ID: 1068301822

View in Genome Browser
Species Human (GRCh38)
Location 10:55153288-55153310
Sequence ACCTCCCACTCAGGTGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068301822_1068301830 26 Left 1068301822 10:55153288-55153310 CCAAGATCACCTGAGTGGGAGGT 0: 1
1: 0
2: 0
3: 9
4: 143
Right 1068301830 10:55153337-55153359 CAAGTTGCTCACCTTGACACGGG No data
1068301822_1068301829 25 Left 1068301822 10:55153288-55153310 CCAAGATCACCTGAGTGGGAGGT 0: 1
1: 0
2: 0
3: 9
4: 143
Right 1068301829 10:55153336-55153358 CCAAGTTGCTCACCTTGACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068301822 Original CRISPR ACCTCCCACTCAGGTGATCT TGG (reversed) Intronic
904576655 1:31509316-31509338 ACCTCACACTCATTTGAGCTTGG + Intergenic
904599188 1:31664506-31664528 ACCACCCACTCAGCACATCTAGG + Intronic
906536379 1:46553005-46553027 AGCTCCAACTCAGGTGACCCTGG - Intergenic
907040751 1:51257133-51257155 ACCTCCCACCCACCTTATCTGGG + Intronic
911194687 1:94982045-94982067 ACTTACTACTCATGTGATCTTGG + Exonic
911616904 1:100023653-100023675 CTCTCCCACTCATGTGATCAGGG - Exonic
915599125 1:156911525-156911547 CCATCCGCCTCAGGTGATCTTGG + Intronic
921128719 1:212200600-212200622 ACTACCCAGTCAGGTGATCAGGG - Intergenic
922558079 1:226548507-226548529 CCCTCCCAGACAGGTGAACTAGG - Intergenic
1064351749 10:14583452-14583474 ACTTCCCGCTAAGGTGAGCTTGG - Intronic
1066498051 10:35961607-35961629 ACCTCCTTCCCAGGAGATCTGGG - Intergenic
1066650168 10:37647561-37647583 ACCCCCAACTTGGGTGATCTTGG + Intergenic
1068301822 10:55153288-55153310 ACCTCCCACTCAGGTGATCTTGG - Intronic
1070540463 10:77412021-77412043 ACCTCCCACTCAGGTGCGTCAGG - Intronic
1075406383 10:122198547-122198569 ATCTCCCACTCAGGTGAGGGAGG + Intronic
1075657953 10:124174293-124174315 ACCTCCTACTCAGGTGCTCAGGG + Intergenic
1076475159 10:130746576-130746598 TCCCTCCACTCAGGTGCTCTGGG + Intergenic
1077661289 11:4070753-4070775 ACTTCCAACTCAGATGGTCTGGG + Intronic
1078122615 11:8525174-8525196 AGCTCCCCCTAAGCTGATCTAGG + Intronic
1078354330 11:10623084-10623106 TGCTACCACTCAGGTGACCTGGG - Intronic
1081591963 11:44429593-44429615 ACCTCCCAACCAGGTGTTCAAGG + Intergenic
1084642164 11:70432401-70432423 ACCGCGCACCCAGGAGATCTGGG - Intronic
1086064297 11:82730933-82730955 GCCTCTCACTCAGATGTTCTGGG + Exonic
1087216368 11:95499512-95499534 ACTTGCCAGTCATGTGATCTTGG - Intergenic
1088971263 11:114776345-114776367 GCCTCCCACTCTGGAGAGCTCGG - Intergenic
1089729812 11:120512574-120512596 ACTTCCCACTCGGATGAACTAGG - Intronic
1090832215 11:130427781-130427803 ACCTCCCACTCGGGTCCTCGCGG + Exonic
1092255236 12:6923416-6923438 ACCTCCCACCCCAGTCATCTTGG - Exonic
1096283504 12:50277569-50277591 ATCAACCAATCAGGTGATCTTGG - Intronic
1098618043 12:72554420-72554442 TCCTACCAGTCATGTGATCTTGG - Intronic
1102072971 12:110036955-110036977 ACTTCCCACTGAGGACATCTAGG - Intronic
