTGG - Intronic
1107080731 13:36372173-36372195 GTGTGGGCAGAAAGGGAGGTAGG - Intergenic
1107203755 13:37755513-37755535 TTGGGAGGCTGAGGGGAGGTGGG - Intronic
1107613552 13:42141046-42141068 TTGTGGGGTTGGTGGGAGGGGGG - Intronic
1107897042 13:44975534-44975556 TTGTGGGGATGGAGAGAACTAGG - Intronic
1108209174 13:48121063-48121085 TTGAGGGGATGAGGGAAAGTGGG - Intergenic
1109725386 13:66334170-66334192 GTGGAGGGATGAAGAGAGGTTGG - Intronic
1109737709 13:66508241-66508263 TTGTGGGGATTAGGGGAGGAGGG + Intronic
1109862145 13:68213988-68214010 AAGTGGGGAGGAAGGGAGGAGGG - Intergenic
1110399033 13:75068190-75068212 TTCTGGGGTTGAAGAGAGTTCGG - Intergenic
1110555890 13:76858449-76858471 TTCTGGGGGGGAGGGGAGGTGGG + Intergenic
1110563070 13:76929959-76929981 TTGTGGGGAAAAAGGGATATTGG - Intergenic
1110754693 13:79159020-79159042 TCGGGAGGATGAAGAGAGGTTGG - Intergenic
1112085990 13:96033449-96033471 TTTGGGGGCTGAAGGCAGGTAGG + Intronic
1112561827 13:100521976-100521998 TTTTGGGGAAGAAGGGTGGGTGG - Intronic
1113822513 13:113224863-113224885 TTGTGTGGATGAATGAGGGTCGG + Intronic
1114080018 14:19195655-19195677 TTATGGGGATGAAGGCTGTTAGG + Intergenic
1114360262 14:21964349-21964371 TTGGGGGAATAAAAGGAGGTTGG - Intergenic
1114547384 14:23512879-23512901 TTGTGGGGAGGAAAAGAGGGGGG + Intergenic
1114683123 14:24503728-24503750 TTGTGGGGTTGGGGGGGGGTAGG + Intronic
1114740664 14:25093892-25093914 TTCTGAGGATGAAGGGCAGTGGG + Intergenic
1115143431 14:30199639-30199661 CTGTGGGGAAGAAGGCAGGGTGG - Intergenic
1115695224 14:35890607-35890629 AGGAGGGGATGAAGAGAGGTTGG - Intronic
1115955083 14:38768682-38768704 TTGTGGGGTTGGGGGGAGGGGGG + Intergenic
1116183752 14:41569570-41569592 TTTTGGGGATGCAGGGAAATAGG + Intergenic
1116707975 14:48327723-48327745 TTGTGGGGGTAAGGGGAGGGGGG - Intergenic
1117916287 14:60681617-60681639 ATGGGTGGATGAAGAGAGGTTGG - Intergenic
1117954240 14:61110555-61110577 TGGTGGGGCTGAAGCGAAGTTGG - Intergenic
1117962761 14:61179153-61179175 CTCTGGGGATGAAGGGATGGGGG + Intergenic
1118169454 14:63372647-63372669 TTGTGGGGATGAGGGTGGGATGG - Exonic
1118279586 14:64416422-64416444 TTTTGGGGGTGGGGGGAGGTGGG - Intronic
1119684837 14:76623352-76623374 ATGTGGAGAAGAAGGGAGGAGGG - Intergenic
1120541932 14:85761502-85761524 ATGTGGGAATGAATGGAGCTTGG + Intergenic
1121307399 14:92915661-92915683 CTATGGGGATGAGGGGAGGGTGG + Intergenic
1121497412 14:94403540-94403562 TTCATGGGATGATGGGAGGTGGG - Intergenic
1121765010 14:96478735-96478757 TTGTGGGGCTGGGGGGAGGGTGG + Intronic
1121800173 14:96768575-96768597 ATGTAGGGAGGAAGGGAGGGAGG - Intergenic
1122149104 14:99715008-99715030 GTGGGGGGATGAAGAGAAGTTGG + Intronic
1123665400 15:22605838-22605860 TTGTTAGGATGCAGGGAGATAGG - Intergenic
1123752357 15:23366813-23366835 TTGTTAGGATGCAGGGAGATAGG + Intronic
1124319234 15:28700255-28700277 TTGTTAGGATGCAGGGAGATAGG - Intergenic
1124371450 15:29106860-29106882 AAGTGGGGATGAAGTGAGGCAGG - Intronic
1124483288 15:30095179-30095201 TTGTTAGGATGCAGGGAGATAGG + Intergenic
1124489739 15:30147246-30147268 TTGTTAGGATGCAGGGAGATAGG + Intergenic
1124520290 15:30402042-30402064 TTGTTAGGATGCAGGGAGATAGG - Intergenic
1124538366 15:30564177-30564199 TTGTTAGGATGCAGGGAGATAGG + Intergenic
1124544829 15:30616241-30616263 TTGTTAGGATGCAGGGAGATAGG + Intergenic
1124753790 15:32391081-32391103 TTGTTAGGATGCAGGGAGATAGG - Intergenic
1124760286 15:32443408-32443430 TTGTTAGGATGCAGGGAGATAGG - Intergenic
1124778349 15:32605655-32605677 TTGTTAGGATGCAGGGAGATAGG + Exonic
1124881492 15:33646792-33646814 TTGTGGGCAGCAAGGAAGGTAGG - Intronic
1125734742 15:41916920-41916942 TTGTGTGGATGCAGGGAGTGGGG - Intronic
1125810641 15:42537913-42537935 GTGGGGCGATGAAGGAAGGTAGG + Exonic
1126070049 15:44858298-44858320 TTGTGGGGTTGGGGGGAGGGGGG + Intergenic
1126137434 15:45405168-45405190 GTGAGGGGATGAAGACAGGTTGG - Intronic
1126549801 15:49915318-49915340 TGCGGGGGATGAAGAGAGGTTGG + Intronic
1126929889 15:53635687-53635709 TGGGGGGGATGGAGGGAGATGGG + Intronic
1127360798 15:58243393-58243415 ATCTGGGGAAGAAGGGAGATGGG - Intronic
1127735649 15:61836232-61836254 TTGTGGGCATGCACGGAGATGGG + Intergenic
1127982920 15:64047169-64047191 GTGAGGGGGTGAAGGGAGGAAGG + Intronic
1128334619 15:66777980-66778002 TTGGGGGGATGGAAGGAGTTTGG + Intronic
1128350205 15:66883434-66883456 TTGTGGGGGAGATGGGAGGAGGG - Intergenic
1128818842 15:70634264-70634286 AAGTGGGGATGAAGGGCGGATGG + Intergenic
1129612958 15:77074826-77074848 GTCTGGGGATGATGGGAGGATGG + Intronic
1130368889 15:83266252-83266274 GTGTGGGGAGGGAGGGAGGGAGG + Intronic
1131149325 15:90037048-90037070 TGGTGGGGAGGACGGGAAGTGGG + Intronic
1132149972 15:99452344-99452366 TGATGAGGAAGAAGGGAGGTGGG + Intergenic
1132561092 16:594330-594352 TTGTGGGGAGAAACGGAGGGAGG + Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133033572 16:3022819-3022841 TTGTGGGGAAGAAGGAAGGTGGG + Exonic
1133217659 16:4303149-4303171 TTTTGTGGATGAAGAGAGGGAGG - Intergenic
1133853070 16:9524284-9524306 AGGTGGGGAGGAAGGGAGGGAGG - Intergenic
1133978586 16:10617568-10617590 GTGTAGGGGTGAAGGGAGGAGGG - Intergenic
1134063011 16:11210394-11210416 TTGTGGGCACGAGGGGAGGAAGG - Intergenic
1134427410 16:14164183-14164205 TGCTGGGGATGAAGAGAGATTGG - Intronic
1134430723 16:14203270-14203292 TTATGGGTATGAAGGAGGGTGGG - Intronic
1134597731 16:15509316-15509338 TTGTGGAGTGGAAGGGGGGTGGG + Intronic
1134782416 16:16910188-16910210 GTGAGTGGATGGAGGGAGGTAGG + Intergenic
1135191501 16:20358238-20358260 CAGTGGAGATGAAGGGAAGTGGG + Intergenic
1135205646 16:20481585-20481607 AGTGGGGGATGAAGGGAGGTTGG + Intronic
1135213266 16:20542228-20542250 AGTGGGGGATGAAGGGAGGTTGG - Intronic
1135583679 16:23650427-23650449 GTGTGGGGAGGGAGGGAGGCAGG - Intronic
1136081505 16:27855217-27855239 TTGTGGGGATCAAAGGAGAATGG - Intronic
1136086827 16:27891090-27891112 TTCTGGGGATGGGGGCAGGTTGG - Intronic
1136504965 16:30697369-30697391 TTCTGGGGGTGATGGGAGGAGGG + Intergenic
1138042557 16:53689378-53689400 TGGGGAGGATGAAAGGAGGTTGG - Intronic
1138248919 16:55487699-55487721 TTGGGTGGATGAGGGGAGGATGG + Intronic
1138369721 16:56517134-56517156 GTGACGGGATGTAGGGAGGTAGG - Intronic
1138615585 16:58163031-58163053 TCATGGGGATAAAAGGAGGTGGG + Intronic
1139218956 16:65159031-65159053 GTGGAGGGATGAAGAGAGGTAGG + Intergenic
