ID: 1068299384

View in Genome Browser
Species Human (GRCh38)
Location 10:55118993-55119015
Sequence CCCATTGAACAGAGGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 202}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068299384_1068299388 -5 Left 1068299384 10:55118993-55119015 CCATGCTCCCTCTGTTCAATGGG 0: 1
1: 0
2: 0
3: 18
4: 202
Right 1068299388 10:55119011-55119033 ATGGGCAGCCAGTTCTCTCATGG No data
1068299384_1068299394 20 Left 1068299384 10:55118993-55119015 CCATGCTCCCTCTGTTCAATGGG 0: 1
1: 0
2: 0
3: 18
4: 202
Right 1068299394 10:55119036-55119058 CCTGCACCTGGCACGTCTCCTGG No data
1068299384_1068299389 -4 Left 1068299384 10:55118993-55119015 CCATGCTCCCTCTGTTCAATGGG 0: 1
1: 0
2: 0
3: 18
4: 202
Right 1068299389 10:55119012-55119034 TGGGCAGCCAGTTCTCTCATGGG No data
1068299384_1068299391 8 Left 1068299384 10:55118993-55119015 CCATGCTCCCTCTGTTCAATGGG 0: 1
1: 0
2: 0
3: 18
4: 202
Right 1068299391 10:55119024-55119046 TCTCTCATGGGCCCTGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068299384 Original CRISPR CCCATTGAACAGAGGGAGCA TGG (reversed) Intronic
900866191 1:5270198-5270220 CCCATTGAACTGTGGTAGGAAGG - Intergenic
902943864 1:19819886-19819908 TCCAGTGAACACAGGGAGCCAGG + Intergenic
903293031 1:22326614-22326636 CCCCTTGATTAGAGGAAGCAGGG + Intergenic
903338389 1:22639448-22639470 CCCATTTTACAGGCGGAGCATGG - Exonic
903780099 1:25815474-25815496 CCCATAGAAGAGAGGGCACAGGG + Intronic
904453394 1:30631453-30631475 CCCAATGAACAGAGAAAGAAAGG + Intergenic
905479401 1:38250722-38250744 TCCATTGGCCAAAGGGAGCATGG + Intergenic
905772616 1:40648151-40648173 CCCATTAATCAGAGGGAGGTTGG - Intronic
905813476 1:40930168-40930190 CTCATTGAACAGAGGCACCATGG + Intergenic
906249650 1:44301297-44301319 CCCAGTGCACAGTGGGGGCAGGG - Intronic
907556767 1:55350851-55350873 CCCATACAACAGAAGGATCATGG - Intergenic
908268325 1:62399659-62399681 CCCCTTGTACAGTGGGAGCCAGG - Intergenic
908294305 1:62698016-62698038 CTCTTGAAACAGAGGGAGCAGGG + Intergenic
908859143 1:68463724-68463746 CTGATTTAACAGAGGGAGGAGGG - Intergenic
910649692 1:89552725-89552747 CCTGGTGAACACAGGGAGCAGGG - Intronic
911537486 1:99117917-99117939 GCCATTGAACAGAGGGCGAACGG + Intergenic
912131095 1:106601391-106601413 CCTATAAAACATAGGGAGCAGGG + Intergenic
912528301 1:110301670-110301692 CCCATTGAACAGATGAGGGAAGG - Intergenic
915744180 1:158143393-158143415 CCCATAGAAGGGAGGCAGCAGGG + Intergenic
920037438 1:203075446-203075468 CCCTTTGGAAAGAGGGAGCGAGG - Intronic
920306368 1:205020667-205020689 CCCATTTGATGGAGGGAGCAGGG + Exonic
922062506 1:222105809-222105831 CACATTGAACACAGGGTGCCTGG - Intergenic
923284002 1:232473454-232473476 TCCATTAAACACAGGGTGCAGGG + Intronic
924910862 1:248511794-248511816 CCCACTGAAAACAGGGAGCCAGG + Intergenic