1102394772 12:112576159-112576181 ACTTGCTACTCATGTGATCTTGG - Intronic
1104658465 12:130591702-130591724 ACCACCCACCCAGGTGCTCCAGG + Intronic
1105447206 13:20467964-20467986 ACCTCACACTTAAGGGATCTAGG + Intronic
1107898985 13:44993532-44993554 AACTCTGATTCAGGTGATCTGGG + Intronic
1107899252 13:44995767-44995789 AACTCTGATTCAGGTGATCTGGG + Intronic
1107993382 13:45838101-45838123 ACCTCCCTCCAAGGTGACCTTGG - Intronic
1113323201 13:109257579-109257601 ACTTCCCAGACAGGTGACCTTGG + Intergenic
1113531082 13:111028008-111028030 ACCACCCACTCAGGGCTTCTTGG - Intergenic
1116935183 14:50732358-50732380 ACCTATCCCTCAGGTGAGCTGGG + Intronic
1120744050 14:88137825-88137847 CCCTACCACACAGGTGATATTGG + Intergenic
1122625859 14:103085054-103085076 ACACCCCACTCAGGTCAGCTGGG - Intergenic
1124492740 15:30168026-30168048 TCCTCTCATGCAGGTGATCTGGG + Intergenic
1124750794 15:32370299-32370321 TCCTCTCATGCAGGTGATCTGGG - Intergenic
1125224277 15:37377478-37377500 ACTTCCCATTCAGCTGAACTGGG - Intergenic
1125790798 15:42364214-42364236 ACCTAACACTTAGGTAATCTTGG + Intronic
1126574678 15:50185078-50185100 ACCTCCCTCTCAGGGGACCTGGG - Intronic
1128361127 15:66962429-66962451 CCCTCCCACTCAGGGACTCTGGG - Intergenic
1128590685 15:68894240-68894262 TCCTCCCACTTAGGTGAAATAGG + Intronic
1128722098 15:69957583-69957605 CCCTTCCTCTCAGGTAATCTGGG + Intergenic
1130098245 15:80872028-80872050 ACCTCCCACACAGGTGTGCTTGG - Intronic
1131183879 15:90258690-90258712 ACCACCTGCTCAGGTGGTCTGGG + Intronic
1131574428 15:93572368-93572390 ACCTCCCACTCAGTTGGGTTCGG + Intergenic
1131681654 15:94729932-94729954 ACATCCAACACAGGTGTTCTTGG - Intergenic
1132240658 15:100255045-100255067 ACCACCCACCCAGGGGATCCTGG - Intronic
1133934489 16:10257527-10257549 ACTTCCCAAGTAGGTGATCTTGG + Intergenic
1135569099 16:23534768-23534790 ACCTACCAGCCAGGTGACCTTGG - Intronic
1138482294 16:57311538-57311560 ACCCCACACTCATGTGAGCTGGG + Intergenic
1148089265 17:45013106-45013128 ACCTCCTTCTCAGCTGCTCTAGG - Intergenic
1149526633 17:57361058-57361080 ACCCCCCACTCAGTTCAGCTAGG - Intronic
1149865224 17:60147873-60147895 CTCTCCCACTCAGGTGGCCTGGG + Intergenic
1150183008 17:63146864-63146886 ACCTGCCTCCCAGGTGATCATGG + Intronic
1156460706 18:37319885-37319907 ACCTCCCAGCCAGGAGCTCTTGG - Intronic
1156963819 18:43065745-43065767 AACTCCCACTTATGTGATCATGG + Intronic
1157136993 18:45065870-45065892 ACCTTCCTCTCAGGTGACTTTGG - Exonic
1157284419 18:46367749-46367771 ACCTAACATTCAGGGGATCTGGG - Intronic
1159559599 18:69979313-69979335 AGCTGTCACTCAGGTTATCTGGG - Intergenic
1159723476 18:71922864-71922886 ACATCCCACTCAGAGGAACTAGG + Intergenic
1159939395 18:74395063-74395085 ACCACCCACTCATGTGACGTGGG + Intergenic
1160144439 18:76352076-76352098 TCCTCCCACTGAGCTGAGCTTGG - Intergenic
1161540998 19:4851531-4851553 ACATCCCACTCCAGTCATCTCGG - Intronic
