ID: 1068301569

View in Genome Browser
Species Human (GRCh38)
Location 10:55148985-55149007
Sequence TACATTGATGTGAATATAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 122}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068301569_1068301570 6 Left 1068301569 10:55148985-55149007 CCTGCTATATTCACATCAATGTA 0: 1
1: 0
2: 0
3: 5
4: 122
Right 1068301570 10:55149014-55149036 ATTATCTTAGATGAAAATGCAGG No data
1068301569_1068301571 7 Left 1068301569 10:55148985-55149007 CCTGCTATATTCACATCAATGTA 0: 1
1: 0
2: 0
3: 5
4: 122
Right 1068301571 10:55149015-55149037 TTATCTTAGATGAAAATGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068301569 Original CRISPR TACATTGATGTGAATATAGC AGG (reversed) Intronic
903106465 1:21084812-21084834 TAACTTGATGAGAATAAAGCAGG - Intronic
907657458 1:56358665-56358687 TTCTTTGATATGAATAAAGCAGG - Intergenic
909831691 1:80199785-80199807 TATTTTGATATGAATATATCAGG + Intergenic
909946150 1:81665697-81665719 TACATTGCTGTTAATATTGGAGG - Intronic
911533290 1:99071575-99071597 TACATGTATGTTTATATAGCTGG + Intergenic
916765634 1:167857516-167857538 TAAATTGAAGAGAATAAAGCAGG + Intronic
918011422 1:180590496-180590518 AACATTTATGTCCATATAGCTGG + Intergenic
918443831 1:184596406-184596428 TATATTGCCTTGAATATAGCAGG - Intronic
919564308 1:199164771-199164793 TATAGTGATTTGAATTTAGCAGG - Intergenic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
1064980325 10:21160162-21160184 TACAGTGATGAGTATATAACAGG - Intronic
1065405908 10:25364169-25364191 TCCATTGCTATTAATATAGCTGG + Intronic
1068301569 10:55148985-55149007 TACATTGATGTGAATATAGCAGG - Intronic
1068895465 10:62194886-62194908 TAAATGGATGTGAATATATGTGG - Exonic
1072463829 10:95645029-95645051 TACAATTATGTGCATGTAGCAGG - Intronic
1074076434 10:110130275-110130297 TGCATTTATGTGTATATAGATGG + Intronic
1075005751 10:118828914-118828936 TGCAGTGATGTGTATATGGCAGG + Intergenic
1078186901 11:9059704-9059726 TACAAAGATGAGAATATAACAGG - Intronic
1080163762 11:29212035-29212057 TTCATTGATGTGACTATAGTTGG + Intergenic
1081223858 11:40497036-40497058 TCCATTGTTTTGAAAATAGCAGG + Intronic
1087325559 11:96718522-96718544 TAAATTGATTTTTATATAGCTGG - Intergenic
1089736934 11:120556117-120556139 TACATTGAAGAGAAGATGGCGGG + Intronic
1089822898 11:121244991-121245013 TCCTTTGAAGTAAATATAGCTGG - Intergenic
1089989545 11:122846140-122846162 TACATTGCTGTGAATGGAGTGGG - Intronic
1091820469 12:3471898-3471920 TACATTGATGGTAAGGTAGCGGG + Intronic
1094351948 12:29536682-29536704 TACAATGATGTGAAGATATTTGG + Intronic
1095370428 12:41460696-41460718 TACGTAGATGTAAATATAGGAGG + Intronic
1100900693 12:99237302-99237324 TACATATATATGTATATAGCTGG - Intronic
1107528728 13:41260817-41260839 TAAATTGATGAGAATGGAGCTGG + Exonic
1108430304 13:50346694-50346716 TACCTTGAAGAGAATATTGCAGG - Intronic
1108644522 13:52413251-52413273 TACATTCATCTGAATATACATGG + Exonic
1108968748 13:56344795-56344817 TGCAGTAAAGTGAATATAGCTGG + Intergenic
1109356131 13:61231295-61231317 AATATTGCTCTGAATATAGCAGG - Intergenic
1109795430 13:67306074-67306096 TACATTGATATGAATCCTGCTGG + Intergenic
1111335120 13:86811224-86811246 TACATAGATCTGAATATTACAGG + Intergenic
1118055940 14:62079959-62079981 TTCATTGATATGAAAATACCTGG - Intronic
