ID: 1068301819

View in Genome Browser
Species Human (GRCh38)
Location 10:55153286-55153308
Sequence CTCCCACTCAGGTGATCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068301819_1068301830 28 Left 1068301819 10:55153286-55153308 CCCCAAGATCACCTGAGTGGGAG 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1068301830 10:55153337-55153359 CAAGTTGCTCACCTTGACACGGG No data
1068301819_1068301829 27 Left 1068301819 10:55153286-55153308 CCCCAAGATCACCTGAGTGGGAG 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1068301829 10:55153336-55153358 CCAAGTTGCTCACCTTGACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068301819 Original CRISPR CTCCCACTCAGGTGATCTTG GGG (reversed) Intronic
900466387 1:2827521-2827543 CTCCCAGCCAGCTGAGCTTGGGG - Intergenic
900968763 1:5977691-5977713 TTTTCACTCAGGTGGTCTTGCGG - Intronic
902482938 1:16721065-16721087 CTCCCTCTCAGCTGCCCTTGAGG - Intergenic
904205635 1:28853312-28853334 CTCCCTCTCTGGTGATCAAGGGG + Intronic
904576658 1:31509318-31509340 CTCACACTCATTTGAGCTTGGGG + Intergenic
906667246 1:47630638-47630660 CTCCCACACAGGTTTTCCTGGGG + Intergenic
910851652 1:91655032-91655054 CTGACACTCAGCTGCTCTTGGGG + Intergenic
912966322 1:114240263-114240285 CTCCCAGTCAGGAGGTATTGAGG - Intergenic
913158198 1:116120921-116120943 CTCACACCCAGGTGGACTTGAGG + Exonic
913612803 1:120524604-120524626 CTCCCTCTCAGCTGTCCTTGAGG - Intergenic
914562878 1:148837711-148837733 CTCAAATTCAGGTGATCATGAGG + Intronic
914578388 1:148997643-148997665 CTCCCTCTCAGCTGTCCTTGAGG + Intronic
915772677 1:158445318-158445340 CTTCCACTGAGGAGATCTTGAGG + Intergenic
920767033 1:208843245-208843267 CTCCCACTCAGCTGAACTGTTGG - Intergenic
1068301819 10:55153286-55153308 CTCCCACTCAGGTGATCTTGGGG - Intronic
1072968412 10:99994981-99995003 CTCCTACTCAAGTGATCCTATGG + Intronic
1073074460 10:100815103-100815125 CTCCTACTCAGGGCATCCTGAGG + Intronic
1074467074 10:113692697-113692719 CTACCTCACAGGTGACCTTGTGG - Intronic
1076449490 10:130546955-130546977 CTCCCACTGTGGTGATGGTGGGG - Intergenic
1077557072 11:3230947-3230969 CTCCTACTCAGGATAGCTTGGGG + Intronic
1078850718 11:15160498-15160520 CTCCTAATCAGGTGTTCTTGTGG + Intronic
1081991033 11:47337750-47337772 CTCCCACGTTGCTGATCTTGGGG + Exonic
1082808493 11:57464434-57464456 CTCACACTCTGGTGAGCTTGTGG + Intronic
1086810027 11:91298473-91298495 CTCCCAGTCCTGTGATTTTGTGG + Intergenic
1087216366 11:95499510-95499532 TTGCCAGTCATGTGATCTTGGGG - Intergenic
1087267642 11:96077967-96077989 CTCCCTCCCAGGTGTTCTTCTGG + Intronic
1092985694 12:13843991-13844013 CTCTCACTGAGGTGATAATGAGG - Intronic
1096262747 12:50103346-50103368 CACCCACAGAGGTCATCTTGGGG - Intergenic
1098301213 12:69055887-69055909 CTCCCTCTCACGTGGTCCTGAGG + Intergenic
1101523688 12:105507884-105507906 CTCCCACTCAGGAGGTTGTGAGG - Intergenic
1101650951 12:106676579-106676601 CACCCACTCAAGTGATCATCTGG - Intronic
1106604847 13:31218945-31218967 CTTCTATTCAGGTGATCATGTGG + Intronic
1108601200 13:51996691-51996713 CTCTCAGTCAGGAGTTCTTGGGG - Intronic
1112188356 13:97149957-97149979 CTGACCCTCAGGTGATTTTGTGG - Intergenic
1113693690 13:112329614-112329636 CTCCCACTCAGGAGACCATCAGG + Intergenic
