ID: 1068300736

View in Genome Browser
Species Human (GRCh38)
Location 10:55135431-55135453
Sequence TTGTGTTTAGGGAGTGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 1, 2: 5, 3: 25, 4: 262}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068300736 Original CRISPR TTGTGTTTAGGGAGTGGAGC TGG (reversed) Intronic
900273465 1:1807288-1807310 TTGTGTTTTTGTAGTGGAGACGG - Intronic
900379579 1:2377232-2377254 CTGTGTTTTGGGTGTGGACCTGG - Intronic
900914840 1:5629558-5629580 CTGTGATGATGGAGTGGAGCTGG + Intergenic
901053500 1:6437714-6437736 CTGTGTCTAGGGAGTGGGGAGGG + Intronic
902391572 1:16110067-16110089 TGGTGGTTAGGGAGTGAACCTGG + Intergenic
902480782 1:16710451-16710473 CTGTGTCTAGGGAGTGGGGAGGG - Intergenic
902798385 1:18814515-18814537 TTGGGGTTAGGGAGGGGAGTAGG - Intergenic
903387328 1:22936025-22936047 TTGTGGTTGGAGAGGGGAGCGGG - Intergenic
904030872 1:27532700-27532722 CTGTGTTTAGGGAGGGGAGAGGG - Intergenic
905775119 1:40663399-40663421 TTGTGGCTGGGGAGTGGGGCAGG + Intronic
905953687 1:41974472-41974494 GTGTGTGTAGGGGGTGGAGTGGG - Intronic
906690928 1:47792384-47792406 TTGTGGTCAGTGAGTGGTGCTGG - Intronic
907609299 1:55851779-55851801 TTGTGTTTTCAGAGTGGAGGTGG - Intergenic
908761442 1:67515982-67516004 AATTGTTTAGGGAGTGGAACAGG + Intergenic
911737977 1:101358271-101358293 TTGCGTTTAGGAAGTAGAGAGGG + Intergenic
912473557 1:109922259-109922281 TTGAGATTAGGGAGTGGAAATGG + Intronic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
912740974 1:112197164-112197186 TGGTGATTATGGAGTGGGGCTGG + Intergenic
914675811 1:149906508-149906530 TTCTGTTTAGGGGGTGCTGCAGG - Intronic
915882674 1:159688771-159688793 TTGTTTTTTGAGAGAGGAGCTGG - Intergenic
917148013 1:171913595-171913617 TTGTGTTCAGGGTGTGGAACTGG + Intronic
917635098 1:176928263-176928285 TTGCCTCTAGGGAGTGGAACAGG + Intronic
917745489 1:178002856-178002878 TTGGGTTTTGGCAGTGGAGATGG - Intergenic
919352522 1:196476632-196476654 TTGTCTTTTGGGAGTGCAGAAGG - Intronic
919359712 1:196577201-196577223 TGTTGTTTTGGGAGTGGAGTAGG - Intronic
919518817 1:198561626-198561648 TTTTCTCTAGGGAGTGGAGGAGG - Intergenic
920154927 1:203940858-203940880 TTGTGTTTAGGAAGTGTGTCTGG - Intergenic
920677255 1:208046836-208046858 GTGTGTGTAGAGTGTGGAGCAGG + Intronic
920808951 1:209264301-209264323 TTTTTTTTAGGGTGTGGGGCAGG - Intergenic
921498552 1:215871166-215871188 TGCTGTTTGGGGAGTGGAGGAGG - Intronic
922750805 1:228069251-228069273 TAGTGTAGAGGGAGTGTAGCGGG + Intergenic
923057580 1:230438771-230438793 TTGTGTTTTGTGAGTGAAGTTGG + Intergenic
923676624 1:236086167-236086189 TGGTGTTTGGGGAGTGGGGAGGG + Intergenic