1139952093 16:70677460-70677482 TTCTGGCCATGAAGGGAGGTGGG + Intronic
1140357522 16:74319168-74319190 TGGAGGGGATGCAGGGAGGGTGG - Intergenic
1141490675 16:84370485-84370507 GTGTGAGGAGGGAGGGAGGTGGG + Intronic
1142074244 16:88108223-88108245 CTGTGGGGATGCGGGGAGGGGGG + Intronic
1142076134 16:88119294-88119316 GTGCGGGGATGAAGCGAGGGAGG - Intergenic
1142434651 16:90048307-90048329 TTGCGGGGAGGAAGGGCGGGGGG - Intergenic
1142887060 17:2919535-2919557 TTGTGGGGAACACGGGAAGTGGG + Intronic
1142993804 17:3749216-3749238 TTGGGGGAATGAAGGGTGGGGGG + Intronic
1143281428 17:5757597-5757619 TTGTGGGGAGGGTGGGAGGAGGG + Intergenic
1143495396 17:7309251-7309273 ATGTGGGGAAGAGGGGTGGTTGG + Intronic
1143914000 17:10275577-10275599 GGGTGGGGATCATGGGAGGTAGG + Intergenic
1144297364 17:13888884-13888906 TTGTGGAGATGGAGGGAGGAGGG + Intergenic
1145883007 17:28365317-28365339 CGGTGGGGAAGAAGGGAGGCTGG + Intronic
1146034185 17:29391094-29391116 GTGTGTGGAAGAAGGGATGTGGG + Intronic
1146845564 17:36179572-36179594 TTTTGAGGATGCTGGGAGGTGGG + Intronic
1146873781 17:36391413-36391435 TTTTGAGGATGCTGGGAGGTGGG + Intronic
1146881138 17:36442503-36442525 TTTTGAGGATGCTGGGAGGTGGG + Intergenic
1147065609 17:37921458-37921480 TTTTGAGGATGCTGGGAGGTGGG - Intergenic
1147423020 17:40331925-40331947 TTGTGGGGAGGATGAGAGGGAGG + Intronic
1147502597 17:40979753-40979775 GTAAGGGGATGAAGAGAGGTTGG + Intronic
1147512876 17:41086900-41086922 TTGTGGGGGTGGGGGGAGGGGGG + Intronic
1147711359 17:42468513-42468535 GTGGGGGGATGAAGAGAGGTTGG - Intronic
1148559318 17:48596991-48597013 TTGGGGGGATGACGGGGGGTGGG - Intronic
1148583813 17:48762429-48762451 TGGTGGGGATGGGCGGAGGTCGG + Exonic
1148856854 17:50583656-50583678 TGGTGGGGGTGGGGGGAGGTGGG + Intronic
1149127312 17:53251186-53251208 TGAGGGGGATGAAGAGAGGTTGG - Intergenic
1149159147 17:53668935-53668957 TTGAGGGAAGGAAGGGAGGGGGG + Intergenic
1149637735 17:58184228-58184250 ATGTGCGGGTCAAGGGAGGTTGG + Intergenic
1149998969 17:61420341-61420363 TTGTTTGTATGGAGGGAGGTGGG - Intergenic
1150326916 17:64264670-64264692 TTCTGAGGATGAAAGGAGTTTGG - Intergenic
1151275035 17:73027915-73027937 TTGTTGGGGTGAAAGGAAGTGGG - Intronic
1151332148 17:73416441-73416463 TTGGGAGGCTGAAGTGAGGTAGG - Intronic
1152554858 17:81047966-81047988 TTGAGGGGCTGGAGGGAGGTGGG + Intronic
1152626386 17:81389624-81389646 TAGAGGGGATCAAGGAAGGTGGG - Intergenic
1153016580 18:587821-587843 TAGAGGGGATGAAGACAGGTTGG - Intergenic
1153177585 18:2395701-2395723 TTCTGGGGAAGAAGAGAGGTTGG - Intergenic
1153344865 18:4014408-4014430 TTGTGGGGGTGAAGAGATGTTGG + Intronic
1153841343 18:9010877-9010899 TGGTGGGGAGGGAGGGAGGGGGG + Intergenic
1153914337 18:9732509-9732531 GTGTGGGCATGCAGTGAGGTGGG + Intronic
1154096529 18:11421546-11421568 GTGGGGGGATGAGGGGAGGAGGG - Intergenic
1154505333 18:15033567-15033589 TTGTGGGGAGTAAAGGAGGATGG - Intergenic
1154970868 18:21407975-21407997 AGATGGGGATGAAGAGAGGTTGG + Intronic
1155248453 18:23933667-23933689 TTTTGGGGATGAAGAGGGGTTGG - Intronic
1155545117 18:26906817-26906839 TTGGGGAGGTGAAGGGGGGTAGG + Exonic
1156261063 18:35445344-35445366 TTGTGGGGAGGGAGGGAGGTGGG + Intronic
1156469864 18:37370482-37370504 TTGTCAGGATGTAGGGAGGCTGG - Intronic
1156698083 18:39792002-39792024 TTATGTGGAAGAAGGGAGATGGG + Intergenic
1156829188 18:41469871-41469893 TTGTGAAGATCAAGTGAGGTAGG - Intergenic
1156850984 18:41725958-41725980 TGGTGGGGAGGGAGGGAGGGAGG + Intergenic
1157120139 18:44901541-44901563 CTTTGGGTATGATGGGAGGTAGG + Intronic
1157226147 18:45866492-45866514 TAGCAGGGAGGAAGGGAGGTTGG - Intronic
1157398064 18:47360209-47360231 ATGGGGGGATGAAGAGAGGTTGG - Intergenic
1157430299 18:47619342-47619364 TTGAGGGGAGGCAGGGAGGGTGG - Intergenic
1157478410 18:48037616-48037638 GAGTGGGGAAGAAGGGAGATGGG + Intronic
1157663998 18:49470019-49470041 TGGTGGGTATGGAGGAAGGTAGG - Intergenic
1157749106 18:50162284-50162306 TTGTGGGTAGGGAGGGAGGGAGG - Intronic
1158243691 18:55406733-55406755 TTGTGGGGATGGGGGGAGGCGGG - Intronic
1158543403 18:58376616-58376638 TAGTGGGGAAGATGGGAGCTTGG - Intronic
1158628487 18:59091943-59091965 AGGTTGGGATGAAGGCAGGTTGG - Intergenic
1158961178 18:62588724-62588746 TGGTAGGGGTGAAGGGAGGGAGG + Intergenic
1159798639 18:72869964-72869986 GTGAGCGGATGAAGGGAGATTGG + Intergenic
1160618375 18:80151137-80151159 TGGTGGTGGTGACGGGAGGTTGG + Intronic
1161426936 19:4208829-4208851 TAGTGTGGATGCAGGGAGGAGGG - Intronic
1161483914 19:4524695-4524717 TTTTTGAGATGGAGGGAGGTGGG - Intronic
1162080127 19:8212818-8212840 TAGTAGAGATGAAGGGGGGTGGG + Intronic
1162341359 19:10093271-10093293 GTGAGGGAATGAAAGGAGGTAGG - Intronic
1162789982 19:13057815-13057837 TTGCGGGGAGGGAGGGAGGAAGG - Intronic
1163319698 19:16566893-16566915 TGGTGAGGATGAAGTGAAGTAGG + Intronic
1163398199 19:17076186-17076208 TTGTGGGGAGGCACGGAGGCGGG + Intronic
1163452274 19:17385487-17385509 TTCTGGGGATGGAGGGTGATAGG - Intergenic
1163582468 19:18146749-18146771 TTGTGTGGATGAATGGATGCTGG + Intronic
1164243452 19:23410013-23410035 TGATGGGGAAGAAGGGAGGGAGG + Intergenic
1165149782 19:33753763-33753785 GTGTGGGGATGGTGGGTGGTTGG - Intronic
1165149848 19:33753932-33753954 GTGTGGGGATGGTGGGAGGTTGG - Intronic
1165771077 19:38380657-38380679 TTGGGGGGAGGGAGGGAGGGAGG + Intronic
1166141236 19:40806531-40806553 TGGCAGGGATGGAGGGAGGTAGG - Intronic
1166839135 19:45685766-45685788 TTGGGGAGATAAATGGAGGTGGG - Intergenic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1167271514 19:48509091-48509113 TGGTGGGGGTCAAGGGTGGTGGG - Intronic
1167473060 19:49686034-49686056 AGGAGGGGATGAAGCGAGGTGGG + Intronic
1167648753 19:50718891-50718913 TGGTGGGGACGCAGGGAGCTTGG + Intronic
1167669029 19:50839081-50839103 CTGGGGGGTTTAAGGGAGGTGGG + Intergenic
1167674013 19:50873526-50873548 TTGGGGGGATAAAGGAAGGGGGG + Intronic
1167694629 19:51007521-51007543 GTAGGGGGATGAAGGGATGTAGG - Intronic
1168265997 19:55224448-55224470 TGGTGGGGATGAGGCGGGGTGGG - Intergenic
1168411060 19:56140832-56140854 TTGTGGAGATCAGGGGAGGCCGG - Intronic
925092106 2:1164154-1164176 CTGGGAGGATGAAGTGAGGTAGG + Intronic
925178519 2:1801163-1801185 TTGTGGGCATGGAGGGGGTTAGG + Intronic
925601186 2:5610234-5610256 TTGTGGGGCTGGAGGCAGGGAGG + Intergenic
926249095 2:11143417-11143439 CTGAGGGGCTGAAAGGAGGTGGG + Intronic
