ID: 1068301820

View in Genome Browser
Species Human (GRCh38)
Location 10:55153287-55153309
Sequence CCTCCCACTCAGGTGATCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068301820_1068301830 27 Left 1068301820 10:55153287-55153309 CCCAAGATCACCTGAGTGGGAGG 0: 1
1: 0
2: 1
3: 6
4: 137
Right 1068301830 10:55153337-55153359 CAAGTTGCTCACCTTGACACGGG No data
1068301820_1068301829 26 Left 1068301820 10:55153287-55153309 CCCAAGATCACCTGAGTGGGAGG 0: 1
1: 0
2: 1
3: 6
4: 137
Right 1068301829 10:55153336-55153358 CCAAGTTGCTCACCTTGACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068301820 Original CRISPR CCTCCCACTCAGGTGATCTT GGG (reversed) Intronic
902997125 1:20234915-20234937 ACTCCCACTCAGGTACTCTAAGG - Intergenic
904576657 1:31509317-31509339 CCTCACACTCATTTGAGCTTGGG + Intergenic
905280675 1:36847027-36847049 CCTCACCCTCCGGTGATCTCTGG + Intronic
906536378 1:46553004-46553026 GCTCCAACTCAGGTGACCCTGGG - Intergenic
906667245 1:47630637-47630659 CCTCCCACACAGGTTTTCCTGGG + Intergenic
907457191 1:54583229-54583251 CCTCCTACCCAGGGGCTCTTGGG + Intronic
907526898 1:55058989-55059011 CCTCTCACTCAGGTGCTCCATGG + Intronic
909438427 1:75671180-75671202 CCTGGCCCTGAGGTGATCTTAGG + Intergenic
909591456 1:77353733-77353755 CCTCCCACTCAGCTGGCCTCTGG + Intronic
910851651 1:91655031-91655053 CCTGACACTCAGCTGCTCTTGGG + Intergenic
911630107 1:100174132-100174154 CCTCCCACTCTAGTTTTCTTTGG - Intronic
914866285 1:151432244-151432266 CATCCCATTCTGGTGATTTTGGG - Intronic
916389867 1:164319962-164319984 CCTCCAACTCTGTGGATCTTAGG + Intergenic
920054412 1:203181964-203181986 CCTCCCACCCCAGTCATCTTAGG - Intronic
923504403 1:234593024-234593046 CTTCCCACTCAGGTCTTCTGTGG - Intergenic
1064351748 10:14583451-14583473 CTTCCCGCTAAGGTGAGCTTGGG - Intronic
1067043287 10:42969957-42969979 CCTCCCCCTCAGGAGACCCTGGG - Intergenic
1068301820 10:55153287-55153309 CCTCCCACTCAGGTGATCTTGGG - Intronic
1073794438 10:106972568-106972590 CCCCCCACCTAGCTGATCTTGGG - Intronic
1073810739 10:107149993-107150015 CCTCCCACTCAGGCAAAATTAGG + Intronic
1074311539 10:112327176-112327198 CCAACCACTCAGGTAACCTTTGG - Intergenic
1074418036 10:113284526-113284548 ACTCACACTCAGATCATCTTAGG - Intergenic
1075945809 10:126432191-126432213 CCTCTCACTCAAGTGAGGTTGGG - Intronic
1076005370 10:126944487-126944509 CCTCCCACACAGGTCATCTCTGG - Intronic
1077234075 11:1471482-1471504 CCACCCGCTCAGGTCATCTGCGG + Intronic
1077846078 11:6026407-6026429 CTTCCCACATATGTGATCTTTGG + Intergenic
1078961406 11:16277024-16277046 TCTCCCACTAAAGTGTTCTTTGG - Intronic
1079849164 11:25508834-25508856 CTTCATACTCAGGTAATCTTAGG + Intergenic
1085071065 11:73546271-73546293 CCCCCCACATAGGTGAACTTGGG - Intronic