1063690781 10:8285072-8285094 TTGTGCTGGGGCAGTGGAGCTGG - Intergenic
1068300736 10:55135431-55135453 TTGTGTTTAGGGAGTGGAGCTGG - Intronic
1068358437 10:55942828-55942850 GTGTGGGTAGGGAGTGGGGCAGG + Intergenic
1069088742 10:64173841-64173863 TTCTGTTTAGGGATTGTATCTGG - Intergenic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1069902485 10:71713961-71713983 TTGGGTTTAGAAAGTGGGGCAGG - Exonic
1070446965 10:76514572-76514594 TTGTGCTTAGGGAGTAGTGTTGG + Intronic
1072889147 10:99306397-99306419 TTGTGGATAGAGGGTGGAGCTGG - Intergenic
1073997036 10:109327386-109327408 TTGTATTTAGGGAGAGGAGGAGG - Intergenic
1074447601 10:113533322-113533344 GTGTGTTTAAGGAATGGAGAGGG + Intergenic
1074770380 10:116729864-116729886 TTGATATTAGGGAGTGGAGCTGG - Intronic
1075005010 10:118823809-118823831 CTGTGTTTATGGAGAGGGGCTGG + Intergenic
1077919452 11:6631882-6631904 TGGTGTTTGGGGAGTGGGGGAGG + Intronic
1078008819 11:7554148-7554170 TTGTGTTTTGGCAGTGGTGGTGG - Intronic
1078075324 11:8154379-8154401 TTGTGTATAGGCAGTGGTGACGG + Intronic
1080034559 11:27699216-27699238 TTGTGTGTTGGGGGTAGAGCGGG - Intronic
1080037044 11:27720995-27721017 TTGGGGTTAGGGGGTGGAGTGGG - Intronic
1081392226 11:42542408-42542430 TGCTGTTTAGGCAGTGCAGCTGG - Intergenic
1083904367 11:65660454-65660476 CTGTGTTTAGAGAGTGGAAAAGG - Intronic
1085793973 11:79520075-79520097 TTGTGGTTTGGGGGTGGAACGGG + Intergenic
1088279561 11:108122292-108122314 TTGTGTTTAGGGAACACAGCAGG + Intronic
1089478903 11:118790247-118790269 GTGTGTTTGGGGCGTGGGGCGGG - Intronic
1090200970 11:124855933-124855955 TTGAATTTAGGGAGTTGAGGAGG - Intergenic
1091999025 12:5017937-5017959 TTGTGTGTAGGGGCTGGGGCTGG + Intergenic
1092046630 12:5435536-5435558 TTGTGTATTGGGAAGGGAGCTGG + Intronic
1094286442 12:28799371-28799393 ATGTGTCTTGGGAGTGGAGCGGG + Intergenic
1096196181 12:49650224-49650246 TTTAGTGTAGGGAGAGGAGCAGG - Intronic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1102180504 12:110909137-110909159 ATGTGGTGACGGAGTGGAGCTGG - Intergenic
1103941977 12:124506166-124506188 TTGTGTTTGGTGAATGGAACTGG - Intronic
1104250219 12:127086180-127086202 GAGTGTTTAGGAAGTGGAGGAGG - Intergenic
1105428477 13:20315880-20315902 TTGAGCTAAGGTAGTGGAGCGGG + Intergenic
1106121773 13:26865677-26865699 CTGTGTTGAGGCACTGGAGCAGG - Intergenic
1106412076 13:29517506-29517528 TGGTTTCTAGGCAGTGGAGCTGG - Intronic
1106485855 13:30171937-30171959 TGGTGGTTAGAGAGTAGAGCCGG + Intergenic
1107665855 13:42689777-42689799 TTGTGGTTAGGGGCTGGGGCTGG + Intergenic
1108721697 13:53139091-53139113 AGGTCTTCAGGGAGTGGAGCCGG + Intergenic