926274703 2:11395068-11395090 TTGTGGGGATGAAGCAAGGCAGG - Intergenic
926451668 2:13011799-13011821 GAGTGGGGATGAACAGAGGTGGG - Intergenic
927948991 2:27154897-27154919 TCCTGGGGATGAAGGGAAATTGG + Exonic
928407139 2:31023468-31023490 TTCTGGGGCTGAGGGGAGGGAGG - Intronic
929464832 2:42134993-42135015 CTGTGGTGATGAAGGGTTGTGGG + Intergenic
929592206 2:43154700-43154722 GAGTGGGGATGGATGGAGGTTGG + Intergenic
929656307 2:43735434-43735456 GTGGAGGGATGAAAGGAGGTTGG + Intronic
930775771 2:55168689-55168711 TTATGGGGAAGAAGTGAGGCTGG - Intergenic
931134570 2:59382894-59382916 GTGAGAGGATGAAGAGAGGTTGG + Intergenic
931255902 2:60572492-60572514 TTGTGGGAAAGAAAGTAGGTAGG + Intergenic
931430151 2:62202861-62202883 ATGAGGGGGAGAAGGGAGGTAGG - Intronic
931624563 2:64245189-64245211 ATGTGGGACTGAAGGGAAGTTGG - Intergenic
931805892 2:65803713-65803735 TTACTGGGAGGAAGGGAGGTTGG + Intergenic
932605580 2:73163307-73163329 TGGTGGGGGTGAGGGGAGGTGGG - Intergenic
933775763 2:85770329-85770351 GAGTGGGGTTGAGGGGAGGTTGG + Intronic
934764854 2:96874956-96874978 TTCTGGGGATGCAGTGAGGGAGG + Intergenic
934786878 2:97016351-97016373 TTGTTGGGATGCAGGGAGTATGG - Intronic
934869670 2:97851793-97851815 TTGAGGAGAGGAAGGGAGTTGGG - Intronic
935588788 2:104826051-104826073 TTGTGGGGTGGAGGGGAGGGTGG - Intergenic
935782282 2:106518872-106518894 TTGGAGGGCTGAAGGGAGGACGG - Intergenic
935782309 2:106518991-106519013 TTGAAAGGATGAAGGGAGGATGG - Intergenic
936480072 2:112877763-112877785 TTGTGGGAATTAAAGGAGATGGG - Intergenic
936993007 2:118386096-118386118 AAGTGGGGATGAAGAGAGGGAGG + Intergenic
937373843 2:121321793-121321815 TTGTGGGGAGGAAGGGTGACAGG - Intergenic
937544588 2:123001565-123001587 TTGTGAGGAAGAAGGAAGGCAGG - Intergenic
937658007 2:124398901-124398923 TGGTGATGATGGAGGGAGGTGGG + Intronic
937811215 2:126201347-126201369 TGGTGGGGAAGAAGGGACATGGG - Intergenic
938090242 2:128426505-128426527 GTGTGGGGAGGATGGGAGGAGGG - Intergenic
938828570 2:135031648-135031670 ATGTGGGGAAGAAGGGAAGTGGG + Intronic
938890154 2:135696337-135696359 TTATGGGGAAGAAGGGAAGGTGG + Intronic
939705092 2:145442599-145442621 TTGTGGGGGTGGGGGGAGGGGGG + Intergenic
940667406 2:156625590-156625612 ATGTGGGGAGGTAGGGAGGAAGG + Intergenic
940755100 2:157673167-157673189 TTCTGGGGCTGAAGAGATGTGGG - Intergenic
940809727 2:158228805-158228827 TTGTGGGGTTGGGGGGAGGGGGG + Intronic
942089748 2:172478460-172478482 TGGTGGGGAGCAATGGAGGTGGG + Intronic
942512919 2:176722082-176722104 TTGTGGGGTTGGGGCGAGGTAGG + Intergenic
942729204 2:179045156-179045178 TTGTGGGGTCGAGGGGAGGGGGG - Intronic
942764453 2:179437761-179437783 AAGTGGGGAAGAAGGGAGGGGGG + Intergenic
943499267 2:188666233-188666255 TTGAAGGGAGGAAGGGAGGGAGG - Intergenic
944145430 2:196503046-196503068 TTGTGGTGCTGAATGGAGCTAGG - Intronic
944239615 2:197473172-197473194 TTGTGTGGATGTATGTAGGTGGG - Intronic
944426722 2:199591171-199591193 GTGTGTGGGTGGAGGGAGGTTGG - Intergenic
945763271 2:213941886-213941908 TTGTTGGGACCAAGGGAGGAAGG - Intronic
946119855 2:217500500-217500522 TGGTGGGGAGTAATGGAGGTTGG + Intronic
946393930 2:219434108-219434130 GTGAGTGGAAGAAGGGAGGTGGG - Intergenic
946497747 2:220213034-220213056 ATGTGGGGATGGAGGGAGAGAGG + Intergenic
946768078 2:223058759-223058781 TTGAGGGGAAGATGGGAGGAGGG + Intronic
946866065 2:224041968-224041990 TTGTGGGGACCAACTGAGGTAGG - Intergenic
947541826 2:230985176-230985198 CTTTGGAGATGAAGGGAGGGAGG + Intergenic
947704192 2:232261208-232261230 TGGTGGGGAGGAAGGAAGGAAGG - Intronic
947831687 2:233146046-233146068 TTGTGGGGCTGCGGGGAGGCTGG + Intronic
947851760 2:233294027-233294049 ATGCTGGGATGAAGGGAGTTTGG - Intronic
948116635 2:235498305-235498327 ATTTGGGGGTGAAGGGAGGGGGG - Intronic
948369954 2:237482557-237482579 TTGGACAGATGAAGGGAGGTTGG + Intergenic
948464439 2:238145492-238145514 TTATGGGGATGGAGGGACCTGGG + Intronic
948770801 2:240250495-240250517 TTATGGGGGTCAAGGGAGGGAGG - Intergenic
948853675 2:240720246-240720268 TTGTGGAGATGAAGAGATGCTGG - Intronic
948948855 2:241236060-241236082 TTCTGGAGGTGAAGGGCGGTGGG - Intronic
1168835075 20:872612-872634 TGGTGGGGTTGCAGGCAGGTGGG - Exonic
1168909706 20:1438088-1438110 TAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1169112213 20:3041593-3041615 GTGTGGGAATGAAGTGAGGAAGG - Intergenic
1169140872 20:3226949-3226971 TGGTGGCGATGGAGGGAGGTGGG - Intergenic
1169197338 20:3690265-3690287 CTGTGGGGAGGAAGGGAGTGTGG + Intronic
1169307726 20:4507542-4507564 TTGAGGGGGTGGAGGGAGGGCGG + Intergenic
1169317188 20:4602472-4602494 TCTTGGGGATGAAGTGAGGGAGG - Intergenic
1169344721 20:4821284-4821306 ATGTGGAGATGGAGAGAGGTGGG + Intronic
1169582462 20:7039273-7039295 TTGGGGGGATGAAGAAAGATTGG + Intergenic
1169597978 20:7222652-7222674 TGGGGGGGATGAAAAGAGGTTGG - Intergenic
1170064501 20:12296055-12296077 GTGTGGGAATGAAGAGAGATTGG - Intergenic
1170086188 20:12535110-12535132 TTGTGGGGAAGATGGCAGATAGG + Intergenic
1170240234 20:14157528-14157550 GAGGGGGGATGAAGAGAGGTTGG - Intronic
1170394906 20:15915674-15915696 GTGTGGGGGTGTAGGGAGGCAGG + Intronic
1170596754 20:17811354-17811376 CTGTAGGGATGAAGGGATGTGGG - Intergenic
1170701727 20:18709804-18709826 TTCTGGGCATGAAGGTAAGTTGG - Intronic
1170739181 20:19038979-19039001 TTGTGGGGGTGAGGGGATGGGGG + Intergenic
1170830037 20:19832315-19832337 GAGTGGGGAGGAAGGAAGGTTGG - Intergenic
1170960332 20:21020043-21020065 TGGTGGGGATGAAGGGACCGAGG - Intergenic
1172367620 20:34362226-34362248 TTGTGAGAATAAAGGGAGCTTGG + Intergenic
1172775765 20:37405880-37405902 TGGTGGGGAAGGAGGGAGGAGGG - Exonic
1173017526 20:39239013-39239035 TTCTGGGGATGGTGGGGGGTTGG + Intergenic
1173316257 20:41947028-41947050 CTGGGGGGATGAGGAGAGGTTGG - Intergenic
1173615062 20:44397599-44397621 TTCAGGGGATGAAGAGACGTTGG - Intronic
1174146305 20:48455036-48455058 ACGTGGGGAGGAAGGGAGGGAGG + Intergenic
1174292836 20:49521159-49521181 TTGTGAAGATGAAAGGAGGCAGG - Intronic
1174536266 20:51253949-51253971 GGTGGGGGATGAAGGGAGGTGGG - Intergenic
1174669645 20:52294417-52294439 TTCTGGGGAGGGAGGGAGTTGGG + Intergenic
1175216891 20:57395902-57395924 CTGAGGGCATGGAGGGAGGTGGG + Intronic
1175353080 20:58340084-58340106 TTGTGGGGTTGAGGGGAGAAAGG + Intronic
1175525254 20:59629311-59629333 TTCCTGGGAAGAAGGGAGGTGGG - Intronic
1175984034 20:62755356-62755378 ATGGAGGGATGAAGGGAGGAAGG - Intronic