1119135690 14:72216867-72216889 TACATAGATGAGAATATATTTGG + Intronic
1121579441 14:95016260-95016282 TACATTAATATCAATATATCAGG + Intergenic
1128093818 15:64937810-64937832 TACAGTTATGTGAACAAAGCAGG + Intronic
1129299537 15:74617596-74617618 TCCATTGATGTGAATATGTATGG + Intronic
1133541022 16:6754242-6754264 GAAATTGATCTGAATAAAGCAGG - Intronic
1134786081 16:16944862-16944884 TAAATTGATGAGAATAAAGAGGG + Intergenic
1135857246 16:26023066-26023088 TACACTGAAGTGAATACAGTTGG - Intronic
1138899850 16:61255763-61255785 TACTCTGAATTGAATATAGCTGG + Intergenic
1140777182 16:78260355-78260377 TACATTTTTGTGAATTTATCTGG - Intronic
1150507230 17:65711734-65711756 TTCATTTTTGTGACTATAGCAGG - Intronic
1158281942 18:55838107-55838129 TAGATGGATGAGAATATAGGGGG + Intergenic
1158500990 18:58001691-58001713 TACAATGGTGTGATCATAGCTGG + Intergenic
1167729059 19:51239813-51239835 TAAGATGATGTTAATATAGCAGG - Exonic
1202643982 1_KI270706v1_random:124113-124135 TACATTACTGTCAATATCGCAGG + Intergenic
928807878 2:35183137-35183159 TCCATAGATGTGAAAATATCTGG + Intergenic
930375743 2:50564586-50564608 TAAATTGATGGAATTATAGCTGG + Intronic
930810096 2:55531145-55531167 TACTTTGATGTGAATAAGTCTGG + Intronic
930991314 2:57659013-57659035 TACAGAGCTGTGCATATAGCGGG - Intergenic
933892466 2:86784424-86784446 TTGATTGATGTGAAAATGGCAGG + Intergenic
936171916 2:110184458-110184480 TACATGGAGATGAAAATAGCAGG - Intronic
938200758 2:129371140-129371162 TACAATGATGTGCTTAGAGCAGG + Intergenic
939366962 2:141246255-141246277 TACATTAATGTGAATATCACAGG + Intronic
943258065 2:185622352-185622374 TACATTGATCTGAAAACAGATGG + Intergenic
943584190 2:189718693-189718715 TAAATTGATGTAAGTATAACAGG + Intronic
943989851 2:194674259-194674281 TGCATTGATCTGACTCTAGCTGG + Intergenic
944744581 2:202642251-202642273 GACAATGATGTGAAAATATCTGG - Intronic
945313970 2:208350466-208350488 TACAATGATGTTAATATGGTAGG + Intronic
945497276 2:210524401-210524423 TATAGTGATGAGAATATAGTAGG + Intronic
947133049 2:226949441-226949463 TACATGGATGTGGACATTGCTGG + Intronic
1169987942 20:11467846-11467868 TGCATTAATCTTAATATAGCTGG + Intergenic
1171327828 20:24311398-24311420 CCCATTGATGTGACTTTAGCAGG - Intergenic
1173778444 20:45732682-45732704 TACATTGATTTCTATATATCTGG + Intergenic
1178767082 21:35464525-35464547 TGCATAGATGTGAGTATGGCTGG + Intronic
1178771241 21:35506228-35506250 TAAATTTATGTAAATTTAGCTGG + Intronic
1180357984 22:11858323-11858345 TACATTACTGTCAATATCGCAGG - Intergenic
1180380284 22:12134010-12134032 TACATTACTGTCAATATCGCAGG + Intergenic
1181679985 22:24488183-24488205 TACAGTGATTTGCATATAACTGG - Intergenic
957486975 3:80874127-80874149 TACATTCCTGTAACTATAGCGGG - Intergenic
957729950 3:84121382-84121404 TACATTGTTGTAAATATATGTGG + Intergenic
958088361 3:88842742-88842764 TAAAGTGATATGAATACAGCAGG + Intergenic
958542934 3:95502772-95502794 TATATTTTTGTGAATATAGGTGG - Intergenic
962306405 3:134290728-134290750 TGTATTTATGTGATTATAGCAGG - Intergenic
962942762 3:140140852-140140874 AACATGGCTGGGAATATAGCAGG - Intronic
966639443 3:182173341-182173363 AACATTTTTGTGAATATAGTGGG - Intergenic
966805073 3:183800747-183800769 TACAGTGATGTGACTAGAGGTGG + Intronic
966851698 3:184168812-184168834 TACATTGAAGAGAATATAAGGGG - Intronic