924913239 1:248536246-248536268 CCCACTGAAAACAGGGAGCCAGG - Intergenic
1062848703 10:727098-727120 CACAGTGGACAGAGGGAGCCTGG - Intergenic
1063121816 10:3109884-3109906 CCCATGGGGCAGAGGGGGCAGGG + Intronic
1063963302 10:11325108-11325130 CCCAGTAAACACAGGCAGCAAGG - Intronic
1064406581 10:15069564-15069586 CCCATGGAAAAGAGGCTGCATGG + Intronic
1065538155 10:26734549-26734571 CCCATTGAAAGGAGGGAAAAGGG + Intronic
1066435432 10:35393049-35393071 ACCAATGCGCAGAGGGAGCAGGG - Intronic
1066662591 10:37751660-37751682 ACCATTGAAGAGAAGTAGCAAGG - Intergenic
1068299384 10:55118993-55119015 CCCATTGAACAGAGGGAGCATGG - Intronic
1069606734 10:69743602-69743624 CCCACTGCACAGAAGCAGCATGG + Intergenic
1069619393 10:69827280-69827302 CCTACTGGACAGAGGGAGCCGGG - Intronic
1072275195 10:93815960-93815982 CACAGTGGAGAGAGGGAGCAAGG + Intergenic
1074572003 10:114632737-114632759 CCGATGAAACAGAGGGAGAAGGG - Intronic
1075454220 10:122574511-122574533 CCCATGGGCCAGAGGGAGAAGGG - Intronic
1076104693 10:127812152-127812174 CCCATTGCACTGAGGGCACAGGG - Intergenic
1076483760 10:130802485-130802507 CCCAGTAATAAGAGGGAGCACGG - Intergenic
1077058868 11:609069-609091 CCCCTTGCACAGGGGGAGCCAGG + Exonic
1078265038 11:9748919-9748941 CCCATTGTACAGAGTGAAAACGG - Intronic
1078937312 11:15963307-15963329 CCCAGTGAAGAGAGTGATCAGGG - Intergenic
1079312950 11:19382227-19382249 CCCATTGTACACTGGGAACATGG - Intronic
1081031970 11:38096185-38096207 TTCATTGAACAGAGGGATAAAGG + Intergenic
1081280953 11:41208892-41208914 CCCACAGAACTGAGGGTGCAGGG + Intronic
1081452989 11:43191191-43191213 CCCACTGATAAGAGAGAGCATGG + Intergenic
1081674134 11:44958538-44958560 CCCAGGGGACAGAAGGAGCACGG - Intergenic
1082219844 11:49621379-49621401 GCCATTTAAAAGAGAGAGCAGGG - Intergenic
1084426954 11:69089357-69089379 CCCAAAGCACAGAGGGTGCAGGG - Intronic
1086092779 11:83020741-83020763 ACCACGGAACAGAGGGAGGATGG + Intronic
1086629786 11:89003398-89003420 GCCATTTAAAAGAGAGAGCAGGG + Intronic
1087088354 11:94242663-94242685 CCCACAGGACAGAGGGAACATGG - Intergenic
1087649129 11:100844207-100844229 CCCATTGAACAAATGGTGCTGGG + Intronic
1089268841 11:117287277-117287299 GCCAGTGGACAGAGGGAGAAGGG - Exonic
1089604501 11:119634117-119634139 CCCATTGCACAGAAGCAGCCTGG - Intronic
1094115426 12:26906800-26906822 CTCATTGGAGAGAGTGAGCATGG - Intronic
1095531421 12:43190684-43190706 CCCTTTGACCAGAGGAAGCCCGG - Intergenic
1095894403 12:47265964-47265986 CCCATAGATAAGAGGGAGAAAGG + Intergenic
1095977599 12:47950264-47950286 CCAAGAGGACAGAGGGAGCAAGG + Intergenic
1096536079 12:52275691-52275713 CCCATTTCACAGATGGAGAAAGG + Intronic
1100402451 12:94244399-94244421 CCCATTGCACAGAGAGAGTTGGG + Intronic
1102426172 12:112846043-112846065 CCTAGTGACCAGGGGGAGCAAGG + Intronic