1114974477 14:28077306-28077328 TTGTGGTTAGGGGATGGATCTGG - Intergenic
1115634796 14:35280991-35281013 TTGGGTTAAAGGAGTGGGGCAGG - Intronic
1118461693 14:65993271-65993293 TTGTGGTTAGTGGGTGGGGCTGG + Intronic
1118814191 14:69298342-69298364 TTGTAGATAGGGAGTGGAGTGGG + Intronic
1119199769 14:72743738-72743760 TTGTGAAGGGGGAGTGGAGCTGG - Intronic
1123128674 14:105968390-105968412 ATCTGTTTAGGGGGTGGGGCAGG + Intergenic
1124395038 15:29293803-29293825 TGGTGTGCAGGCAGTGGAGCGGG - Intronic
1124636600 15:31368909-31368931 TGCTGTCTAGGGAGTGGGGCTGG - Intronic
1125622173 15:41073266-41073288 CTGTGTGTAGGGGGTGGAGCTGG - Intronic
1126078604 15:44937241-44937263 TTGTCTCTTGGGAGGGGAGCTGG - Intergenic
1126079244 15:44943084-44943106 TTGTCTCTTGGGAGGGGAGCTGG + Intergenic
1127465008 15:59235299-59235321 TTGTCTTGAGGGAGGGGAGCTGG - Intronic
1129833772 15:78688616-78688638 TTGTCTCTTGGGAGGGGAGCTGG - Intronic
1131077325 15:89503488-89503510 CTGTGTTGAGGGCGTGGTGCTGG + Intergenic
1135250940 16:20900591-20900613 TTGTTTTACGGGAATGGAGCGGG + Intronic
1136146995 16:28321697-28321719 TTGTGGTTAGGGGGAGGGGCGGG - Exonic
1136282940 16:29224558-29224580 TTGTGTTCAGGAGGTGGAGGAGG + Intergenic
1136871606 16:33812480-33812502 ATCTGTTTAGGGGGTGGGGCAGG - Intergenic
1138426800 16:56939968-56939990 TTGTGAATAGGGGCTGGAGCAGG - Exonic
1138513460 16:57522240-57522262 TTGTTTTTAGAGAGAGGATCTGG + Intronic
1138673453 16:58633746-58633768 TTGTCTGTAGGGAGAGGAGTGGG + Intergenic
1139038758 16:62979157-62979179 TTGTGTTTAGGGAGTGGAGTAGG - Intergenic
1139492674 16:67294850-67294872 TGGGGTTGAGGGAGTGAAGCAGG - Intronic
1141869199 16:86773092-86773114 CTGCGTTTTGGGAGAGGAGCAGG + Intergenic
1142087316 16:88190459-88190481 TTGTGTTCAGGAGGTGGAGGAGG + Intergenic
1142342442 16:89532335-89532357 CTGTTTGTAGGGAATGGAGCTGG + Intronic
1203100566 16_KI270728v1_random:1303578-1303600 ATCTGTTTAGGGGGTGGGGCAGG + Intergenic
1144993158 17:19247861-19247883 TTGTGTTTAGGGAGTAAAGGGGG + Intronic
1146352016 17:32102938-32102960 TGATGTTCAGGGAGTGGGGCTGG + Intergenic
1146518075 17:33504924-33504946 TGGGGGTGAGGGAGTGGAGCTGG + Intronic
1147421864 17:40325955-40325977 TTGGATTTAGGGAGGGGAGAAGG - Intronic
1148028467 17:44604319-44604341 TTGTGTTTAGGGAGGGGAGAGGG + Intergenic
1149560533 17:57604955-57604977 TTGTGTGTGGGGAGGGGGGCGGG + Intronic
1150989497 17:70239572-70239594 TTGTCTTTAGGGAAAGTAGCAGG - Intergenic
1151336181 17:73441012-73441034 TTGTCCTTACCGAGTGGAGCAGG + Intronic
1153443895 18:5151118-5151140 GTGTGTGCAGGGAGTGGTGCTGG - Intronic
1153603556 18:6807841-6807863 CTGAGTTTAGGAAATGGAGCTGG - Intronic