1086903096 11:92389755-92389777 CCTGACACTCATGTGATCATCGG - Intronic
1087216367 11:95499511-95499533 CTTGCCAGTCATGTGATCTTGGG - Intergenic
1087938343 11:104062081-104062103 CCTCCCACTCAGAAAAGCTTAGG - Intronic
1090840274 11:130481560-130481582 CCTCTCATTCAGAAGATCTTCGG - Intergenic
1092255234 12:6923415-6923437 CCTCCCACCCCAGTCATCTTGGG - Exonic
1093395202 12:18672701-18672723 CCTCCCAGTGAGGTCACCTTGGG - Intergenic
1095329218 12:40937428-40937450 AATCCCACTCAGTTCATCTTAGG + Intronic
1098633752 12:72756319-72756341 ACTCCCACTTATGTGATATTTGG - Intergenic
1101327370 12:103727916-103727938 CCTGCTAGTCATGTGATCTTGGG - Intronic
1101718187 12:107329290-107329312 CCTACAAGCCAGGTGATCTTGGG + Intronic
1102394771 12:112576158-112576180 CTTGCTACTCATGTGATCTTGGG - Intronic
1104404196 12:128504053-128504075 CCTCCCTCTCACGTCATCTCAGG + Intronic
1108076002 13:46680353-46680375 CCTCCCACCCAGGAGCTCATAGG + Intronic
1108550466 13:51538946-51538968 CCTCCCACTCTGATGATCTTTGG + Intergenic
1110913037 13:80987346-80987368 CCTCCCTCTGAGGTGTTATTTGG - Intergenic
1113531080 13:111028007-111028029 CCACCCACTCAGGGCTTCTTGGG - Intergenic
1124019821 15:25909913-25909935 CCTCCCACTCCGCTGATGATGGG + Intergenic
1124141497 15:27080993-27081015 CACCCCACTCAGGTCCTCTTAGG + Intronic
1128680146 15:69645526-69645548 CATCCCACTGAGGTGGTATTAGG - Intergenic
1130098243 15:80872027-80872049 CCTCCCACACAGGTGTGCTTGGG - Intronic
1132220771 15:100103437-100103459 CCTGCCTCACAGATGATCTTTGG + Intronic
1132240656 15:100255044-100255066 CCACCCACCCAGGGGATCCTGGG - Intronic
1133934490 16:10257528-10257550 CTTCCCAAGTAGGTGATCTTGGG + Intergenic
1134630175 16:15750499-15750521 TCTGCCACTCAGGTGCTCTCAGG - Intronic
1139419447 16:66841313-66841335 CAACCCACTCAGGTCAACTTGGG - Intronic
1141799055 16:86294989-86295011 CCTCCCAGTCACGTGCTCTGTGG + Intergenic
1142205820 16:88782695-88782717 CCTCCCTCTCTGGCGAGCTTTGG - Intronic
1146452224 17:32983667-32983689 CCTCTCACTCTGCAGATCTTGGG - Intronic
1148503720 17:48111192-48111214 CAACCCACTCAGGTGCTCCTTGG + Intronic
1150183010 17:63146865-63146887 CCTGCCTCCCAGGTGATCATGGG + Intronic
1151534014 17:74727229-74727251 TCTCCCACACAGGAGATCTATGG + Intronic
1157850528 18:51044875-51044897 TCTCCCATGCAGGTTATCTTTGG + Intronic
1157945938 18:51980968-51980990 AGTCCCACTCAGGTCTTCTTAGG - Intergenic
1158351349 18:56567515-56567537 CTACCCACTCAGGTTCTCTTAGG - Intergenic
1158579903 18:58671841-58671863 CCTCCGCCTCAGGTGAGCTCAGG + Exonic
1159658376 18:71060451-71060473 CCTCCCACTCAGGGGCTTTGAGG - Intergenic
1161666150 19:5578279-5578301 CCTCCCACAAAGGTGGTGTTGGG + Intergenic
1162391663 19:10393623-10393645 GCTCCCAAGCAGGTGGTCTTTGG - Intronic
