ID: 1068301818

View in Genome Browser
Species Human (GRCh38)
Location 10:55153285-55153307
Sequence TCCCACTCAGGTGATCTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068301818_1068301829 28 Left 1068301818 10:55153285-55153307 CCCCCAAGATCACCTGAGTGGGA 0: 1
1: 0
2: 0
3: 12
4: 106
Right 1068301829 10:55153336-55153358 CCAAGTTGCTCACCTTGACACGG No data
1068301818_1068301830 29 Left 1068301818 10:55153285-55153307 CCCCCAAGATCACCTGAGTGGGA 0: 1
1: 0
2: 0
3: 12
4: 106
Right 1068301830 10:55153337-55153359 CAAGTTGCTCACCTTGACACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068301818 Original CRISPR TCCCACTCAGGTGATCTTGG GGG (reversed) Intronic
900315396 1:2053734-2053756 TCCCACTCTGGAGTTCCTGGTGG + Intronic
900521857 1:3109775-3109797 GGCCACTCAGGTGATATTTGGGG - Intronic
900726846 1:4222155-4222177 CCCCACTGTGGGGATCTTGGAGG + Intergenic
904205636 1:28853313-28853335 TCCCTCTCTGGTGATCAAGGGGG + Intronic
905938351 1:41842544-41842566 TGCCAATCAGGAGGTCTTGGTGG + Intronic
906723409 1:48025658-48025680 TCTGACTCAGGTGTTCTGGGAGG + Intergenic
907805610 1:57816305-57816327 TCCCAGTGAGGTGCTCTTGCAGG + Intronic
911642583 1:100304748-100304770 TCCCACTCAGAATTTCTTGGGGG - Intergenic
915313166 1:155014669-155014691 TCCCAATCAGGTCATCCTCGGGG - Exonic
916365041 1:164017245-164017267 TGACACTCAGGTGGGCTTGGAGG - Intergenic
919165187 1:193883743-193883765 TCCTACTCAGTTTACCTTGGAGG - Intergenic
919614944 1:199795139-199795161 ACCCCCTCAGGTGATCTTCCAGG - Intergenic
919800632 1:201352416-201352438 TCCCACTCAGTTGCGGTTGGTGG - Intergenic
1068301818 10:55153285-55153307 TCCCACTCAGGTGATCTTGGGGG - Intronic
1069666821 10:70168104-70168126 TCCCACTCAGATCATTTTGGAGG + Intronic
1069904792 10:71725833-71725855 TCTCACTTGGGTGATCTTGGAGG + Intronic
1070286161 10:75085419-75085441 CCCCACTCAGGTGACCTCAGAGG + Intergenic
1075930692 10:126292953-126292975 TCCAATTCAGATGATCTGGGTGG + Intronic
1075964820 10:126602433-126602455 TCACACCTAGGTCATCTTGGAGG - Intronic
1077557073 11:3230948-3230970 TCCTACTCAGGATAGCTTGGGGG + Intronic
1081991034 11:47337751-47337773 TCCCACGTTGCTGATCTTGGGGG + Exonic
1082994522 11:59240983-59241005 TCCTACTCAGTTTATGTTGGAGG - Intergenic
1084815325 11:71642592-71642614 TGCCACTCAGGGGCTCCTGGGGG - Intergenic
1084857104 11:71996382-71996404 TCCCACCCAGGAGGTCTTTGTGG - Exonic
1086873282 11:92064984-92065006 TGCATCTCAGGGGATCTTGGTGG + Intergenic
1088835876 11:113577693-113577715 TCCCACCTAGGTGATTGTGGTGG - Intergenic
1088971261 11:114776342-114776364 TCCCACTCTGGAGAGCTCGGTGG - Intergenic
1092075505 12:5670081-5670103 TCCCACACGTGTGCTCTTGGCGG - Intronic
1092214368 12:6670474-6670496 TCTCACTCAGTTGTTTTTGGAGG + Intronic
1096776128 12:53965469-53965491 CCCCACCCAGGTGTTCCTGGGGG - Intergenic
1099183290 12:79491896-79491918 TCACCAACAGGTGATCTTGGTGG - Intergenic
1101933932 12:109040525-109040547 GCCAACTCAGCTGCTCTTGGTGG - Intronic
1105499126 13:20956080-20956102 TCCACCTCAGGTGATCCGGGAGG + Intergenic