1154370905 18:13762321-13762343 TTGTGTTCAGGGAGAGGAGCTGG + Exonic
1156714449 18:39990136-39990158 TTGGGTCTAGGGGGTGGAGAGGG + Intergenic
1157353706 18:46914566-46914588 TTGTGTGTCGGGGGTGGAGTTGG - Intronic
1157729620 18:49992203-49992225 TTGGGTCCAGGGAGTGGGGCAGG + Intronic
1158608913 18:58920786-58920808 GTGTGTTTGGGGAGGGGAGGGGG + Intronic
1158617313 18:59000239-59000261 TTGTGTTTGGGGATTGGAGGTGG - Intergenic
1158832388 18:61294365-61294387 TTGTGGTTAGGGAATGGAGCTGG - Intergenic
1159069741 18:63610575-63610597 TTGTGGTTAGGGGCTGGGGCTGG + Intergenic
1159075277 18:63674226-63674248 TTGAATTAAGGGAGTGGAGATGG - Intronic
1160962326 19:1728432-1728454 CTGAGTTTAGGGGGTGGAGAAGG - Intergenic
1164394249 19:27850170-27850192 TGGGGTTTAGGGGGTGGAGTGGG + Intergenic
1164442681 19:28291360-28291382 TTGGGTGGAGGGAGTGGGGCAGG - Intergenic
1165677914 19:37744284-37744306 TGGTGGTTAGGGTGTGGTGCTGG + Intronic
1166006013 19:39907179-39907201 TGGAGTTTGGGGAGGGGAGCAGG - Intronic
1168456122 19:56509786-56509808 TTGTGTTGTGTGAGTGGAGTAGG + Intronic
1168520624 19:57047561-57047583 TTGTGGTTAGGATGTGGACCAGG - Intergenic
1202714819 1_KI270714v1_random:36356-36378 CTGTGTCTAGGGAGTGGGGAGGG - Intergenic
926609728 2:14934197-14934219 TTGCTTTTAGGGAGTGGGACTGG - Intergenic
927095611 2:19745735-19745757 TGGTGTTTGGGAAGTGGGGCTGG + Intergenic
927541768 2:23918511-23918533 CAGTGTGTAGGGAGAGGAGCAGG - Intronic
927657076 2:24958217-24958239 TTGCCTCTAGGGAGTGGAACTGG - Intronic
932368885 2:71171478-71171500 TTGTCTCTTGGGAGGGGAGCTGG - Intergenic
934064742 2:88330461-88330483 TTGACTGTAGGGAGAGGAGCAGG + Intergenic
935359252 2:102233572-102233594 TTATATTTAGGGAGGGGAGGGGG - Intronic
935649555 2:105370570-105370592 TTGTGTGGGGGGTGTGGAGCTGG + Intronic
936159993 2:110077704-110077726 TTCTGGTTTGGGAGAGGAGCTGG - Intergenic
936184671 2:110293649-110293671 TTCTGGTTTGGGAGAGGAGCTGG + Intergenic
942118045 2:172748558-172748580 TTGTGTTGTGGGAGGGGACCCGG - Intronic
944668440 2:201975598-201975620 TGGTATGGAGGGAGTGGAGCAGG + Intergenic
945034062 2:205689005-205689027 GTGTGTACAGGGAGTGGAGAAGG + Intronic
945680882 2:212912838-212912860 TGGTGTTTAGGGAGGTGATCTGG - Intergenic
945943789 2:215974785-215974807 CTGTGTTTAGGAACTGGAGCAGG - Intronic
946212702 2:218160284-218160306 TTGTCTGCAGGGATTGGAGCTGG + Intergenic
946281470 2:218668792-218668814 TTGTTTTTAAGGAGTTTAGCAGG - Intronic
946889897 2:224264443-224264465 GTGTGTTTGGGGAGAGGAGCTGG + Intergenic
1168977157 20:1975394-1975416 TTGTGTGAAGGGCTTGGAGCTGG + Intergenic
1170404011 20:16017582-16017604 TTGTGATTGGAGAGTGGAGAAGG - Intronic