1162441653 19:10696021-10696043 ACCGCCCACTTAGGAGAGCTGGG - Intergenic
1164587520 19:29485305-29485327 ACCTCCTCCTCAGGTGGGCTGGG - Intergenic
1166877838 19:45908615-45908637 ACCGCCCCCTCAGATTATCTAGG + Intergenic
1166942556 19:46375591-46375613 CCCTCCCACCCAGGTGGTCAAGG + Exonic
1166965442 19:46527063-46527085 CCCTCCCACCCAGGTGGTCAAGG - Exonic
1168306532 19:55438929-55438951 ACCTCCCACTCATGTCCACTTGG + Intronic
925281714 2:2689880-2689902 TCCTCCCAATCAGGTGCCCTGGG + Intergenic
926705703 2:15835963-15835985 ACCTCCCATTCAGCTAACCTGGG + Intergenic
927422710 2:22949784-22949806 ATCTCACACTCAGGTGATGGTGG - Intergenic
927842857 2:26456481-26456503 TCCTCCCACTCAGGTGTTGCGGG + Exonic
929759734 2:44797038-44797060 ACCTCGCACTGAGTTGATCAGGG - Intergenic
933290362 2:80431583-80431605 GCCTCACACTCAGGTGAACAAGG + Intronic
935123307 2:100200439-100200461 ACCACCCACTCAGGCAAGCTTGG + Intergenic
937450533 2:121998768-121998790 ACCTCCAACTTATGTGTTCTAGG - Intergenic
938114474 2:128593999-128594021 ACCTCCCACGCAGCTGTTCCTGG - Intergenic
941207336 2:162590283-162590305 TCCTCCCACTCAGATGCACTCGG - Intronic
943795457 2:191987220-191987242 ACCTCCCATTCAGGGGACATTGG - Intronic
944617955 2:201482250-201482272 AACTCACACACAAGTGATCTAGG - Intergenic
1168816778 20:743231-743253 TCCTCGCACTCAGGTGCTCCAGG + Intergenic
1169058720 20:2644711-2644733 ACCAGCCAGTAAGGTGATCTGGG + Intergenic
1169149371 20:3277202-3277224 TCCTCCTACTCAGGTCATCAGGG + Intronic
1171425684 20:25047167-25047189 CCCTGCCACTCGGGTGACCTGGG - Intronic
1173812436 20:45964234-45964256 ACCTCCCAGTCAGGAGACCTGGG + Intronic
1174446130 20:50592570-50592592 AACTCCCATTCAGGGGACCTGGG - Intronic
1176719650 21:10382748-10382770 ACCTCCTACTCAGGAGACCGAGG + Intergenic
1179550440 21:42140393-42140415 ACCTCCCAACCACGTGACCTGGG - Intronic
1179550455 21:42140439-42140461 ACCTCCCAGCCATGTGACCTGGG - Intronic
1179993513 21:44960775-44960797 ACTTCCCACTCAGGTTGTTTTGG + Intronic
1180300887 22:11035710-11035732 ACCTCCTACTCAGGAGACCGAGG + Intergenic
1183538584 22:38417053-38417075 ACCTCCCTCTCGGGTGGTCCTGG - Intergenic
1183596124 22:38813042-38813064 ACTTCCCAGCCATGTGATCTTGG + Intergenic
1183734890 22:39638876-39638898 ACTTCACACTCAAGAGATCTAGG - Intronic
1184616483 22:45641444-45641466 ACCTCCCAGTCAGGATCTCTGGG - Intergenic
951865512 3:27302744-27302766 ACTTCCCTCTCATGTCATCTGGG + Intronic
953237424 3:41118890-41118912 CCCCTCCACTCACGTGATCTGGG + Intergenic
954367956 3:50156044-50156066 TCCTCCCACTCTGCTGATGTGGG - Intronic
957199049 3:77108611-77108633 ACCTTCCACCCTGGTGATGTAGG + Intronic
960204577 3:114879814-114879836 ACCTCCAGCACAGGTGATGTTGG - Intronic
971201284 4:24511518-24511540 ACTTCCCACTCAGGTTACCTGGG - Intergenic
972634490 4:40871059-40871081 AGGTCCCACTCAGGTAATCCAGG + Intronic
972862959 4:43193674-43193696 ACCTACTACTCATGTGATCTTGG + Intergenic