1176268839 20:64224889-64224911 TTGGGCGGATGAAAGGAGCTTGG + Intronic
1176792518 21:13335533-13335555 TTGTGGGGAGTAAAGGAGGATGG + Intergenic
1176897493 21:14398812-14398834 GAATGGGGATGAAGAGAGGTTGG - Intergenic
1177206793 21:18019335-18019357 TAGTGGGGAGGAAGTGAGGATGG + Intronic
1177991920 21:28046407-28046429 TTGTGGGGAGTAAAGGAGGATGG + Intergenic
1178216478 21:30605095-30605117 TGTTGGGGATGTGGGGAGGTTGG - Intergenic
1178770995 21:35504013-35504035 TTATGGGGATGAACAGATGTGGG - Intronic
1178821208 21:35976889-35976911 TTCTGGGGAGGAAGGGAGGGAGG + Intronic
1179091349 21:38268873-38268895 TCCTGGGGAAGAAGGAAGGTGGG - Intronic
1179343788 21:40537265-40537287 ATGTGGTGAGGAAGGGAGGTAGG + Intronic
1179621323 21:42618109-42618131 TTGCGGGGAGGTGGGGAGGTGGG - Intergenic
1180094519 21:45549786-45549808 TTGTGGGGAGGAGGACAGGTGGG + Intergenic
1180736723 22:18023221-18023243 TTGTGGGGAGGAGTGGTGGTGGG - Intronic
1181273416 22:21673929-21673951 CTGTAGTGATGTAGGGAGGTGGG + Intronic
1181428640 22:22862268-22862290 TTGTGGGGATGAGGGGTAGTTGG + Intronic
1181584379 22:23845092-23845114 TAGTGGGGGTGAAGGTAGGAGGG + Intergenic
1181967456 22:26666953-26666975 ATGTGGGGAGGGAGGGAGGGAGG + Intergenic
1182560087 22:31152862-31152884 GTGTGGAGAGGGAGGGAGGTGGG - Intergenic
1183440034 22:37817928-37817950 TTGTGGGGCACAAGGGAGGATGG - Intergenic
1183659238 22:39208682-39208704 TTGTGAGGATTAAAGGAGCTAGG - Intergenic
1184436986 22:44485070-44485092 TTCATGGGATGAAGGCAGGTGGG + Intergenic
1184755756 22:46514941-46514963 TTGTGGGGAGGCATGGAGTTTGG - Intronic
1184960016 22:47921993-47922015 TTGTGGAGTGGAAGGGAGGTGGG - Intergenic
1185167133 22:49268333-49268355 TTGGGCAGATGAAGGGAGGGAGG - Intergenic
949515053 3:4800131-4800153 TTGTGGGGAGGAAGGGGATTGGG + Intronic
949860354 3:8499589-8499611 GTGAGGGGATGAACAGAGGTTGG + Intergenic
950422352 3:12906487-12906509 GTTTGGGGGTGAAGCGAGGTGGG - Intronic
950445895 3:13037846-13037868 TGCTGGGGGTGAAGGGAGGGGGG + Intronic
950616819 3:14166501-14166523 GGGTGGGGGTGAAGGGAGGGTGG - Intronic
951019380 3:17765989-17766011 TGGTGGTGATGGAGGGTGGTGGG + Intronic
951099631 3:18672069-18672091 TGGTGGTGATGAAGGAAGATAGG + Intergenic
951291200 3:20874060-20874082 TTGTGGGGTTGGGGGGAGGGGGG - Intergenic
951655337 3:25001105-25001127 GTGTGAGGATGGAGGGAGGGAGG + Intergenic
952184956 3:30958545-30958567 GTGTGGAGATGAAGGGAGGGAGG - Intergenic
952459567 3:33510207-33510229 TGGGGGGGATGAAGGGAGGAAGG + Intronic
952490202 3:33863409-33863431 GGGTGGGGATGAAGAGAGGGTGG - Intronic
952696230 3:36267801-36267823 TTGGGAGTATGAAAGGAGGTGGG + Intergenic
952926854 3:38326607-38326629 TTGTGGGGAGTGAGGGAGGCAGG - Intergenic
953668763 3:44945105-44945127 TGGCGGGGATGGAGGGAGGCAGG + Intronic
954368854 3:50159858-50159880 TTGTGGGGGAGAAGGGAGACCGG + Intronic
954545723 3:51433064-51433086 TTGTGGGGATGAGATTAGGTTGG - Intronic
955879628 3:63529911-63529933 TGGTAGGGATGAGGGGATGTGGG + Intronic
956848644 3:73207379-73207401 CTGTGGAGATGAAGGGATTTGGG + Intergenic
957646765 3:82939971-82939993 TTGGGGGGGTGGGGGGAGGTTGG - Intergenic
959518928 3:107303800-107303822 TTCTAGGGATGAAGGAAGGAAGG + Intergenic
960384619 3:117007163-117007185 TTGTGGGGGTGGAGGGAGGGAGG - Intronic
960431607 3:117575968-117575990 TGGAGGGGATGAAGAGAAGTTGG - Intergenic
960619748 3:119626513-119626535 TTGTGGGGATGCTGTGAGGCTGG + Intronic
960846223 3:122006640-122006662 TGGTGGGGGTGAGGGGAGGCGGG + Intronic
960967804 3:123117013-123117035 TTGTGGGGGAGAAGAGAGCTGGG + Intronic
961221516 3:125204584-125204606 TTGGGGGGATGAAGAGAGGTTGG + Intronic
961636189 3:128334727-128334749 TTCTGGGGAAGGAGGGAGGGAGG - Intronic
961830030 3:129618640-129618662 TTGAGGAGAGGAAGGGAGGAGGG - Intergenic
961866999 3:129960805-129960827 CTGTTGGGATGATGGGAGCTTGG - Intergenic
962025118 3:131539689-131539711 GTGTGGGGAAGTGGGGAGGTGGG + Intronic
962650539 3:137484513-137484535 ATGGGTGGATGAAGAGAGGTTGG - Intergenic
962743315 3:138379156-138379178 GTGGGGGGATGAAGAGAAGTTGG - Intronic
962932886 3:140053817-140053839 TTGTGGAGATGGAGTGAGATGGG + Intronic
963818244 3:149857905-149857927 TTGTGGGGGTGTTGGAAGGTGGG + Intronic
963873617 3:150447587-150447609 GTGGGGGGATGAAGTGGGGTGGG - Intronic
964250656 3:154712213-154712235 TGGTGGGATTGAAGGGGGGTTGG + Intergenic
964284819 3:155106656-155106678 TTGGGGGGATGGTGGGAGGAGGG + Intronic
965340353 3:167483010-167483032 TTGTGTGGTAGAAGGGGGGTAGG + Intronic
965355620 3:167669493-167669515 TTGGGAGGATGGAGGGAGGAGGG + Intergenic
965373768 3:167896301-167896323 TTGTTGTGATGGAGAGAGGTGGG + Intergenic
965404535 3:168252845-168252867 TGGTGGGTATGGAGAGAGGTTGG + Intergenic
965525056 3:169707205-169707227 TCGTGGGGTTGAGGGGAGGAGGG + Intergenic
965668313 3:171119794-171119816 TTGTGGGGTTGGGGGGAGGGAGG + Intronic
965915135 3:173835923-173835945 TTGTGAGGATCAAGGGAAATAGG - Intronic
966018279 3:175171923-175171945 TTGGGGGGATAAAGAGAGGTTGG + Intronic
966029963 3:175333687-175333709 CCGGGGGGATGAAGAGAGGTTGG + Intronic
966109133 3:176375979-176376001 ATGTAGAGATGAAGGGAAGTAGG - Intergenic
966130586 3:176633687-176633709 CTGTGGGAATGCAGGAAGGTGGG + Intergenic
967013788 3:185463679-185463701 ACCTGGGGATGAAGGGAGGTGGG - Intronic
967110751 3:186291723-186291745 GTATGGGGATGAAGGGTGGGCGG + Intronic
967258548 3:187619010-187619032 TAGAGGGGAGGAAGGGAGGGAGG - Intergenic
967475235 3:189908819-189908841 ATGTGGGGAGGAAGTGAGTTAGG + Intergenic
967982391 3:195073478-195073500 TTGTGGGCATGAGGGGGGGAGGG - Intronic
968434302 4:576715-576737 TTATGGGGATGCAGGGAGAGGGG + Intergenic
969436982 4:7194008-7194030 TTGTGGGGGTGGGGGGAAGTGGG - Intronic
969661578 4:8532673-8532695 GGGTGGGGGTGAGGGGAGGTGGG + Intergenic
969699703 4:8761437-8761459 TTGTGGGGCTCCAGGGAGGGTGG - Intergenic
969862775 4:10050868-10050890 ATGTGGGGATGCCTGGAGGTGGG - Intronic
970169472 4:13275453-13275475 TTGTGGGAAAGATGGGAGATGGG - Intergenic
970558451 4:17259269-17259291 TTGTGGGGGTGGGGGGAGGGGGG - Intergenic
971052424 4:22876260-22876282 CAGTGGAGATGAAGAGAGGTGGG - Intergenic
971537553 4:27772526-27772548 TTGTGGGGTTGGGGGGAGGGGGG + Intergenic
972415713 4:38838595-38838617 GTGAGGGAATGAAGAGAGGTTGG + Intronic
973532435 4:51846145-51846167 TTTGGGGAATGGAGGGAGGTGGG - Intronic
973704991 4:53572286-53572308 TTCTGGGGAATGAGGGAGGTAGG + Intronic