1171275841 20:23855901-23855923 TTGTGTTTGGTGAGTGGGGCAGG + Intergenic
1172318169 20:33972892-33972914 TAGTTTTTAGGGAGAGGACCTGG + Intergenic
1173814131 20:45974170-45974192 TTGGGTTGAGGGAATGGAACAGG + Intergenic
1174236985 20:49102231-49102253 TTGTGCCTAGGGATTGGTGCGGG - Intergenic
1174263492 20:49314525-49314547 TTGTCTTTAGGGAGAGGAGCTGG - Intergenic
1174520454 20:51126069-51126091 CTGTCTTTTGGAAGTGGAGCTGG + Intergenic
1175242488 20:57560132-57560154 TAGAGTTTAGGGAGTGGAGGGGG - Intergenic
1175565807 20:59975850-59975872 TTGTGTTCAGGGGGTGGTGTGGG + Intronic
1178089155 21:29143330-29143352 TTCTGCTTGGGGAGTGGAGTGGG + Intronic
1178391884 21:32205570-32205592 GTGTGTTTTGGGGGTGGAGAGGG + Intergenic
1178584580 21:33861386-33861408 TTGTATTTGGGGGGTGGGGCAGG + Intronic
1179511479 21:41876894-41876916 CTGTGTGTGGGGAATGGAGCTGG - Intronic
1180476090 22:15708991-15709013 TTCTGTTTAGGGAGGGAACCAGG + Intronic
1180852940 22:19030402-19030424 GTGCGTCTAGGGAGTGCAGCTGG + Intergenic
1182363952 22:29765552-29765574 TTTAGGTTAGGGTGTGGAGCAGG - Intronic
1183314747 22:37130583-37130605 TTGGGTCTAGTGTGTGGAGCGGG - Intronic
1184359141 22:44003696-44003718 CTGTGTTTAGGAGTTGGAGCTGG + Intronic
1184763723 22:46560927-46560949 TTGTGTGCAGGGAGAGGAGCTGG + Intergenic
949439546 3:4065992-4066014 TTGTGTTTAGACAATGGAGCAGG - Intronic
950167939 3:10815926-10815948 TGGGGTTTGGTGAGTGGAGCCGG + Intergenic
950748087 3:15106773-15106795 TTGAGTATAGATAGTGGAGCTGG + Intergenic
950952533 3:17015710-17015732 TTGTGCTTTTGGAGTGGAGGAGG - Intronic
951332076 3:21380325-21380347 GTGTGTTCAGGGAGAGGAACAGG + Intergenic
955216653 3:56989717-56989739 TTGTTCCTAGGGAGTGGGGCAGG - Intronic
958151014 3:89695536-89695558 CTGTGTGTAGGGAGAGGGGCAGG - Intergenic
958661207 3:97069916-97069938 GTGTGTTTAAGGAGTGGGACTGG + Intronic
959747396 3:109792692-109792714 ATGTATTTGGGGAGTGGAGTAGG + Intergenic
960057810 3:113288059-113288081 TTGTGTTTTGGGGCTGGAGAGGG + Exonic
960943403 3:122949263-122949285 TTGTTTTTGGGGAGAGGAGGGGG - Intronic
961375877 3:126465465-126465487 TTGTGTTTCAGGAGTGGACTGGG - Intronic
962021959 3:131511156-131511178 GTGTGATTAGGGAGAGGAACAGG + Intergenic
962839406 3:139220441-139220463 TTCTGTTGTGGGAGTGGGGCAGG + Intronic
963340556 3:144027306-144027328 TGGTGTGTAGGGAGTGGGGAGGG + Intronic
965026109 3:163303774-163303796 TTCTGCTTAGGGAGAGGAGAGGG + Intergenic
966413505 3:179666594-179666616 TTGCATTTGGGGAGTGGAGCTGG + Intronic
966646063 3:182247506-182247528 TTGTGAATACTGAGTGGAGCAGG + Intergenic
967082745 3:186065222-186065244 TTGCTTTAAGGGAGTGGAGTGGG + Intronic
967816432 3:193802878-193802900 TAGTGTTTAGGGTGGGGAGGTGG - Intergenic
