ID: 1068301823

View in Genome Browser
Species Human (GRCh38)
Location 10:55153297-55153319
Sequence CTGGATTTCACCTCCCACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068301823_1068301830 17 Left 1068301823 10:55153297-55153319 CCTGAGTGGGAGGTGAAATCCAG 0: 1
1: 0
2: 1
3: 12
4: 182
Right 1068301830 10:55153337-55153359 CAAGTTGCTCACCTTGACACGGG No data
1068301823_1068301829 16 Left 1068301823 10:55153297-55153319 CCTGAGTGGGAGGTGAAATCCAG 0: 1
1: 0
2: 1
3: 12
4: 182
Right 1068301829 10:55153336-55153358 CCAAGTTGCTCACCTTGACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068301823 Original CRISPR CTGGATTTCACCTCCCACTC AGG (reversed) Intronic
900185129 1:1329334-1329356 CTGGATGTCACCCCCACCTCAGG + Intergenic
900689976 1:3974651-3974673 CTGGAAGTCACCTTCCACTGAGG - Intergenic
903063345 1:20685020-20685042 CTGGGTTTCTCTTCACACTCAGG - Exonic
903222895 1:21878706-21878728 CAGGCTTTCTCCTCCCACCCTGG + Intronic
903819996 1:26094805-26094827 CTGGCTCTCACCACCCACTAGGG - Intergenic
908332999 1:63089455-63089477 GTGGATTTTACCTTCCCCTCTGG - Intergenic
908651993 1:66343991-66344013 ATGGACTCCAACTCCCACTCTGG + Intronic
915098932 1:153484725-153484747 CTGCATTCCTTCTCCCACTCAGG + Intergenic
915147141 1:153801915-153801937 CTGGGCTTCACCTCCAACCCTGG + Intergenic
916211992 1:162367072-162367094 CTGGAGATCACCTTCCGCTCCGG + Exonic
917105499 1:171486853-171486875 CTAGATTTCACCTCCCATATTGG + Intronic
917135710 1:171786380-171786402 GTGGATTTCTCCTTCCACACTGG + Intronic
924799549 1:247317607-247317629 CTGGAACTCCACTCCCACTCGGG + Intronic
1065438533 10:25726032-25726054 CTGGTTTTCATCTTTCACTCCGG + Intergenic
1066030584 10:31419311-31419333 CTGGGTTCTACCTCCCTCTCCGG - Intronic
1066049375 10:31620180-31620202 CAGGATTTGAACTCCCAGTCTGG + Intergenic
1067011507 10:42718246-42718268 CTGGATGTCACCTCCTCCCCCGG + Intergenic
1068046550 10:51893462-51893484 CTGAATTTCAGCCCTCACTCAGG + Intronic
1068301823 10:55153297-55153319 CTGGATTTCACCTCCCACTCAGG - Intronic
1071481200 10:86066312-86066334 CTGGATTTCAACTCCCAGCTTGG - Intronic
1072402256 10:95116561-95116583 CTGAATTCCATCTCCCATTCAGG - Intergenic
1072632156 10:97153916-97153938 CTGGATCTCACCTCCTGCTCTGG + Intronic
1073130119 10:101182943-101182965 CTGGATTTACCATCCCACACAGG + Intergenic
1073773290 10:106759067-106759089 CTGGCTTTCAACTCCCACAGGGG + Intronic
1074711682 10:116183278-116183300 CTGGAAATCAACTCCCATTCAGG + Intronic
1075811375 10:125227281-125227303 CAGGACATCACCTCCCTCTCTGG - Intergenic
1078830456 11:14972613-14972635 GTGAATTTCACCTCTCAGTCCGG + Intronic
1079554923 11:21747753-21747775 CTGGACTTCTGCTTCCACTCTGG + Intergenic
1080060261 11:27949323-27949345 CTGTTTCTCACATCCCACTCAGG + Intergenic