974146659 4:57956281-57956303 TTTTGGGGATGAAGGAATGGTGG + Intergenic
974255297 4:59445586-59445608 TTTTGAGAAAGAAGGGAGGTGGG - Intergenic
974432524 4:61817113-61817135 TTGGGGGGCTGAAGGTAGCTTGG + Intronic
974859551 4:67502993-67503015 TTGAAGGGATGGAGGAAGGTTGG - Intronic
975656589 4:76647277-76647299 TGGTGGTGATGAAGAGATGTTGG + Intronic
975665628 4:76732267-76732289 TTGGGGGGAGGAGGGGAGGCTGG + Intronic
975808014 4:78133380-78133402 TAGTGGGGTGGGAGGGAGGTAGG + Intronic
975882410 4:78926120-78926142 TTTAGGGGGTGAAGGGAGGTTGG - Intronic
975985402 4:80197560-80197582 TTGGGGGGGTGGAGGGAGGGAGG - Intronic
976484861 4:85590244-85590266 ATGGAGGGATGGAGGGAGGTGGG - Intronic
977263119 4:94822250-94822272 TTGTGGTGGTGTTGGGAGGTGGG - Intronic
977969887 4:103200950-103200972 TTGTGGCAATGGAGAGAGGTAGG + Intergenic
978737211 4:112097500-112097522 AGGTGGGGAGGAAGGGAGGGAGG + Intergenic
978829387 4:113066179-113066201 TTGTGGGGCTGGGGGGAGGAGGG - Intronic
979512982 4:121575186-121575208 TTGTGGGGATGAACACATGTTGG - Intergenic
980101156 4:128542818-128542840 TTGTGTGGAAGCAGGGAGGCTGG - Intergenic
982653409 4:158116525-158116547 TGGGAGGGATGAAGAGAGGTTGG + Intergenic
983338445 4:166425843-166425865 TTGTGGGGATGAGGGTTGGATGG - Intergenic
983765152 4:171471062-171471084 TGGGAGGGATGAAGAGAGGTTGG - Intergenic
983851984 4:172592408-172592430 GTGTGGGGATGGTGGGAGGTAGG - Intronic
984199747 4:176703487-176703509 TGGGGGGAATGAAGAGAGGTTGG + Intronic
984401583 4:179272303-179272325 TGGTGGGGAGGCAGGGAGGCAGG + Intergenic
984720791 4:182970844-182970866 GAGTGGGGATGTAGGGAGGAAGG + Intergenic
985080839 4:186262420-186262442 TGGTGAGGACGAAGAGAGGTTGG - Intergenic
985141633 4:186845956-186845978 TGGTGGGGAGGTAGGGGGGTGGG - Intergenic
985239147 4:187911101-187911123 TTGTGGACAGGAACGGAGGTAGG + Intergenic
985705971 5:1401609-1401631 TTGTGGTGATGACGTGGGGTGGG - Intronic
988698067 5:33644001-33644023 TTATGGGGATAAAGGAAGGTTGG + Intronic
988820010 5:34873712-34873734 TTGTGGGTATCCAGGGATGTGGG - Intronic
989955501 5:50354775-50354797 TTGGGGGTATGAAGGTTGGTTGG - Intergenic
990241455 5:53820207-53820229 CTGAGGGGAGGAAGGGAGGGAGG + Intergenic
990461055 5:56031478-56031500 TGGTGAGGATTAAGAGAGGTTGG + Intergenic
990545016 5:56814684-56814706 TTGGGGCGAGGAAGGGAGGCGGG - Intergenic
990771819 5:59255399-59255421 CTGTGGGGTGGAAGGGAGGCAGG + Intronic
991021812 5:61987248-61987270 CTGTGGGGATTGAGGGAGATTGG + Intergenic
991278226 5:64877421-64877443 TGGGGGGGATGAAGAGAGATTGG + Intronic
992216512 5:74529514-74529536 GTGGGAGGATGAAGAGAGGTTGG + Intergenic
992525111 5:77602091-77602113 GGGTGGGGATGAAGAGAGGTTGG - Intronic
992674518 5:79092333-79092355 TTGTGGGGATTGAGGGAGGTGGG - Intronic
992874072 5:81034796-81034818 TTGTGGGGTGGGAGGGGGGTAGG + Intronic
992882890 5:81128128-81128150 TGGTGGGGAGGAAGGGAAGCGGG + Intronic
992970290 5:82049395-82049417 TTGTGGGGGTGGGGGGAGGGGGG + Intronic
993488434 5:88515554-88515576 ATGTGGTGATAATGGGAGGTGGG - Intergenic
993626576 5:90232204-90232226 GTGTGAGGATAAAGAGAGGTGGG + Intergenic
993816774 5:92558273-92558295 TAGTGGGGATGACGCCAGGTGGG + Intergenic
993845383 5:92935984-92936006 TCCTGGGTATGGAGGGAGGTAGG + Intergenic
994994036 5:107036853-107036875 CTGGGGGGATGAAGAGAGGTGGG + Intergenic
995306779 5:110660968-110660990 AAGTGGGGAAGAAGAGAGGTTGG - Intronic
996032456 5:118721226-118721248 TTGGGGGGAAGGAGGGAGGGGGG + Intergenic
996081816 5:119265912-119265934 TTGTGGGGATCAAGGGTGGGAGG + Intergenic
997417060 5:133737236-133737258 GTGGGGGGATTAGGGGAGGTGGG - Intergenic
998108425 5:139482905-139482927 TTGTGGGGATGATATTAGGTAGG + Intronic
998226832 5:140333577-140333599 TTGTGGGGATGAGGAGTGGAGGG + Exonic
998458029 5:142288847-142288869 TTGTGGAGAAGGAGGGAGGCTGG - Intergenic
999024894 5:148217584-148217606 TTGTGTGGAAGAAGGCTGGTAGG - Intergenic
999231572 5:150065144-150065166 TGGTGGGGAGGATGGGAGGAAGG - Intronic
999268806 5:150284487-150284509 AGGTGGGGAGGAAGGGAGGGAGG + Intronic
999408264 5:151326305-151326327 AGGTGGGGGTGAGGGGAGGTGGG - Intronic
999501116 5:152147720-152147742 ATCTGGGGATGAATGGATGTTGG + Intergenic
999675724 5:154000213-154000235 GGGTGGGGATGAAGAGAAGTTGG + Intronic
1000032515 5:157416482-157416504 GAGGGGGGATGAAGAGAGGTTGG + Intronic
1000602163 5:163287820-163287842 AGGAAGGGATGAAGGGAGGTGGG + Intergenic
1001125351 5:169014085-169014107 TTGTGGGAAGGAAGGCAGGCAGG + Intronic
1001686734 5:173598997-173599019 TTGTGGGGAGGCAGGAAGCTGGG + Intergenic
1001791116 5:174458648-174458670 GTGTGGGGAGGTAGGGAGGTGGG - Intergenic
1002111641 5:176918656-176918678 TAGTGGGGCTGAAGGGTGATTGG - Intronic
1002647827 5:180669909-180669931 TTGTGGGGATGGAATGAGGTTGG - Intergenic
1002792607 6:447065-447087 TTGTGTTTATGAAGTGAGGTGGG + Intergenic
1002978457 6:2110185-2110207 TTATGGGGGGGAAGGGCGGTTGG - Intronic
1003122437 6:3329158-3329180 TTGTGGGGGATGAGGGAGGTGGG - Intronic
1003860680 6:10319418-10319440 CCGTGGGGATGGAGGGATGTGGG + Intergenic
1003860777 6:10319750-10319772 CCGTGGGGATGGAGGGACGTGGG + Intergenic
1003860787 6:10319780-10319802 CCGTGGGGATGGAGGGACGTGGG + Intergenic
1004026691 6:11826367-11826389 TTAGGGGGATGAAGAGAGTTTGG - Intergenic
1004031596 6:11875488-11875510 TTGTGGGCTTGGAGGGAGGGCGG - Intergenic
1004586721 6:17009460-17009482 TTGGGGGGATGAAGAGAGTTTGG + Intergenic
1004842729 6:19605854-19605876 TTGTGGTGGTGTTGGGAGGTGGG - Intergenic
1005111359 6:22285352-22285374 TTGGGGGGGTGGGGGGAGGTTGG + Intergenic
1005602687 6:27443778-27443800 AAGTGGGGGTGGAGGGAGGTGGG - Intergenic
1005705770 6:28451241-28451263 GTGTGGGGGTGAAGAGAGGTTGG - Intergenic
1006513826 6:34535299-34535321 TGGTTGGGATGCAGGGGGGTAGG + Intergenic
1006820947 6:36894227-36894249 TAGTGTGGATGCTGGGAGGTGGG - Intronic
1007004090 6:38343585-38343607 TTGTGGTGATGGAGGGTTGTGGG - Intronic
1007044001 6:38753075-38753097 TGGTGGGGAGGAAGGGAGAGAGG - Intronic
1007107698 6:39294996-39295018 AAGTGTGGAGGAAGGGAGGTGGG - Intergenic
1007231017 6:40347857-40347879 CTGTGGGGAGGAGGGGAGGAGGG - Intergenic
1007515813 6:42410633-42410655 ATGTGGTGATGGAGGGAGGGGGG - Intronic
1008131652 6:47725921-47725943 TTCTGGGGATGAGGGGATGGTGG + Intergenic
1008140449 6:47825762-47825784 TTATGGGGAAGAAGGGAAGAAGG + Intronic
1009417114 6:63428197-63428219 TAGTAGGGAAGAAGGTAGGTTGG - Intergenic