968130246 3:196188919-196188941 TTGTGTGCAGGCAGTTGAGCAGG - Intergenic
968503036 4:960028-960050 TTGTGTTCAGGGAAGGGAGAAGG - Exonic
968815087 4:2817951-2817973 AGGTGTTGGGGGAGTGGAGCGGG + Intronic
971065873 4:23032671-23032693 TTGAGTTTAGAGAGTGGATTTGG + Intergenic
971177583 4:24294583-24294605 TTGTTTTTTGGGAGTGGGGGTGG - Intergenic
971701544 4:29984186-29984208 TTCTGTTTAAGGAGAGGAGAAGG + Intergenic
971715776 4:30174961-30174983 TTGTGTTCAGGAAGAAGAGCTGG - Intergenic
972639903 4:40915916-40915938 CTGCCTTGAGGGAGTGGAGCTGG + Intronic
972772687 4:42212498-42212520 TTGTAGTTGGGGAGTGGGGCTGG + Intergenic
976082881 4:81375683-81375705 TTCTGTTTAAGGAGAGGAGAGGG - Intergenic
977547152 4:98397464-98397486 TTGTTTTTAGAGAGTGGGTCGGG - Intronic
979045009 4:115851923-115851945 AAGTGATTAGGGACTGGAGCAGG + Intergenic
979102263 4:116633505-116633527 TTCTATTTTGGTAGTGGAGCAGG + Intergenic
979364170 4:119800941-119800963 TTATCTTTAGGGAGTAGAACAGG - Intergenic
981625120 4:146746857-146746879 TTCTTTTTAGGGGGTGGAGGAGG - Intronic
982593012 4:157339717-157339739 TTGTTTTAAGGGATTTGAGCAGG + Intronic
983478639 4:168245935-168245957 ATGTCTTTGGGGAGTGGAACAGG + Intronic
983495119 4:168434911-168434933 ATGAGTTTTGGCAGTGGAGCAGG - Intronic
984566143 4:181332555-181332577 TTATTTTTATGGAGTGAAGCAGG - Intergenic
985895064 5:2744190-2744212 TTATGTTCAGGCATTGGAGCAGG - Intergenic
986795717 5:11210044-11210066 TTGTATTGAGGGAGTGGAGGAGG - Intronic
987009878 5:13751729-13751751 TGGTGTTTAGGGGGTAGAGCTGG + Intronic
987741298 5:21912674-21912696 TCATGTTTAGGGTGTGGACCGGG - Intronic
989460103 5:41687607-41687629 TTGGGGTTGGGGAGTGGAGAGGG - Intergenic
989807274 5:45624779-45624801 TTGTGTTTATGGAGGCAAGCAGG + Intronic
990426548 5:55695444-55695466 TTGAGATTAGGGAGTGGTGATGG + Intronic
990711600 5:58587327-58587349 TTGTATTTAGCGAGTTGAGTGGG - Intronic
990923841 5:60996443-60996465 TTCTGTTTAAGGAGAGGAGAGGG - Intronic
991776617 5:70091372-70091394 TTGAGTTTAGGGAGGAGAACAGG - Intergenic
991855904 5:70966819-70966841 TTGAGTTTAGGGAGGAGAACAGG - Intergenic
991869919 5:71099592-71099614 TTGAGTTTAGGGAGGAGAACAGG - Intergenic
992134933 5:73734814-73734836 TTGTGTTTTTGCAGTGGAGAGGG + Intronic
993013492 5:82510112-82510134 TTATGTACAGGGAGTGGAGGTGG - Intergenic
995774762 5:115713101-115713123 ACGTGTTTTGGGAGGGGAGCCGG - Intergenic
999418836 5:151422941-151422963 TTGTGTGTGGGGAGTGGAGTGGG - Intergenic
1000314641 5:160077562-160077584 TTGTGTTTGTGGGGTGGGGCGGG + Intronic
1000591454 5:163163814-163163836 TTGTGTTTGGGAAGTGTAACAGG - Intergenic