1105811171 13:23996918-23996940 GCCCTCTCAGATCATCTTGGAGG + Intronic
1113204296 13:107897715-107897737 TTCCAGTCAGGTGTTATTGGAGG - Intergenic
1116541158 14:46103613-46103635 TCCCACTTATGTGTTTTTGGTGG + Intergenic
1116973155 14:51089182-51089204 ACCCACTTAGGTGATCTCAGAGG - Intronic
1117285972 14:54286138-54286160 TTCTACTCTGGTGTTCTTGGAGG + Intergenic
1119338019 14:73851308-73851330 GCCCACACTGGTAATCTTGGAGG + Intergenic
1124019823 15:25909915-25909937 TCCCACTCCGCTGATGATGGGGG + Intergenic
1126712550 15:51475688-51475710 TCCCACTAATGTGCTTTTGGGGG - Intronic
1128680144 15:69645524-69645546 TCCCACTGAGGTGGTATTAGGGG - Intergenic
1129179276 15:73862051-73862073 TCCAAGTCAGGAGATATTGGAGG - Intergenic
1131766368 15:95680238-95680260 TCCCACCTAGGTGATATTGCAGG - Intergenic
1138206069 16:55126141-55126163 TACCAGTCAAGTGTTCTTGGAGG + Intergenic
1138522924 16:57581929-57581951 TCCCACTCCGGAGATCTTACTGG + Intronic
1139419445 16:66841311-66841333 ACCCACTCAGGTCAACTTGGGGG - Intronic
1143184541 17:5002454-5002476 TCCCACTCAGGTGAGCTATATGG + Exonic
1145788652 17:27610491-27610513 CCCCACCCAGCTGATCTGGGAGG + Intronic
1149629620 17:58111579-58111601 TTTAACTCAGGTGTTCTTGGGGG - Intergenic
1152424535 17:80211714-80211736 TCCGATTCAGTAGATCTTGGCGG - Intronic
1160962653 19:1730421-1730443 TCCCGCTCAGGGGCTCTTGGTGG + Intergenic
1163024526 19:14502720-14502742 CCCCAGCCAGGTGATCCTGGAGG + Intergenic
1167768458 19:51499592-51499614 CCCCATCCAGGTGATCGTGGGGG + Exonic
1168557417 19:57354764-57354786 ACCCACTCCGGTGTCCTTGGTGG + Intronic
929439034 2:41950980-41951002 CCCTACTGAGGTGATTTTGGGGG + Intronic
932586525 2:73033499-73033521 TCTCACTGAGGTGATATTGGAGG + Intronic
946576483 2:221081450-221081472 TCTCAACCAGGTGACCTTGGAGG - Intergenic
946666200 2:222052355-222052377 GCATACTCAGGTGATTTTGGTGG - Intergenic
1168835482 20:874515-874537 TCCCCTCCAGGTGTTCTTGGAGG + Intronic
1169022438 20:2340041-2340063 TCCCACCCAGGGGATCTGGAGGG - Intronic
1172993698 20:39054326-39054348 TCCCAGCCAGGGGATCTTGGGGG - Intergenic
1173564248 20:44027877-44027899 TCCCACTTAGGGGATCATGGAGG + Intronic
1175051135 20:56156596-56156618 TCCTACTCCACTGATCTTGGGGG - Intergenic
1175077933 20:56391851-56391873 TCTTACCCAGGTGATCTCGGAGG + Intronic
1175378567 20:58546672-58546694 GTCCACTCAGGTCATCTTGAAGG - Intergenic
1175876844 20:62234318-62234340 TCCCACTCAGGTGCACATGGAGG - Intronic
1177878434 21:26663786-26663808 TCCCACTCAGTTTACCTTGGAGG + Intergenic
1182775258 22:32826781-32826803 TGCCACTCAGGAGTTCATGGGGG + Intronic
949474354 3:4429522-4429544 TCCCACACACGTTGTCTTGGAGG + Intronic
951126375 3:18989255-18989277 CCCCTCTCAGATGATCTTTGAGG - Intergenic
952080216 3:29748848-29748870 TCCCACTCAGGTGGGCGTGTGGG + Intronic
952111063 3:30124385-30124407 TCCCATCCTGGTGCTCTTGGTGG + Intergenic
953121213 3:40044464-40044486 TCACACCCAGGTGCTCCTGGGGG - Intronic
953237427 3:41118893-41118915 CTCCACTCACGTGATCTGGGAGG + Intergenic
953802683 3:46038355-46038377 TCCTACTCAGTTTACCTTGGAGG - Intergenic