970905369 4:21209744-21209766 TACAGTGTTGAGAATATAGTAGG + Intronic
973141511 4:46774469-46774491 TACATTGATGCCAATATAATAGG - Intronic
974834772 4:67234741-67234763 TACATTGCTGTGAATATTAGAGG - Intergenic
978265315 4:106816809-106816831 TATAATTATGGGAATATAGCTGG - Intergenic
978854488 4:113378551-113378573 AAGATTGAGCTGAATATAGCTGG - Intronic
979682737 4:123479618-123479640 TATTATGATGTGCATATAGCTGG + Intergenic
979748383 4:124245025-124245047 TACATTCATGTCAATTTGGCAGG + Intergenic
980647877 4:135667341-135667363 TAAAATGATTTGAATATATCTGG + Intergenic
980848095 4:138348385-138348407 TGCATTGATGTGCATGTGGCTGG - Intergenic
981871239 4:149488184-149488206 TACATTGATGTGAAAAGTGTGGG + Intergenic
988478829 5:31612288-31612310 TACAGTGAGGTGAATACAGCAGG - Intergenic
993408311 5:87541049-87541071 TAAATTGTTATGAATATAGCAGG - Intergenic
994742313 5:103635617-103635639 TACACTGATGTAAAAATATCTGG + Intergenic
997431313 5:133843029-133843051 TACAGTAATGGAAATATAGCAGG - Intergenic
999163703 5:149529017-149529039 TAAAGTGATGTGCATATTGCAGG + Intronic
1003833637 6:10043065-10043087 AACATTGAAGTGTATATTGCTGG - Intronic
1005190663 6:23218821-23218843 TAGATTGATGAGAATAAAGGAGG + Intergenic
1005394629 6:25368492-25368514 AACATTGATCTGTATGTAGCTGG - Intronic
1008134828 6:47762630-47762652 TACAATTATGTGCATATAGTTGG - Intergenic
1009308743 6:62123193-62123215 TACAGGGATGTGAATGAAGCTGG - Intronic
1010250986 6:73706846-73706868 TACATTTATGAAAATATAGCTGG + Intronic
1012106224 6:95162748-95162770 TTTATTGATGTCAAAATAGCAGG + Intergenic
1013004299 6:106057396-106057418 TACAGATATGTGAATATATCTGG - Intergenic
1017357660 6:153528648-153528670 TACATTGATGCCAGTATTGCCGG + Intergenic
1020833194 7:13116107-13116129 TACAGTGCAGTGGATATAGCTGG + Intergenic
1026399832 7:69998343-69998365 TTTTTTAATGTGAATATAGCTGG - Intronic
1026528754 7:71178984-71179006 TCCATTGAAAGGAATATAGCAGG - Intronic
1028028267 7:85874813-85874835 TACAATGATTATAATATAGCAGG + Intergenic
1031457159 7:121995937-121995959 AACATTGTTTTGAATATACCTGG - Intronic
1034839215 7:154380363-154380385 TACATATATGTGCATATAGAGGG + Intronic
1038794331 8:30696432-30696454 TACATTGCTGTGGAGATGGCAGG - Exonic
1038936645 8:32259313-32259335 TACATTAATGTCATTATTGCAGG + Intronic
1039344483 8:36688900-36688922 TTCATTGCTCTGAATTTAGCTGG + Intergenic
1039928497 8:41960962-41960984 TACCTTAATGTGAATATGGGTGG + Intronic
1041178290 8:55220900-55220922 TACAGTGACTTGCATATAGCAGG + Intronic
1044436011 8:92165066-92165088 AACATTTATGTGAACATAGTGGG - Intergenic
1052323827 9:27195979-27196001 TACCTTGATGTGATCAGAGCAGG + Intronic
1057555161 9:96082339-96082361 TGCAGTGATGTGAATGTGGCTGG - Intergenic
1058368557 9:104236964-104236986 TACATTTTTGTAAGTATAGCTGG + Intergenic
1059232892 9:112737765-112737787 TACATTTATTTGAGTCTAGCAGG + Intergenic
1188318249 X:28703256-28703278 TAAGTTGATGTGAATATTTCTGG + Intronic
1189253266 X:39617677-39617699 TACTTTGATGTGAAAATAAAAGG - Intergenic
1189918491 X:45880434-45880456 GGCATTGAAGTGAATTTAGCTGG - Intergenic
1194842770 X:98764320-98764342 TAATTTGATGTGAATATTACTGG + Intergenic
1196217835 X:113074967-113074989 TATATATATGTGAATGTAGCAGG - Intergenic
1198919632 X:141711040-141711062 AACAGTGATGTTAATGTAGCTGG - Intergenic