1000792421 5:165624206-165624228 TTGTGTCTGGGGTGGGGAGCAGG + Intergenic
1001787701 5:174427715-174427737 TTGTGTTTATGTATTGGAGGTGG - Intergenic
1001922831 5:175613941-175613963 CTGTGTTCAGAGAGTGGAGGAGG + Intergenic
1002377433 5:178798324-178798346 TTGAGATTAGGGAGTGGTGATGG - Intergenic
1003420591 6:5954269-5954291 TTGTCTTTAGGGAGGTGAACTGG + Intergenic
1003420612 6:5954608-5954630 TTGTCTTTAGGGAGGTGAACTGG + Intergenic
1003782002 6:9439678-9439700 TTTTCTTTTGGGAGTGGAGGAGG - Intergenic
1003847489 6:10188351-10188373 TTGTGATTAGAGAGTGGGGCTGG - Intronic
1005191664 6:23230404-23230426 TTGTGAAGAGGGAGAGGAGCAGG + Intergenic
1005493589 6:26369468-26369490 TTGTGTTAGGGGATTGGGGCCGG + Intronic
1005712561 6:28515858-28515880 GTGTGTGTAGGGAGTGGAGGTGG - Intronic
1005721684 6:28608486-28608508 TTGTGTTGGGGCAGTGGAGGTGG - Intronic
1007650865 6:43420346-43420368 TTGTGTTAAGGGTGTGGATTGGG + Intergenic
1007843010 6:44731981-44732003 CTGTGTGTAGAGAGTGGTGCAGG + Intergenic
1008932179 6:56953176-56953198 TTGTGTTTCTTCAGTGGAGCTGG + Intronic
1009736316 6:67680511-67680533 TTGTAGTTAAGGAGTGGAGCTGG - Intergenic
1010174919 6:73017050-73017072 ATGAGTTAAGGGACTGGAGCTGG - Intronic
1010324643 6:74550560-74550582 TTCTGCTTAGGGAGAGGAGAAGG - Intergenic
1012435976 6:99215693-99215715 ATGGCTTCAGGGAGTGGAGCTGG - Intergenic
1013149966 6:107436007-107436029 TTTAGTTTATGGAGTGCAGCTGG - Intronic
1015031021 6:128596102-128596124 TTGTTTTTAGGAAGTTAAGCTGG + Intergenic
1018109588 6:160522272-160522294 TAGAGTTGAGGGTGTGGAGCTGG - Intergenic
1018752213 6:166816952-166816974 TTGTGTTTGGGGCGTGGACTCGG - Intronic
1021550140 7:21862218-21862240 TTTGGTTTGGGGAGTGGGGCCGG + Intronic
1021844268 7:24748790-24748812 TTGTGATTAGTGAATGGAGATGG - Intronic
1023319574 7:38978731-38978753 TTGTATCTAGGGAGGTGAGCTGG + Intronic
1023882652 7:44329292-44329314 GTGTGTTTAGGGAATGAAGACGG + Intronic
1025148232 7:56523572-56523594 TTGTGTTGAGGGGTTGGAGATGG + Intergenic
1025300256 7:57814331-57814353 ATGTGTTCAGGGAGGGAAGCAGG - Intergenic
1026522481 7:71129658-71129680 GTGTCTCTAGGGAGAGGAGCTGG + Intergenic
1026775331 7:73227515-73227537 GAGTGTTCAGGGAATGGAGCAGG + Intergenic
1027016188 7:74780886-74780908 GAGTGTTCAGGGAATGGAGCAGG + Intronic
1027071840 7:75165051-75165073 GAGTGTTCAGGGAATGGAGCAGG - Intergenic
1027200857 7:76063144-76063166 TTGTGCATGGGGAGTGGAGCCGG + Intronic
1028646232 7:93099818-93099840 TTGTGTTTGGGGTGTGGGGGTGG - Exonic
1028873649 7:95796175-95796197 GTGTGTTTAGTGAGGGGAGAAGG + Intronic
1032309334 7:130768576-130768598 TTCAGTTTAGCCAGTGGAGCTGG - Intergenic
1032959557 7:137015684-137015706 CTGTGTTCAGGGAGAGGAGAAGG + Exonic