957520602 3:81313570-81313592 CCTGAATCAGGTGATCTTGGTGG + Intergenic
961170883 3:124796943-124796965 TCCTACTCCGGCCATCTTGGTGG - Intronic
961479448 3:127170750-127170772 TGCAACTCAGGTGGGCTTGGGGG + Intergenic
963228427 3:142886612-142886634 TCCCACTGAGGTCATTTTGCAGG - Intronic
963585389 3:147180499-147180521 CCTCACTGAGGTGTTCTTGGAGG - Intergenic
964364726 3:155937666-155937688 TCCCACTCAGTAGTTCCTGGGGG - Exonic
965190871 3:165527847-165527869 TCCCACTCAGGTAGTTTTAGGGG + Intergenic
969531103 4:7730941-7730963 GCTCACTCAGGTGATCTGGAAGG + Intronic
969600782 4:8174973-8174995 TCCCACTCAGTAGTTCCTGGGGG - Intergenic
973159190 4:46994065-46994087 TCCCATTCAGGTGTTATGGGGGG + Exonic
974537990 4:63193928-63193950 TCCTACTCAGATTACCTTGGAGG - Intergenic
979065246 4:116123207-116123229 TACCAGTCAGGTGATTTTAGAGG + Intergenic
981858311 4:149322890-149322912 TCCTACTCAGTTTACCTTGGAGG - Intergenic
992072520 5:73161148-73161170 TCCCACTCAGGTGAGCTTCTAGG + Intergenic
998461280 5:142312008-142312030 TTGCACTTTGGTGATCTTGGTGG - Exonic
1002711466 5:181197659-181197681 TCTCACTCAGGTGTTTTAGGTGG + Intronic
1004616799 6:17298455-17298477 TGCCACTTAGGGGATCATGGAGG + Intergenic
1005610428 6:27518650-27518672 TACCTCTCATGTGATCTTGTTGG + Intergenic
1006944958 6:37778892-37778914 GCCCCCTCAAGTGGTCTTGGGGG + Intergenic
1014975066 6:127870135-127870157 TCCCACTGAGGTGATGTCAGAGG + Intronic
1018980838 6:168600493-168600515 TGCCACTCGGGTGCTTTTGGAGG - Intronic
1020006303 7:4785276-4785298 TCCCACTCAAGTCCTCCTGGGGG + Intronic
1021698272 7:23294117-23294139 TCCCACTCAGATGTTCTGTGTGG - Intergenic
1022559070 7:31330873-31330895 TCCCACTCAGTAGTTCCTGGGGG - Intergenic
1022628994 7:32067614-32067636 TCCCACTGTGGTGATCATGTGGG - Intronic
1024125857 7:46294378-46294400 TCCCACCCACTTGATCTTGTCGG + Intergenic
1024994498 7:55261580-55261602 TCACACTAGGGTGAACTTGGGGG - Intergenic
1026291171 7:69007449-69007471 TGCCACACAGGGGATCTTGGAGG + Intergenic
1026666183 7:72341606-72341628 TCCCACTCTGGTTATGTGGGAGG - Intronic
1032478676 7:132229444-132229466 TCCAAGTCAGGTGAACTTTGTGG + Intronic
1032480948 7:132246631-132246653 TCCCAGAAAGGTGATCTAGGGGG - Intronic
1036394091 8:8351968-8351990 TCAGGCACAGGTGATCTTGGTGG - Intronic
1038247473 8:25872341-25872363 TGCCACTCTGGGGATGTTGGCGG + Intronic
1039632590 8:39128841-39128863 TCCCAGTCAAGGGATATTGGAGG - Intronic
1040578175 8:48672643-48672665 CTCCACTCAGGAGGTCTTGGTGG + Intergenic
1042770754 8:72379116-72379138 TCCCACTTTGTTGATTTTGGTGG - Intergenic
1044958151 8:97503294-97503316 TCCCACTCAGATGGTGTTGCTGG - Intergenic
1050626355 9:7507986-7508008 TCCCACTCTGGGGATCCTGGTGG + Intergenic
1056557717 9:87703597-87703619 TCCCACCCAGGAGATCTGTGTGG - Intronic
1061669836 9:132182526-132182548 TCCCACCCAGGGGGTCCTGGAGG + Intronic
1061861187 9:133469491-133469513 CCCCACTCAGGTGCTCCTGCTGG + Exonic
1186185996 X:7020291-7020313 TGCCACTCAGGTGACCATGCTGG + Intergenic
1196458822 X:115909002-115909024 ACACAGACAGGTGATCTTGGTGG - Intergenic