1009522797 6:64705824-64705846 TTGTGGGGTGGGAGGGAGGGGGG + Intronic
1009673057 6:66781144-66781166 GTGGGGGGTTGAGGGGAGGTGGG + Intergenic
1009788173 6:68365089-68365111 TAGGGGGGGTGAAGAGAGGTTGG - Intergenic
1010584809 6:77644454-77644476 TTGAAGGGTTGAAGGGAGGGGGG + Intergenic
1010682238 6:78810322-78810344 TTGAGGGGATGATGGCAGGAGGG - Intergenic
1010957917 6:82112183-82112205 TGGGAGGGATGAAGAGAGGTTGG + Intergenic
1011067493 6:83343139-83343161 GTGGGAGGATGAAGAGAGGTTGG - Intronic
1011486963 6:87852836-87852858 TAAAGGGGAAGAAGGGAGGTGGG - Intergenic
1011657887 6:89567891-89567913 TTCTGGGGAGGACTGGAGGTTGG - Intronic
1012082178 6:94773866-94773888 TTGTGGGCATGGTAGGAGGTGGG - Intergenic
1012559611 6:100564341-100564363 TATGGGGGATGAAGAGAGGTGGG - Intronic
1012690614 6:102307049-102307071 TAGTGGGAATGAAGACAGGTTGG + Intergenic
1013195239 6:107838867-107838889 TTGGGAGGATGAAGGGAAGAAGG + Intergenic
1013214316 6:108013626-108013648 TCAGGGGGATGAAGAGAGGTTGG + Intergenic
1013585339 6:111573489-111573511 TTGCGGGGAAGAAGGGAGCGGGG - Intronic
1013970892 6:116017161-116017183 GTGTTGGGAGGTAGGGAGGTGGG - Intronic
1014416392 6:121190212-121190234 TGGTGGGGAGGAAAGGAGGGAGG - Intronic
1015743243 6:136481629-136481651 TGGTGGGGATGGAGGGAGTAGGG + Intronic
1016542052 6:145177587-145177609 TAGTGGGGGTAGAGGGAGGTGGG + Intergenic
1016660891 6:146578570-146578592 TTGTGGGGTTGTGGGGAGGGGGG - Intergenic
1016832826 6:148450020-148450042 GTGTGGTGATGTTGGGAGGTGGG - Intronic
1017008431 6:150044956-150044978 TTGTGGGGAGGAAGAGTGGGAGG - Intergenic
1017455397 6:154596970-154596992 TTGAGTGGCTGCAGGGAGGTAGG - Intergenic
1017553929 6:155542624-155542646 TTGTGGGGATGAAGAGGAATTGG + Intergenic
1018412111 6:163560487-163560509 TTGTGGGGATGGGGATAGGTAGG + Intronic
1018650030 6:165985840-165985862 GTGTGGGGAAGAAGGGAGGGTGG - Intronic
1019092723 6:169553020-169553042 GTGTGTGTATGCAGGGAGGTGGG + Intronic
1019092736 6:169553088-169553110 GTGTGTGTATGCAGGGAGGTGGG + Intronic
1019103571 6:169650737-169650759 TGGTGGGGATGGAGGGATGGAGG - Intronic
1019162325 6:170076858-170076880 CTGTGGGGAAGAAGAGAGGAGGG - Intergenic
1019190804 6:170249521-170249543 TTGTCGTGCTGAAGTGAGGTTGG + Intergenic
1019278628 7:188897-188919 TGGTGAGGACGAAGGGAGGTCGG - Intergenic
1019303096 7:318905-318927 GTTTGGGGTTGAAGGGAGGCAGG - Intergenic
1019492521 7:1321955-1321977 GTGTCGGGAGGAAGGGAGGTGGG + Intergenic
1020116381 7:5478635-5478657 CTGTGGGGTTGGAGGGAGGGAGG - Intronic
1020398681 7:7748523-7748545 TTGAGGGGATCAAGTGAGGAAGG + Intronic
1021104272 7:16618573-16618595 TTGGGGGGATTCGGGGAGGTGGG + Intronic
1021494004 7:21252450-21252472 ATGGAGTGATGAAGGGAGGTTGG + Intergenic
1023027052 7:36060331-36060353 TTGGGGGATTGAGGGGAGGTGGG + Intergenic
1023596010 7:41829982-41830004 TGGTGGCCAGGAAGGGAGGTAGG + Intergenic
1023855187 7:44178763-44178785 TTGTGGCCAGGAGGGGAGGTAGG - Intronic
1023855456 7:44180606-44180628 TTGTGGCCAGGAGGGGAGGTGGG + Intronic
1024062425 7:45709122-45709144 TTGTGAGTGTGAAGGGTGGTAGG + Intronic
1024349495 7:48349334-48349356 TTGAGGGGATGAAGGGCAGAAGG + Intronic
1024608282 7:51040695-51040717 TGGTGGGGAGGGAGGGAGTTCGG - Intronic
1025066490 7:55860391-55860413 GTGGGGGGATGAACAGAGGTTGG + Intronic
1025120908 7:56301340-56301362 TTGTGGGGATGAAGGTGGGATGG - Intergenic
1026390693 7:69898640-69898662 GGTTGGGGATGAGGGGAGGTGGG - Intronic
1026833102 7:73622028-73622050 TTGTTGGAAGGAAGGGAGGGAGG - Intronic
1027047166 7:74998688-74998710 TGGTGGGGGTGAAAGGAAGTTGG + Intronic
1028120290 7:87049849-87049871 ATGTGGTGATGTTGGGAGGTGGG + Intronic
1028169679 7:87581327-87581349 TTGTGGTGAAGACGGCAGGTGGG - Intronic
1028243782 7:88451926-88451948 ATGAGGGGAGGGAGGGAGGTGGG - Intergenic
1028320313 7:89451289-89451311 CTGGGGAGATGAAGGGAGGGAGG - Intergenic
1028399625 7:90410703-90410725 TTGTGGGGGTGGAAGGAGGAGGG + Intronic
1028531264 7:91841275-91841297 TGCTGGGGATGGAGGGAGGTGGG - Intronic
1029204152 7:98858925-98858947 TTGGGAGGAGGAAGGGAGGGAGG + Intronic
1029335780 7:99898119-99898141 TGGTGGTGCTGAAGGGAAGTGGG - Intronic
1029788406 7:102816758-102816780 ATGTGGGGAGGCAGGGAGGATGG - Intronic
1030149663 7:106390954-106390976 TTGGGGGGATAAAGGGAGATTGG + Intergenic
1030551384 7:110964864-110964886 TCGTGGTGAAGAAGGAAGGTCGG + Intronic
1030660591 7:112214684-112214706 TTCATGGGGTGAAGGGAGGTTGG + Intronic
1030856011 7:114558517-114558539 TTTTAGGGAAGAAGGGTGGTAGG - Intronic
1031144743 7:117985394-117985416 TTGTGGGGTTGCGGGGAGGGGGG + Intergenic
1031638292 7:124129339-124129361 GTGTGGGGAGGAGGGGAGGGGGG - Intergenic
1031894656 7:127335312-127335334 GTGGGGGAATGAAGTGAGGTTGG + Intergenic
1032169484 7:129572641-129572663 TAGTGGGGATGGAGAGATGTTGG + Intergenic
1032453095 7:132051592-132051614 TGGTGGGAATGAAGGGAAATAGG - Intergenic
1032547767 7:132757952-132757974 GTGTGGTGATGTTGGGAGGTGGG - Intergenic
1032703646 7:134403824-134403846 CTGTGGGGATGAAGAAATGTGGG + Intergenic
1033291984 7:140093352-140093374 TTGTGGGGGAGAAGGGAAGGAGG - Intronic
1034426536 7:151016992-151017014 TTGTGGGGGTGAAGGCAGAAGGG + Intronic
1035017243 7:155777389-155777411 TTGTGGGTATTGAGTGAGGTCGG - Exonic
1035409940 7:158631522-158631544 TTGTGGGAATGTGGGAAGGTGGG - Intronic
1035437064 7:158867196-158867218 TTGTGGGGTTGTAGGGTTGTGGG + Intronic
1035519901 8:267099-267121 GTGTGGGGATGTGGGGAGATGGG + Intergenic
1035796360 8:2360875-2360897 ATGTGGGGAGGAAGGAAGGATGG + Intergenic
1036043560 8:5113853-5113875 TCATGGAGATGAGGGGAGGTGGG - Intergenic
1036206061 8:6806383-6806405 GGGTGGGGATGGAGGGTGGTTGG + Intergenic
1036644059 8:10601234-10601256 AGGAGGGGAGGAAGGGAGGTAGG + Intergenic
1036681150 8:10875293-10875315 ATTTGGGGATGATGGTAGGTTGG + Intergenic
1036899512 8:12660233-12660255 CTGTGGGGATGGAGCGTGGTGGG + Intergenic
1036900576 8:12666380-12666402 CTGTGGGGATGGAGCGTGGTGGG + Intergenic
1037255931 8:16953556-16953578 GTGTGGGGATGAAAGGAGGTGGG + Intergenic
1037856376 8:22374183-22374205 TGGTGGGGTTGGGGGGAGGTTGG + Intronic
1038699354 8:29835517-29835539 GTGTGGGGAGGAGGGCAGGTAGG - Intergenic
1039418934 8:37419747-37419769 ATGTGGGGGTGAGGGGAGGGTGG - Intergenic
1039455288 8:37701883-37701905 TTGTTGGGAGGAAGGAAGGAAGG + Intergenic
1039458968 8:37727552-37727574 TTGGAGGAATGAAGGGGGGTGGG - Intergenic