1102455346 12:113067313-113067335 CCCCTAGAACAGAGGAAGCTGGG - Intronic
1103345285 12:120245169-120245191 CCCATGGAGCAGAGGAGGCAGGG + Intronic
1108481593 13:50877895-50877917 CCCACTGAGCACAGGAAGCAAGG - Intergenic
1109730382 13:66405571-66405593 CCCCTTGATCTGAGGGAGCAAGG + Intronic
1110041320 13:70762748-70762770 ACCATTGAACAGAGCTAGAATGG - Intergenic
1114531084 14:23396917-23396939 CTCATAGAACAGGGGGAGCCAGG - Intronic
1114536439 14:23425918-23425940 CTCATAGAACAGGGGGAGCCAGG - Intronic
1115961397 14:38838302-38838324 CCCAGGGAACACAGGGAGGATGG + Intergenic
1117814445 14:59582622-59582644 CCCATTGTACAGATGAAGAATGG - Intergenic
1118395766 14:65335138-65335160 CTCCTTGAACAGGAGGAGCAAGG - Intergenic
1118850176 14:69577071-69577093 CCCATGGGACACATGGAGCAAGG - Intergenic
1119411143 14:74431308-74431330 CCCTTTACACAGAGGGAGAAAGG - Intergenic
1119654943 14:76410553-76410575 CCCATTTTACAGATGGAGAATGG + Intronic
1122014159 14:98779314-98779336 GCCAGTGACCAGAAGGAGCATGG - Intergenic
1123907344 15:24933761-24933783 CCCATTGAGTAGAGGGTACATGG + Intronic
1127054804 15:55120722-55120744 CAAATGAAACAGAGGGAGCAAGG - Intergenic
1127960535 15:63887187-63887209 CCTGTTAAAAAGAGGGAGCAGGG - Intergenic
1135954999 16:26949083-26949105 CATATGGAATAGAGGGAGCAAGG - Intergenic
1137004065 16:35255869-35255891 CCCAGTGAACAGTGCGGGCAGGG - Intergenic
1137013247 16:35344761-35344783 CCCAGTGAACAGTGTGGGCAGGG - Intergenic
1138442115 16:57041430-57041452 CCCACTGAACAGAGGCGGGAAGG - Intronic
1138580949 16:57940103-57940125 CCCGCAGGACAGAGGGAGCAGGG - Intronic
1138748729 16:59393895-59393917 GGCATTGAAGAGGGGGAGCAAGG - Intergenic
1139308826 16:66011196-66011218 CCCAGGAAACAGAGGGAGCATGG - Intergenic
1139412649 16:66776676-66776698 TAGATTGAACAGAGGGAGAATGG + Intronic
1140204691 16:72924263-72924285 CCTGTTTAACAGAGGGAGCTGGG - Intronic
1140748970 16:78006149-78006171 CACTTTGAAAGGAGGGAGCAGGG - Intergenic
1140976475 16:80064508-80064530 CCCATTGAAAAAAGGGGGGAAGG - Intergenic
1141096433 16:81166195-81166217 CCCATTGGACAGATGGGGGATGG + Intergenic
1142426687 16:90005383-90005405 CCCCCAGAGCAGAGGGAGCAGGG + Exonic
1144614752 17:16758524-16758546 CCTATTGAACAGAGAGAAAATGG + Intronic
1144897952 17:18557150-18557172 CCTATTGAACAGAGAGAAAATGG - Intergenic
1145134417 17:20388564-20388586 CCTATTGAACAGAGAGAAAATGG + Intergenic
1145916454 17:28576876-28576898 CTCATTTACCAGAGGGAGCCAGG - Exonic
1146541874 17:33703185-33703207 CGCCTAGAACAGAGTGAGCAAGG + Intronic
1146907749 17:36628972-36628994 CCCATGAAACAGATTGAGCAAGG + Intergenic
1147155069 17:38540508-38540530 CCCATTGTACAGACGAAGAAAGG + Intronic
1148207609 17:45789158-45789180 CTCAGTGAAAAGAGGGAGTAGGG + Intronic
1149202157 17:54199430-54199452 TCCAGTGGACAGAGGGAGAATGG - Intergenic