1165723475 19:38096114-38096136 CCTCTCGCCCAGGTGCTCTTTGG + Intronic
1167160320 19:47763317-47763339 CCTCCCACTCAAGAGACTTTTGG - Intergenic
925281716 2:2689881-2689903 CCTCCCAATCAGGTGCCCTGGGG + Intergenic
928277044 2:29911613-29911635 TCTGCCACTCAGGTGAGCTGAGG - Intronic
929878385 2:45815833-45815855 CCTTCCAGTTAGGTGACCTTGGG + Intronic
931134087 2:59377219-59377241 CAGCTCACTCTGGTGATCTTGGG + Intergenic
937988723 2:127650446-127650468 CCTGCCACCCAGGAGATCTGAGG - Intronic
938114472 2:128593998-128594020 CCTCCCACGCAGCTGTTCCTGGG - Intergenic
939719608 2:145632451-145632473 CCTCCCACTCAACTGATTTGTGG - Intergenic
940108440 2:150124401-150124423 CCTACCACTCAGGGGACCCTGGG + Intergenic
943798109 2:192023822-192023844 CCCCCAAGTCAGGTGATCTAAGG - Intronic
1168816780 20:743232-743254 CCTCGCACTCAGGTGCTCCAGGG + Intergenic
1171425682 20:25047166-25047188 CCTGCCACTCGGGTGACCTGGGG - Intronic
1174512290 20:51062878-51062900 GCTGCCACTCAGCTGATTTTTGG + Intergenic
1174835495 20:53852828-53852850 CCTTCTATTCAGATGATCTTAGG - Intergenic
1180706039 22:17810556-17810578 CCTGCCACCCAGGTCACCTTTGG - Intronic
1182742886 22:32581626-32581648 CCACCCACTTAGGGTATCTTAGG - Intronic
1182775256 22:32826779-32826801 CCTGCCACTCAGGAGTTCATGGG + Intronic
1183538582 22:38417052-38417074 CCTCCCTCTCGGGTGGTCCTGGG - Intergenic
1183596125 22:38813043-38813065 CTTCCCAGCCATGTGATCTTGGG + Intergenic
1185338519 22:50281489-50281511 CCCCCCACACAGGTGAAGTTCGG - Exonic
951025124 3:17820237-17820259 CCTCCCACCCCAGTGATCTCTGG - Intronic
951990288 3:28668942-28668964 CCTCCTATTTATGTGATCTTGGG + Intergenic
954252676 3:49380263-49380285 CCTGGATCTCAGGTGATCTTGGG + Intronic
955579363 3:60402298-60402320 TCTCCCACCCACGTGCTCTTTGG - Intronic
955802110 3:62697069-62697091 CAACCCACTCATGGGATCTTGGG + Intronic
957190162 3:76997872-76997894 CCTCCCTCTGAGGTCATTTTGGG - Intronic
960511862 3:118558977-118558999 CCTTCCACCCAGGTTATTTTTGG - Intergenic
960603746 3:119483831-119483853 CCTCCCACCCAGGGGACATTTGG - Intronic
961479446 3:127170748-127170770 CCTGCAACTCAGGTGGGCTTGGG + Intergenic
961678713 3:128584324-128584346 CCTTCCTCCCAGGGGATCTTTGG + Intergenic
967419052 3:189253284-189253306 ACTCCCACTCATGTGGTGTTTGG + Intronic
970694802 4:18664537-18664559 CCTCCCACTGAGCTGATCTGAGG + Intergenic
971201283 4:24511517-24511539 CTTCCCACTCAGGTTACCTGGGG - Intergenic
972862961 4:43193675-43193697 CCTACTACTCATGTGATCTTGGG + Intergenic
973159188 4:46994063-46994085 CCTCCCATTCAGGTGTTATGGGG + Exonic
974618588 4:64324841-64324863 CCTACCACACATGTGTTCTTAGG - Intronic
979442230 4:120764552-120764574 GCTCCTACTCAGTTGATTTTGGG - Intronic
981557420 4:146009915-146009937 CCTCTCACTCAGGTAATCAAAGG + Intergenic