1040011481 8:42664722-42664744 ATGGGGGGATGAAGAGAGGCTGG - Intergenic
1040015495 8:42696028-42696050 TTGTGGGAATGCAAGGAGGAAGG - Intergenic
1040362148 8:46676086-46676108 GTGGGGGAATGAAGAGAGGTTGG + Intergenic
1040771197 8:50977889-50977911 TTGTGGGGGTGTGGGGAGGGGGG + Intergenic
1040880400 8:52198923-52198945 TGGTGGGGCTGGAAGGAGGTGGG - Intronic
1040921419 8:52624016-52624038 TTGAGGGGTTGGAGGGATGTGGG + Intronic
1040985031 8:53284580-53284602 GTGGAGGGATGAAGAGAGGTTGG + Intergenic
1041030294 8:53729598-53729620 CTGTGGGGAGGAAGGGAGTGTGG + Intronic
1041577131 8:59411213-59411235 TTATGGGGAGCAAGGGAGGATGG + Intergenic
1041703387 8:60817362-60817384 TTTTGGAGATGAAGGAAAGTGGG + Intronic
1042571476 8:70170155-70170177 AGGTGGGGGTGACGGGAGGTAGG + Intronic
1042902747 8:73746025-73746047 TTGCCGGGGTGAAGGGAGTTGGG - Intronic
1043563071 8:81517689-81517711 TGGGGGTGATGAAGAGAGGTTGG - Intergenic
1043987747 8:86714505-86714527 TTGTGGAGAAGATGGGAGATAGG + Intronic
1044468260 8:92533578-92533600 TTAGGGGTATGATGGGAGGTTGG + Intergenic
1044645847 8:94442243-94442265 AGGTGGGGATTAAGAGAGGTTGG + Intronic
1045154995 8:99458061-99458083 TTGTGGGGTTGGGGGGAGGGGGG - Intronic
1045423432 8:102039730-102039752 GTGTGGTGATGTTGGGAGGTGGG + Intronic
1045550100 8:103163840-103163862 TTGTGGGAAGGAAGGAAGGAAGG - Intronic
1045826967 8:106409261-106409283 TTGTGGGGCCAAAGGGAGGATGG + Intronic
1046120858 8:109844981-109845003 GAGTGGAGATGAAGAGAGGTTGG - Intergenic
1046133827 8:110000813-110000835 GAGTGGGAATGAAGTGAGGTTGG - Intergenic
1047291576 8:123535754-123535776 TTGTGGGGGTTGAGGGAGTTAGG - Intronic
1047347293 8:124040522-124040544 TTGTGAGTATTAAGGGAGATGGG + Intronic
1047506764 8:125486335-125486357 ATGTGGGGATGTCGGGATGTCGG - Intergenic
1047594660 8:126366234-126366256 TTGTGGGGAAGAAGGGGGGAAGG + Intergenic
1047896743 8:129374646-129374668 TTGCAGGGATGAAGTCAGGTGGG - Intergenic
1047949713 8:129922198-129922220 TTGTTGGGATGATGACAGGTAGG - Intronic
1048695800 8:137026389-137026411 TTGTGGGGTTGGGGGGAGGGGGG + Intergenic
1049161011 8:141097640-141097662 GTGGGGGAATGAAGAGAGGTTGG - Intergenic
1049594700 8:143477959-143477981 CTGTGGGGAGGCAGGGAGCTGGG - Intronic
1049762430 8:144337332-144337354 TTGTGGGGAGGAACGTAGGGAGG + Intergenic
1049776476 8:144408184-144408206 TGGTGGGGATGGAGGGAGGTAGG - Intronic
1049865589 8:144933607-144933629 CTGTGGGCAGGAGGGGAGGTTGG - Intronic
1050221509 9:3396184-3396206 TTGTGGGGTGGAGGGGAGGGGGG - Intronic
1051330856 9:16023834-16023856 TTGTGGGGGTGGGGGGAGGGTGG - Intronic
1052393847 9:27913738-27913760 CTGTCGGGAGGAAGGGAGGAAGG - Intergenic
1053010234 9:34628798-34628820 TCGCGGGGATGGAGGGCGGTGGG + Intergenic
1055533307 9:77210134-77210156 GTGGGGGGAGGAAGGGAGGGAGG - Intronic
1055575169 9:77653947-77653969 TGGTGGGGATATAGGGAGATGGG - Intergenic
1056102068 9:83309186-83309208 TTGTGGGGGTGGGGGGAGGAGGG + Intronic
1056165468 9:83936891-83936913 TGGTGGGGAGGAACTGAGGTAGG - Intergenic
1056201981 9:84285759-84285781 TTGTGGGGAAGGAGGGGGATAGG + Intronic
1056306595 9:85296676-85296698 TGGTGGGGAGGAAGGAAGGAAGG - Intergenic
1056365842 9:85903840-85903862 TTCTGGGGATGAATGGATGTTGG + Intergenic
1056538812 9:87553873-87553895 TTGTGGGCAGAAAGGGAGGCAGG + Intronic
1056548535 9:87633266-87633288 ATGTAGGGATGAAGGGGGATGGG + Intronic
1056628540 9:88274032-88274054 GGGTGGGGATGGAGGGAGGCTGG + Intergenic
1056844327 9:90024492-90024514 TGGTTGGGAGGAAGGGAGGGGGG - Intergenic
1057702987 9:97376978-97377000 GTGGAGGGATGAAGGGAGGGAGG - Intronic
1057931293 9:99195872-99195894 TAGAGGGGATTAAGGGAAGTAGG - Intergenic
1058928651 9:109695877-109695899 TGGGGGTGATGAAGAGAGGTTGG + Intronic
1059188183 9:112296536-112296558 TTTTGGAGTTGTAGGGAGGTGGG - Intronic
1060298145 9:122356838-122356860 TGGAGGGGATGAAGGGACGCAGG + Intergenic
1060967035 9:127717235-127717257 TTGTGGGAAGCAAGGGAGCTGGG - Intronic
1060972317 9:127745219-127745241 CTCTGGTGATGCAGGGAGGTGGG - Intronic
1061091267 9:128427914-128427936 TGGTGGGGATCAGGAGAGGTGGG + Intronic
1062036606 9:134385321-134385343 TTGTGTGGCTGGAGGGAGGCTGG + Intronic
1062283932 9:135764790-135764812 GTGTGGGGACCAAGGGAGGAGGG - Intronic
1062588704 9:137263429-137263451 TTGGGGGGAAGGAGGGAGGGAGG - Intronic
1185920499 X:4086816-4086838 TTGTGGCAATGTTGGGAGGTGGG + Intergenic
1186137003 X:6532715-6532737 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186137024 X:6532789-6532811 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137045 X:6532848-6532870 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137056 X:6532878-6532900 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137068 X:6532911-6532933 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137087 X:6532970-6532992 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137106 X:6533029-6533051 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137118 X:6533062-6533084 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137129 X:6533092-6533114 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137141 X:6533125-6533147 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137152 X:6533155-6533177 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137164 X:6533188-6533210 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137176 X:6533221-6533243 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137187 X:6533251-6533273 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137198 X:6533281-6533303 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137218 X:6533343-6533365 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137240 X:6533405-6533427 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137252 X:6533438-6533460 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137263 X:6533468-6533490 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137275 X:6533501-6533523 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137287 X:6533534-6533556 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186137303 X:6533571-6533593 TGGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186267141 X:7844168-7844190 TGGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267155 X:7844205-7844227 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267177 X:7844267-7844289 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267199 X:7844329-7844351 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267211 X:7844362-7844384 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267222 X:7844392-7844414 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267234 X:7844425-7844447 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267245 X:7844455-7844477 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186267282 X:7844583-7844605 ATGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186297707 X:8169068-8169090 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186297738 X:8169171-8169193 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297750 X:8169204-8169226 GTGTGGGGAGGGAGGGAGGGGGG - Intergenic