1114364863 14:22014860-22014882 CTCCCAATCAGGTGTCATTGCGG + Intergenic
1116184401 14:41578195-41578217 CTGCCACTTAGTTGACCTTGAGG + Intergenic
1124019822 15:25909914-25909936 CTCCCACTCCGCTGATGATGGGG + Intergenic
1128833674 15:70791940-70791962 CTCCAATTCAACTGATCTTGAGG - Intergenic
1132240655 15:100255043-100255065 CACCCACCCAGGGGATCCTGGGG - Intronic
1139419446 16:66841312-66841334 AACCCACTCAGGTCAACTTGGGG - Intronic
1143914034 17:10275763-10275785 CTCCTACTCAGAGGCTCTTGGGG - Intergenic
1144285747 17:13772322-13772344 CTCTCCTACAGGTGATCTTGAGG - Intergenic
1149425020 17:56546558-56546580 CTGCTTCTCAGGTGATCATGAGG + Intergenic
1149693580 17:58598737-58598759 CTCCCACTCAGGTTACCTGATGG + Intronic
1153860198 18:9195102-9195124 CTCCCACTTATGAGATCATGTGG - Intronic
1154169922 18:12043994-12044016 CTCACACACTGGTGATCTTACGG + Intergenic
1157259615 18:46166810-46166832 CTACTACTCAGGAGATCCTGAGG + Intergenic
1157945937 18:51980967-51980989 GTCCCACTCAGGTCTTCTTAGGG - Intergenic
1163366094 19:16876861-16876883 CTCCCACTCAGGGCATCCCGTGG + Intronic
1167768456 19:51499591-51499613 CCCCCATCCAGGTGATCGTGGGG + Exonic
926881444 2:17548963-17548985 CTCCCACTCCAGTGATTCTGTGG + Intronic
929541975 2:42829681-42829703 CTCCCACTGTGGTGCTGTTGGGG + Intergenic
930217371 2:48710565-48710587 CTCCCAATGATGTGACCTTGCGG + Intronic
932411926 2:71552708-71552730 CCCCCACTCAGCTGATGTGGTGG + Intronic
932581810 2:72996965-72996987 CTCCCACTCAGGGGAGCCTTTGG + Intronic
933956225 2:87375062-87375084 CTGCCATTCAGGTGCTCTTCAGG - Intergenic
934240375 2:90267086-90267108 CTGCCATTCAGGTGCTCTTCAGG - Intergenic
935698637 2:105791027-105791049 CTCCCACTCAGGAAACTTTGGGG + Intronic
936195794 2:110371787-110371809 CTGCCATTCAGGTGCTCTTCAGG - Intergenic
938114471 2:128593997-128594019 CTCCCACGCAGCTGTTCCTGGGG - Intergenic
943104051 2:183521025-183521047 CTCTCTCCCAGGTCATCTTGTGG - Intergenic
943847838 2:192674533-192674555 CTTCCACTCTGGTGTCCTTGAGG + Intergenic
946740837 2:222799701-222799723 CACACACTCAGCTGATCATGAGG + Intergenic
1169022439 20:2340042-2340064 GTCCCACCCAGGGGATCTGGAGG - Intronic
1170399184 20:15961229-15961251 TTCTCACTCAGGTGAGTTTGTGG + Intronic
1171425681 20:25047165-25047187 CTGCCACTCGGGTGACCTGGGGG - Intronic
1172993699 20:39054327-39054349 TTCCCAGCCAGGGGATCTTGGGG - Intergenic
1173069941 20:39754187-39754209 CTCCCACTCCAGTGTTCTGGAGG + Intergenic
1174964048 20:55190737-55190759 CTCCCACTCACCTGACCTTATGG - Intergenic
1175307493 20:57986999-57987021 CTCCCACTGAGGTCATCTGCTGG - Intergenic
1181411261 22:22721405-22721427 CTTCCATTCAGGTCATCTTGAGG - Intergenic
1182775257 22:32826780-32826802 CTGCCACTCAGGAGTTCATGGGG + Intronic
1183251866 22:36735965-36735987 CTCCCACTCAGATGCTCCTTAGG + Intergenic
1183596126 22:38813044-38813066 TTCCCAGCCATGTGATCTTGGGG + Intergenic
949372458 3:3350118-3350140 CTCACATACAGGTTATCTTGTGG + Intergenic
949439923 3:4069564-4069586 CTCCCACACATGTGCTCATGGGG - Intronic
952080215 3:29748847-29748869 GTCCCACTCAGGTGGGCGTGTGG + Intronic
954329374 3:49881354-49881376 CTCCCACTTAGGAGGTCTTGAGG + Intergenic
961479447 3:127170749-127170771 CTGCAACTCAGGTGGGCTTGGGG + Intergenic
964295853 3:155232392-155232414 GTGTCACTCAGGTGAACTTGGGG - Intergenic