1155085912 18:22457801-22457823 CCCAGTGAACACAGGGTGCCGGG - Intergenic
1156627144 18:38922837-38922859 CCCAATAAACAGAAAGAGCATGG - Intergenic
1160353243 18:78203355-78203377 CCCTGTGGACAGAGTGAGCAGGG - Intergenic
1161966778 19:7553507-7553529 CCCATTAGACAGAGGAACCAAGG + Intronic
1162851966 19:13437885-13437907 CCCAGTGGACAGAGGGAGCCAGG + Intronic
1164516837 19:28943862-28943884 TACAATGCACAGAGGGAGCAGGG - Intergenic
1167131053 19:47586187-47586209 CCAATTGCACAGAGACAGCAGGG - Intergenic
925121548 2:1422178-1422200 CCAATGGAACAGACGGAGCAGGG + Intronic
926089739 2:10042542-10042564 CGCAGTGAACAGACGGAGGAGGG + Intergenic
929142395 2:38677622-38677644 CACAGTGAACAGGGGGAGCAGGG - Intronic
932429755 2:71667292-71667314 CCCAGTGAACAGGCTGAGCAGGG - Intronic
932844243 2:75119078-75119100 CTCATGGAACAGATGCAGCAGGG + Intronic
933004085 2:76967864-76967886 CCCATTAGCCAGAGGGAGAATGG - Intronic
933164419 2:79060284-79060306 ACCATTGAAGAGAGGGATAATGG + Intergenic
933467075 2:82666055-82666077 CCTAGTTAACAAAGGGAGCAAGG - Intergenic
935182178 2:100701143-100701165 CCCAATGAAGAGAAGGATCAAGG - Intergenic
937299566 2:120830759-120830781 CCCAGAAAACAGAGGGAACATGG - Intronic
938232741 2:129675578-129675600 CCCAGTGAACAGAGAGAGGAAGG - Intergenic
939814216 2:146874108-146874130 CTCAGTGTACAGATGGAGCAAGG - Intergenic
940936397 2:159500250-159500272 CCTATTTAACAGAGGGTGCTGGG - Intronic
941610654 2:167657462-167657484 CCCACAGTACAGAGGGAACAGGG + Intergenic
942625555 2:177896558-177896580 CCCATTAAACAAAGGCAGGAAGG - Intronic
944511807 2:200472877-200472899 CGCATTCAGCAGAGGCAGCAGGG - Exonic
946924871 2:224616567-224616589 TGCACTGAACAGAGGGAGTAGGG - Intergenic
947064394 2:226205532-226205554 TTCATGGAACAGAGGGAGAAAGG + Intergenic
948262243 2:236613018-236613040 CACATGGAGCAGAGGGAGGAGGG - Intergenic
1169348242 20:4846939-4846961 CCCATTGCTCACATGGAGCAAGG + Intergenic
1170153501 20:13249273-13249295 CCCATTTCACAGATGGAACAGGG + Intronic
1171437524 20:25134809-25134831 CCCATGGAACACGGGGTGCAAGG + Intergenic
1172615323 20:36279628-36279650 CCCACTGGGCACAGGGAGCAGGG - Intergenic
1172931382 20:38588560-38588582 CCCATTGAACAGATGGAAGAGGG - Intergenic
1173965495 20:47109526-47109548 ACCATAGCACAGAGGGAGAAAGG - Intronic
1178356001 21:31911259-31911281 CCCACAGAACTGAGTGAGCATGG - Intronic
1180876273 22:19176653-19176675 CCCAGTGATCAGAGGGTTCATGG + Exonic
1182996149 22:34814260-34814282 CCCACTGAACAGAGGGATAAAGG - Intergenic
1183044434 22:35208371-35208393 CCCTTTGTAGAGAGGGACCAAGG + Intergenic
1183074176 22:35416286-35416308 CCTACTGAAGTGAGGGAGCAGGG - Intronic
1183198244 22:36368146-36368168 CCCATTGTACAGATGAAGAAAGG - Intronic
1183319430 22:37156059-37156081 TCCAGTGAGCAGAGGGAGGACGG - Intronic
1183739068 22:39660125-39660147 CTCAGAGAACGGAGGGAGCAGGG - Intronic