981781936 4:148441087-148441109 CCGCTCTCTCAGGTGACCTTGGG - Intronic
983625108 4:169794530-169794552 CCTCCCACTTATGTGAACTTGGG + Intergenic
983633817 4:169877772-169877794 CCTCCCACTTATATGAACTTGGG - Intergenic
986990621 5:13548822-13548844 CCATCCGCTAAGGTGATCTTTGG - Intergenic
989405870 5:41060071-41060093 TTTCTGACTCAGGTGATCTTGGG - Intronic
990908693 5:60832148-60832170 GCCACCACTCAGGTGACCTTGGG + Intronic
997446733 5:133945773-133945795 CCTCCCTCTCTGGTGAGCCTTGG + Intergenic
999263564 5:150252184-150252206 CCTGCCCCTCAGGTGCACTTGGG + Intronic
999302673 5:150500837-150500859 CCACCCACTCAAGTGACATTAGG - Intronic
999322191 5:150622435-150622457 CCTCCCACTCGGATGCTCTGGGG + Intronic
1003244694 6:4374047-4374069 CCTCCCACTTTGGTGATCCCAGG - Intergenic
1004903166 6:20212294-20212316 CCTCCCGCCCGGGTGCTCTTGGG + Exonic
1005494996 6:26380680-26380702 CCTCCTGCTCAGATGAACTTTGG + Intergenic
1008395027 6:50996127-50996149 CCTCACACTCCTCTGATCTTGGG + Intergenic
1010500892 6:76598927-76598949 CCTTCCACTTAGATTATCTTTGG - Intergenic
1019836054 7:3385147-3385169 CTTTCCACTCACGTCATCTTAGG + Intronic
1020187989 7:5973532-5973554 TCTCACACTCAGGTGATGATTGG - Exonic
1020259011 7:6520359-6520381 CCTCCTAGTCACGTGACCTTGGG - Intronic
1020294929 7:6751237-6751259 TCTCACACTCAGGTGATGATTGG + Intergenic
1024994500 7:55261582-55261604 CCTCACACTAGGGTGAACTTGGG - Intergenic
1027487663 7:78782145-78782167 CCTCCAACTCAGGAGAACGTCGG + Intronic
1028388732 7:90290607-90290629 CCTCCCATTCAGGTGGTCCCAGG - Intronic
1035624514 8:1060884-1060906 CCTCACAGTCAAGGGATCTTAGG + Intergenic
1035873701 8:3164028-3164050 CCTCCGACTCAGCAGATCTGGGG - Intronic
1037501760 8:19493218-19493240 GCTTCCACTCAGGAGCTCTTCGG + Intronic
1037816382 8:22114882-22114904 CCTCCCACTGAGGAGACTTTGGG - Exonic
1040479147 8:47807941-47807963 CCTGACCCTCAGGTGATCCTTGG + Intronic
1041037949 8:53814319-53814341 CCTCACACGCACGTGCTCTTTGG + Intronic
1046778644 8:118191420-118191442 CCTCCCTTTCTGGTGATCTGAGG + Intronic
1049211945 8:141391029-141391051 CAGCCCAGTCAGGTGGTCTTGGG + Intergenic
1049664870 8:143838525-143838547 GCTCCCACTGAGGTCCTCTTTGG + Intronic
1051628721 9:19123554-19123576 CCATCAACTCAGGTGAGCTTGGG - Exonic
1060516697 9:124270399-124270421 CCTCCCACTCTGGGGACCTGGGG - Intronic
1062103741 9:134741552-134741574 CCTCCCTCTCAGGTGATAAGGGG + Intronic
1062412856 9:136433582-136433604 CCGCCCACACAGGTGCTCTGGGG - Intronic
1188455134 X:30355512-30355534 CCAACCACTCAGGTGGTCTTCGG - Intergenic
1194253360 X:91604856-91604878 CCTCCAACTCAGTTGAGATTTGG - Intergenic
1198493635 X:137168436-137168458 CCTCCCACACAGCTGTTTTTGGG - Intergenic
1202191535 Y:22250848-22250870 GCTCCCCCTCAGGTCCTCTTTGG - Intergenic