964364727 3:155937667-155937689 CTCCCACTCAGTAGTTCCTGGGG - Exonic
969600783 4:8174974-8174996 CTCCCACTCAGTAGTTCCTGGGG - Intergenic
970240550 4:14004009-14004031 CTCCTACTTATGTGTTCTTGTGG - Intergenic
973159189 4:46994064-46994086 CTCCCATTCAGGTGTTATGGGGG + Exonic
977832559 4:101611418-101611440 CTCCTACTCAGTTAACCTTGGGG - Intronic
980751669 4:137098085-137098107 CTCCCACTGAAGTGATTTTCAGG + Intergenic
981093694 4:140757439-140757461 CTCCCGCCCAGGAGATCTGGAGG + Intergenic
984261144 4:177444788-177444810 CTCTCACTTAGGTGCTCTTTTGG + Intergenic
990908695 5:60832149-60832171 CCACCACTCAGGTGACCTTGGGG + Intronic
992005803 5:72476297-72476319 CTCCCACCCAAGAGATCCTGAGG - Intronic
993680010 5:90865330-90865352 CACCCACTCTGGTGATTTTTTGG + Intronic
998712081 5:144837678-144837700 CTCCCAATAAGGAGAGCTTGGGG - Intergenic
999322192 5:150622436-150622458 CTCCCACTCGGATGCTCTGGGGG + Intronic
1001191376 5:169635932-169635954 CTCCTACTCTGGTCATCTGGTGG + Intergenic
1008362210 6:50633544-50633566 TTACCAATCAGTTGATCTTGAGG - Intergenic
1008652463 6:53577095-53577117 CTTCCCCTCAGGTTATTTTGAGG + Intronic
1010330973 6:74623708-74623730 CTCCCTCTCAGTTGCTTTTGTGG - Intergenic
1018972040 6:168536549-168536571 CTTCCAGTCATGTTATCTTGAGG + Intronic
1020187988 7:5973531-5973553 CTCACACTCAGGTGATGATTGGG - Exonic
1020294930 7:6751238-6751260 CTCACACTCAGGTGATGATTGGG + Intergenic
1022559071 7:31330874-31330896 CTCCCACTCAGTAGTTCCTGGGG - Intergenic
1022628995 7:32067615-32067637 ATCCCACTGTGGTGATCATGTGG - Intronic
1024994499 7:55261581-55261603 CTCACACTAGGGTGAACTTGGGG - Intergenic
1030360456 7:108590073-108590095 CTCCCACTCAGCTGCCCTGGAGG + Intergenic
1033076928 7:138258424-138258446 ATCCCACTCATCTGGTCTTGTGG + Intergenic
1038768532 8:30453784-30453806 CTCCCACTGAGATGAGATTGTGG - Intronic
1040392913 8:46964721-46964743 CTCCCACTCTGGAACTCTTGTGG + Intergenic
1042356349 8:67832623-67832645 CTCCTCCTCAGGTGCTCCTGTGG - Intergenic
1044585381 8:93864896-93864918 ATCCCACTCAGGAGATGGTGGGG - Intronic
1049146797 8:141006435-141006457 CTTCCACTCGGGGGAACTTGTGG - Intergenic
1049664871 8:143838526-143838548 CTCCCACTGAGGTCCTCTTTGGG + Intronic
1054893242 9:70276293-70276315 CGCCCAATCAAGTGATCTTGAGG - Intronic
1058833460 9:108839840-108839862 CTCCCACTTAGGAGAACATGTGG - Intergenic
1060058619 9:120438637-120438659 CTCCTTCTCAGGTGATTTTGAGG + Intronic
1060468439 9:123929024-123929046 CTCCCAGCCAGGTCCTCTTGTGG - Intronic
1061545867 9:131304001-131304023 CCCCATCTCAGGTGACCTTGGGG - Intronic
1062412855 9:136433581-136433603 CGCCCACACAGGTGCTCTGGGGG - Intronic
1186187007 X:7030523-7030545 CCCCTGCTCAGGTCATCTTGTGG + Intergenic
1188081297 X:25844279-25844301 CTCTTACTGAGGAGATCTTGAGG - Intergenic
1188996818 X:36896902-36896924 TTCCTTCTCCGGTGATCTTGAGG + Intergenic
1189314658 X:40046148-40046170 CTCCCACTGGGATGATTTTGAGG + Intergenic
1192674649 X:73183072-73183094 CTCCCAGTCAGGTGACATGGAGG - Intergenic
1193949400 X:87779100-87779122 CTCCCAGTCAGGAGACATTGGGG - Intergenic
1199727553 X:150599505-150599527 CTTCTACACAGGTGACCTTGAGG + Intronic
1200097503 X:153671066-153671088 CTCAGAATCAGGTGAGCTTGAGG - Exonic
1201339742 Y:12921852-12921874 CTCCTGCTCAGGTGATTTTTAGG + Intergenic