1184308475 22:43625492-43625514 CCCATCCAACAGTGGCAGCAGGG - Intronic
951009439 3:17659081-17659103 ACCATTGTACAGAGGGGGAAGGG + Intronic
952803045 3:37315453-37315475 CCCAAAAAACAGAGGAAGCACGG + Exonic
953719478 3:45342963-45342985 CCCATTCAAGAGAGAGAACATGG - Intergenic
958472453 3:94537917-94537939 CCCATTTAAAAGAGGGATCATGG + Intergenic
961041229 3:123679876-123679898 CACACTTAACAGAGGCAGCAGGG + Intronic
961623207 3:128240682-128240704 CCCATTCTGCAGAGAGAGCAAGG - Intronic
964433859 3:156632341-156632363 CCCATTTTACAGAGGAAGAAAGG - Intergenic
966119409 3:176505927-176505949 TCCCTTGTACAGAGGGAGGAGGG + Intergenic
968190376 3:196662900-196662922 GTCATTGAACAGAGGGAGAAGGG - Intronic
968730681 4:2267931-2267953 CCCCTTGGACACAGGGAGCTTGG + Intergenic
970675236 4:18441369-18441391 ACCAGTGATCAGAGGGAGGAGGG + Intergenic
972319728 4:37962424-37962446 TCCATTAAACAGAGGAAGCAGGG - Intronic
972682384 4:41318806-41318828 CACATTGAGCAGAGAGAGCTGGG - Intergenic
974831839 4:67199431-67199453 CCCATTGAACATAGGAAGGATGG - Intergenic
979745747 4:124211003-124211025 CACATTGAAGAGATGGAGAAAGG + Intergenic
980188720 4:129495673-129495695 ACCAATGAACAGAGGGACCAGGG - Intergenic
981829283 4:148981542-148981564 TCCATTGGACAGAGGGAGTAGGG + Intergenic
982639911 4:157945370-157945392 CCCAGTAAACAGAGTGACCAGGG + Intergenic
984448837 4:179873019-179873041 CCAATTGAATATAGGGAGTAAGG + Intergenic
985952816 5:3236460-3236482 CTCTTTGAACAGAGGAGGCAAGG - Intergenic
986049858 5:4079442-4079464 ACCAAGGAACAGAGGGAGAAGGG - Intergenic
986634597 5:9808904-9808926 CCCATGGAGCAGGAGGAGCAGGG + Intergenic
987850002 5:23339534-23339556 CCCATTAAAAAGAGGGGGCCAGG - Intergenic
994926361 5:106121664-106121686 CACATGCAAGAGAGGGAGCAAGG + Intergenic
995991678 5:118247414-118247436 GCCCTTGAACAGCTGGAGCACGG + Intergenic
997175655 5:131773943-131773965 GGCATTAAAAAGAGGGAGCAGGG + Intronic
997303154 5:132821019-132821041 CCCTTTGAACACAGTGGGCAGGG - Intergenic
997665543 5:135627147-135627169 CCCATGGGGCAGAGAGAGCAGGG - Intergenic
997852244 5:137343436-137343458 CCCATTCAACAGTGGAAGAAGGG + Intronic
998620428 5:143788634-143788656 CTCATTAAACAGAGAAAGCAAGG - Intergenic
999111438 5:149124976-149124998 CTGATTGAACAGAGTGAGCTGGG + Intergenic
999335330 5:150711210-150711232 CCCATTGAAGAAAGTGACCAGGG - Exonic
1003401472 6:5794588-5794610 CCCCTGGAGCAGAGGGACCAGGG + Intergenic
1005192233 6:23238175-23238197 CCCATTTATGAGAGGCAGCAAGG + Intergenic
1010136114 6:72555255-72555277 CCGACTGAAGAGAGGGAGAAAGG - Intergenic
1012988311 6:105898563-105898585 CCCAATGTACTGAGGGAGGATGG + Intergenic
1013267179 6:108511367-108511389 CCCATTCATCAAAGGCAGCATGG + Intronic
1013282136 6:108648445-108648467 ACCATTAATCAAAGGGAGCAGGG - Intronic
1013656542 6:112252824-112252846 TCCATGAAAAAGAGGGAGCATGG - Intronic