1186297764 X:8169237-8169259 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297776 X:8169270-8169292 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297788 X:8169303-8169325 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297800 X:8169336-8169358 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297812 X:8169369-8169391 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297824 X:8169402-8169424 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297836 X:8169435-8169457 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297858 X:8169497-8169519 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297870 X:8169530-8169552 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297882 X:8169563-8169585 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297904 X:8169625-8169647 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297926 X:8169687-8169709 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297940 X:8169724-8169746 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297952 X:8169757-8169779 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297964 X:8169790-8169812 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186297978 X:8169827-8169849 GTGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186298004 X:8169897-8169919 TGGTGGGGAGGGAGGGAGGGAGG - Intergenic
1186324846 X:8466535-8466557 TGGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324882 X:8466630-8466652 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324955 X:8466838-8466860 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324967 X:8466871-8466893 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324978 X:8466901-8466923 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186324989 X:8466931-8466953 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325001 X:8466964-8466986 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325014 X:8466997-8467019 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325036 X:8467059-8467081 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325117 X:8467296-8467318 GTGTGGGGAGGGAGGGAGGGAGG + Intergenic
1186325152 X:8467403-8467425 GTGTGGGGAGGGAGGGAAGTGGG + Intergenic
1187481012 X:19655665-19655687 AAGTGGGGAGGAAGGGAGGGGGG + Intronic
1187894866 X:23971296-23971318 GTCGGGGGATGAAGAGAGGTTGG - Intergenic
1188106546 X:26154221-26154243 ATGTGGGGATGTGGGGATGTGGG + Intergenic
1188106549 X:26154229-26154251 ATGTGGGGATGTGGGGATGTGGG + Intergenic
1188106552 X:26154237-26154259 ATGTGGGGATGTGGGGATGTGGG + Intergenic
1188106555 X:26154245-26154267 ATGTGGGGATGTGGGGATGTGGG + Intergenic
1188287239 X:28342790-28342812 GTGTGGGGTTGGAGGTAGGTGGG - Intergenic
1188380621 X:29487337-29487359 TTGTAGAGATGAAAGAAGGTTGG - Intronic
1188434050 X:30140006-30140028 ATGTGAGGGTGAAGGGAGATCGG - Intergenic
1188862212 X:35271336-35271358 TTGTGGGGTTGGGGGGAGGGGGG + Intergenic
1189137280 X:38562306-38562328 GTGTAAGGATGCAGGGAGGTGGG - Intronic
1189323144 X:40098052-40098074 CTGTTGGGAGGGAGGGAGGTAGG - Intronic
1190055037 X:47176342-47176364 ATGGAGGGAAGAAGGGAGGTAGG - Intronic
1190063436 X:47224914-47224936 TGGTGGGGATGAAGGTCAGTGGG + Intronic
1190311031 X:49117171-49117193 TTGAGGGGAAGAAGTCAGGTAGG + Intronic
1192474931 X:71432200-71432222 TTGAGGGGATGAAGGCAGTTGGG + Intronic
1192560680 X:72126090-72126112 TTGTGGAGATGAAATGATGTTGG + Intergenic
1192626854 X:72737895-72737917 ATCTTGGGATGAAGGGAGGATGG - Intergenic
1192805531 X:74505461-74505483 TTGTCTGAAGGAAGGGAGGTAGG - Intronic
1193139734 X:78015232-78015254 TTGTGGGGAGGAGGGAAGGAAGG - Intronic
1193695115 X:84699220-84699242 TTGAGGGGAGGATGGGAGGCGGG - Intergenic
1193782602 X:85722205-85722227 CGGGGGGGATGAAGAGAGGTTGG - Intergenic
1193859787 X:86651213-86651235 TTGTGGGGCAGGAGAGAGGTGGG + Intronic
1194524129 X:94956624-94956646 GAGTGGGGATGAAGAGAGGCTGG + Intergenic
1194527273 X:94992123-94992145 TTGTTGGGAAGAGGTGAGGTGGG + Intergenic
1195000592 X:100639614-100639636 TGGTAGGGATGGAGGGAGGCTGG - Intronic
1195081140 X:101371973-101371995 TTGTGGGGAGGAGAGGAGTTAGG + Intronic
1195400902 X:104459912-104459934 GCGGGGGGATGAAGAGAGGTTGG + Intergenic
1195808080 X:108798051-108798073 TAGTGGGGATTGAGGGAGCTTGG - Intergenic
1196575227 X:117309312-117309334 TAGAGGGGATGAAGAGAGGTTGG + Intergenic
1196585965 X:117428384-117428406 ATGTGGGGATGAAGAGAGAAAGG - Intergenic
1196799078 X:119525892-119525914 TTTTGTGGATGATGAGAGGTAGG + Intergenic
1196828782 X:119760228-119760250 TTGTGGTTAGTAAGGGAGGTGGG - Intergenic
1197335125 X:125203552-125203574 ATCTGGGGCAGAAGGGAGGTCGG - Intergenic
1197555940 X:127953757-127953779 TTAGGGGGATAAAGAGAGGTTGG - Intergenic
1198171550 X:134110800-134110822 TTGTGGAGATGAAGAGAGGTTGG - Intergenic
1198427698 X:136536241-136536263 ATGTGGGGAGGGAGGGAGCTGGG + Intronic
1198931220 X:141862804-141862826 TTGGGGTGGTGAAGAGAGGTTGG + Intronic
1199325910 X:146497989-146498011 TTGGGGGGTTGGGGGGAGGTGGG + Intergenic
1199521651 X:148742154-148742176 TTGTGGGGATCATGGTGGGTGGG - Intronic
1199530769 X:148845067-148845089 TAATGGGGATGAAGTGAGGCAGG - Intronic
1199540072 X:148948822-148948844 TTGTGGGTCTGAAGTGGGGTTGG - Intronic
1199963745 X:152801038-152801060 GTGTGGGAAGGGAGGGAGGTGGG - Intergenic
1199963756 X:152801072-152801094 TGGTGGGGAGGGAGGGAGGAAGG - Intergenic
1201387881 Y:13463010-13463032 TTGTGGGGTTGGGGGGAGGGGGG - Intronic
1202098871 Y:21284533-21284555 GTGTGGGGTTGGAGGGAGGTGGG - Intergenic