973159186 4:46994062-46994084 CCCTCCCATTCAGGTGTTATGGG + Exonic
975446005 4:74466371-74466393 ACCTGCCACTCAGGTAACTTGGG + Intergenic
979442231 4:120764553-120764575 AGCTCCTACTCAGTTGATTTTGG - Intronic
979971882 4:127145770-127145792 ACTTCCAAGTCAGTTGATCTAGG - Intergenic
980715901 4:136629245-136629267 ACCACCCAGTCAGGGGATCTTGG - Intergenic
981148754 4:141356535-141356557 ACCTCACCATCATGTGATCTAGG - Intergenic
983625106 4:169794529-169794551 ACCTCCCACTTATGTGAACTTGG + Intergenic
983633819 4:169877773-169877795 ACCTCCCACTTATATGAACTTGG - Intergenic
990908692 5:60832147-60832169 AGCCACCACTCAGGTGACCTTGG + Intronic
990938397 5:61174787-61174809 ACCTGGCACTCAGTAGATCTTGG - Intergenic
991329549 5:65478993-65479015 ACTTCCCACTCAAGTGATCGGGG + Intronic
995769203 5:115651609-115651631 ACCTGCCACTGAGGTAATGTGGG - Intergenic
998407969 5:141884664-141884686 ACTTACTACTCAGGTGACCTTGG + Intergenic
999322189 5:150622434-150622456 CCCTCCCACTCGGATGCTCTGGG + Intronic
1000870645 5:166573144-166573166 ACTTCCCACTGAGGTACTCTAGG + Intergenic
1003271938 6:4615009-4615031 ACCACCAACTCTGGTGATGTAGG + Intergenic
1006878776 6:37321224-37321246 ATCACTCACTCAGGTGACCTTGG - Intronic
1006885965 6:37382555-37382577 TCCCCCGACTCAGCTGATCTTGG - Intronic
1020259013 7:6520360-6520382 ACCTCCTAGTCACGTGACCTTGG - Intronic
1034870080 7:154676084-154676106 ACCTCCTACACAGGTGTTCCGGG + Intronic
1034870092 7:154676157-154676179 ACCTCCTACACAGGTGTTCCGGG + Intronic
1035873703 8:3164029-3164051 GCCTCCGACTCAGCAGATCTGGG - Intronic
1044716876 8:95107967-95107989 TCCTCCCACCCAAATGATCTTGG + Intronic
1044841491 8:96340625-96340647 ACCTGCAGCTGAGGTGATCTGGG - Intergenic
1045634039 8:104162026-104162048 TGGGCCCACTCAGGTGATCTAGG + Intronic
1049919155 9:347072-347094 GACTCCCATTCAGGTGGTCTGGG + Intronic
1051877733 9:21809184-21809206 AGGTCCCACCCAGGTAATCTAGG + Intronic
1053707286 9:40768387-40768409 ACCTGCCACTGAGGTGCTGTCGG + Intergenic
1054417202 9:64889155-64889177 ACCTGCCACTGAGGTGCTGTCGG + Intergenic
1057792785 9:98135075-98135097 ACCTCCCACTCAGTGGCTATGGG + Intronic
1058752439 9:108052408-108052430 CCCTCTCACTCAGTTGATGTTGG - Intergenic
1060516699 9:124270400-124270422 CCCTCCCACTCTGGGGACCTGGG - Intronic
1062103739 9:134741551-134741573 GCCTCCCTCTCAGGTGATAAGGG + Intronic
1062412858 9:136433583-136433605 GCCGCCCACACAGGTGCTCTGGG - Intronic
1185431601 X:14619-14641 ACCTCCCACCCGGGTCACCTCGG - Intergenic
1185432867 X:19634-19656 ACCTCCCACCCGGGTCACCTCGG - Intergenic
1185442219 X:232456-232478 ACCTCCCACCCGGGTCACCTCGG - Intergenic
1187007352 X:15245721-15245743 ACCGCACACTCAGATGACCTCGG - Intronic
1188320529 X:28731643-28731665 ACCTCTCACTCTCTTGATCTAGG - Intronic
1196042465 X:111219753-111219775 ACCTCCCACTCATAAGAACTTGG - Intronic
1198493637 X:137168437-137168459 ACCTCCCACACAGCTGTTTTTGG - Intergenic