1034760235 7:153665533-153665555 TTCTGTTTTGGGAGGGGAGGGGG + Intergenic
1035291239 7:157840631-157840653 TGGAATTTAGGGAGTGGTGCTGG + Intronic
1036444495 8:8809753-8809775 TTGTGTTTTGTGAGAGGAGAGGG - Intronic
1040565711 8:48564896-48564918 TTGTGCTTAGTCAGGGGAGCAGG + Intergenic
1041029948 8:53726890-53726912 TTGTGATTTGGGAGTGGAAGTGG - Intronic
1042532529 8:69830970-69830992 TTGTTTTTAGATAGTGGTGCAGG + Intronic
1044447885 8:92299769-92299791 ATTGGTTTAGGGAGTGGAGGAGG - Intergenic
1045871591 8:106933882-106933904 TTGTGGTTAGGGATTGGAGCTGG + Intergenic
1046012932 8:108572501-108572523 TTGTTTTTAAAGAGCGGAGCAGG + Intergenic
1046416988 8:113929642-113929664 ATGTGTCTAGGGAGAGGAGAAGG + Intergenic
1047004182 8:120602697-120602719 TTGTGTTTATGTAGTGTATCAGG - Intronic
1050741535 9:8826145-8826167 TTGAGTTAAGGGTGTGGAGGAGG - Intronic
1052197894 9:25740373-25740395 GTGTGTGTATGGAGTGGAGAGGG + Intergenic
1053226370 9:36361871-36361893 TAGTGTTTAGGGGGTGTGGCAGG - Intronic
1055347460 9:75353549-75353571 GTGTGTTCAGGGTGTGGAACAGG + Intergenic
1057585490 9:96324857-96324879 TTGTGTGTTGGAAGTGCAGCAGG - Intronic
1059099123 9:111452882-111452904 CTGAGTTTAGGGATTGGGGCAGG + Intronic
1059919878 9:119148008-119148030 GTGTGTCTAGGAAGTGGAGATGG - Intergenic
1060846449 9:126841488-126841510 TAGTGTTTAGTGAGTTGAGTGGG - Intergenic
1060914950 9:127382726-127382748 TTGTGTTTAGAGCTTGCAGCAGG + Intronic
1061162248 9:128902134-128902156 GTGTGTCTGGGGAGTGGAGGAGG - Intronic
1061409031 9:130408590-130408612 TTGTGTTTAGTCAGTGCATCAGG - Intronic
1186771163 X:12819426-12819448 TTGTATTTTGGGAATGTAGCAGG - Intronic
1187035293 X:15532196-15532218 TAGGGTACAGGGAGTGGAGCAGG - Intronic
1188013842 X:25086071-25086093 TTATTTTTAGGGGGTGGAGGGGG + Intergenic
1188512482 X:30951133-30951155 TAGTGTTTAGGGTGTGGGCCAGG - Intronic
1188871674 X:35381294-35381316 GCCTGTTTAGGAAGTGGAGCTGG - Intergenic
1189715080 X:43857046-43857068 TTGTGTTGAGGGGCTGGAGGAGG - Intronic
1190333424 X:49249252-49249274 TTGTGTTCAAGGTGTGGGGCAGG + Exonic
1194245051 X:91500433-91500455 ATGTGTTCATGGACTGGAGCAGG + Intergenic
1195913828 X:109916087-109916109 TTCTGTTTGGGAAGAGGAGCTGG + Intergenic
1196649431 X:118153783-118153805 TTGTGTCTAGGGGGTGGGGTAGG - Intergenic
1198279213 X:135125484-135125506 TTGTGTTCAGAGAGAGCAGCTGG - Intergenic
1198291744 X:135247036-135247058 TTGTGTTCAGAGAGAGCAGCTGG + Intergenic
1198688186 X:139250248-139250270 TGGTGTTTGGGGAGTGAAGATGG - Intergenic
1199878542 X:151954566-151954588 TTCTGTTTGGGGAATGGGGCAGG + Exonic
1200564026 Y:4741743-4741765 ATGTGTTCATGGACTGGAGCAGG + Intergenic