1017321374 6:153097932-153097954 CCTATTGAACAGTGGTAGAAAGG - Intronic
1017869468 6:158474555-158474577 CTTTTTGAAGAGAGGGAGCAGGG - Intronic
1018524229 6:164689943-164689965 CCAATTAAATAGAGGGAGAAAGG - Intergenic
1018799432 6:167210707-167210729 CCAAGTGGGCAGAGGGAGCAGGG + Intergenic
1019109492 6:169698487-169698509 CCCATTGAACAGAGGTCAGATGG + Intronic
1019501417 7:1366706-1366728 CCCATTCTACAGAGGAAGAACGG + Intergenic
1021340545 7:19458114-19458136 GCCAAGGATCAGAGGGAGCATGG + Intergenic
1023125056 7:36947116-36947138 CCCAAAGCAGAGAGGGAGCAGGG - Intronic
1024608194 7:51039919-51039941 ACAGTTGGACAGAGGGAGCAGGG + Intronic
1030151033 7:106405103-106405125 GACAGTGAAGAGAGGGAGCAAGG + Intergenic
1032847697 7:135765927-135765949 CATATTGGACAGAGGGAGAAAGG + Intergenic
1033351204 7:140563585-140563607 GCCTTTCTACAGAGGGAGCAAGG + Intronic
1034513959 7:151559168-151559190 AACATTGAACAGAGGGAGCCAGG - Intronic
1034539164 7:151745084-151745106 CCCATGGAGCAGAGGCAGCCTGG - Intronic
1035901087 8:3459254-3459276 CTCATGGACCAGAGTGAGCAGGG + Intronic
1038675165 8:29616498-29616520 TCCTTTGAAGACAGGGAGCAAGG - Intergenic
1042369144 8:67971042-67971064 CCCATTGAAGAGTAGGTGCAGGG + Intronic
1042614534 8:70633850-70633872 CCCATTGAACAGAGGCAGTGGGG - Intronic
1045635289 8:104179129-104179151 GTCATTGAACATAGGGAGCCTGG + Intronic
1046518078 8:115289026-115289048 CCCATTTTACATAGGGAGGAGGG + Intergenic
1047089414 8:121557125-121557147 ACTATTGACCAGAGTGAGCAAGG + Intergenic
1049243508 8:141550361-141550383 CACATGCAGCAGAGGGAGCAGGG + Intergenic
1049283988 8:141764648-141764670 CCCAGTGAACAAGGGGAGCCAGG + Intergenic
1049426470 8:142540134-142540156 CTAAATGACCAGAGGGAGCATGG - Intronic
1051361672 9:16286443-16286465 CCCACTGAGCAGAGGGACCGAGG + Intergenic
1054732140 9:68712212-68712234 TCCATGTAAAAGAGGGAGCAAGG - Intronic
1055373434 9:75624566-75624588 CCCAGTGAAAAGTGGGAGCTGGG + Intergenic
1057026780 9:91740133-91740155 CCCACAGGACAGAGAGAGCAAGG + Intronic
1057350465 9:94292997-94293019 CTCATCGAACAGCTGGAGCAAGG + Exonic
1058551190 9:106116662-106116684 CCCATTGCACAGATGAAGGATGG + Intergenic
1059283582 9:113154433-113154455 CAGTTTGAACAGAGGCAGCAAGG - Intronic
1061806720 9:133141046-133141068 CCCATTTGACAGATGGGGCAAGG + Intronic
1186389147 X:9141168-9141190 CACTTTGAAAAGAGGGAGGAAGG + Intronic
1189067639 X:37827940-37827962 CCCAATCAATAGAGGGAGCTGGG + Intronic
1189887621 X:45564311-45564333 CCCATTGATGACATGGAGCAGGG - Intergenic
1190715062 X:53096136-53096158 ACCATGGAACAGACAGAGCAGGG - Intergenic
1190732809 X:53235955-53235977 CCCATTGAAGAGGGGGAGGCGGG + Intronic
1195755965 X:108198933-108198955 TCCCTTGAACAGAGGGCACATGG + Intronic
1195918982 X:109963752-109963774 CCATCTGAACAGAAGGAGCAGGG - Intergenic