1080296502 11:30736198-30736220 TTGGTTCTCACCTCCCACCCTGG + Intergenic
1080863954 11:36176918-36176940 CTGGATTTCTCTTCTTACTCAGG + Intronic
1081259535 11:40942597-40942619 CTGAATCCCACCTCCCTCTCTGG - Intronic
1081989099 11:47328076-47328098 CTGGGCTTCTCCTGCCACTCAGG + Intronic
1083088605 11:60176395-60176417 CTTGATTTTATTTCCCACTCTGG + Intronic
1084012688 11:66361449-66361471 CTGGATTTGACCTAGGACTCTGG + Intronic
1084994295 11:72960313-72960335 TTAGATCTCACCTCCAACTCTGG + Intronic
1088995863 11:114996267-114996289 CTGGTTTTCAGCTACCTCTCTGG + Intergenic
1090062433 11:123475772-123475794 CTGGATGTCTTCTCCCACTAAGG + Intergenic
1090275561 11:125416940-125416962 TGGGATTTCACCTCCATCTCAGG - Intronic
1092041432 12:5388675-5388697 TGGGACTTCACATCCCACTCAGG + Intergenic
1099156988 12:79190022-79190044 CTGTATTTTGCCTTCCACTCTGG + Intronic
1099258272 12:80343269-80343291 CTGGAACTAACCTCCCACTGAGG - Intronic
1100163003 12:91882746-91882768 CTGGGTCTCATATCCCACTCAGG - Intergenic
1101643078 12:106602476-106602498 CTGGATTTCAAATCCCAGCCTGG - Intronic
1102084272 12:110123541-110123563 ATGGAGTTCACATCCCACGCAGG - Intergenic
1102617990 12:114171531-114171553 CTGGAATTCAACTGTCACTCAGG + Intergenic
1104872113 12:132007318-132007340 CTGGATTTCACCTGTCAATGGGG + Intronic
1110793582 13:79612277-79612299 CTAGATTTAAGCTCCCACTCAGG - Intergenic
1113392092 13:109907764-109907786 CTGAATTTCACACCGCACTCTGG + Intergenic
1114581232 14:23762117-23762139 CTGGAAGTCACCTCCCAGTAGGG - Intergenic
1115833034 14:37363547-37363569 CTGGAAGACACCTCCCACTGGGG - Intronic
1117300255 14:54418695-54418717 CTGGATTAGACCTCCAACCCTGG - Intronic
1118633483 14:67726709-67726731 CTGGCTTCCAACTCCCACTCTGG - Intronic
1122199255 14:100112402-100112424 CTGCATTTCACCTCTCAGTCAGG + Intronic
1123074591 14:105661628-105661650 GGGGATTTCACCCCCAACTCTGG + Intergenic
1128568061 15:68714257-68714279 CTGGAGCTCAGCCCCCACTCTGG - Intronic
1128814642 15:70598800-70598822 CTTCCTTTCACCTCCCCCTCAGG + Intergenic
1131003495 15:88956890-88956912 CTGATTTTCACCTGGCACTCAGG - Intergenic
1131215949 15:90535284-90535306 CTGGCTTTCTCCTGCCCCTCTGG - Intronic
1133429585 16:5725005-5725027 TTGGATTTCACCACCCAATAAGG - Intergenic
1135651247 16:24208660-24208682 ATGGATTGCACCTGCCTCTCTGG - Intronic
1136556721 16:31011313-31011335 CCTGATTTCCCCTCCCACTAAGG - Intergenic
1137069191 16:35884745-35884767 CTGGATATCTTCTCCCACTCGGG - Intergenic
1137069569 16:35890364-35890386 CTGAATATCTTCTCCCACTCTGG - Intergenic
1138957896 16:61993169-61993191 CTGGATTTCATAACTCACTCAGG + Intronic
1139373144 16:66480677-66480699 CTGGATGGCACCTCCGACTCAGG + Exonic
1139483925 16:67245919-67245941 CTGGAGGCCACCTCCCATTCAGG - Intronic
1141799432 16:86296817-86296839 TTGGTGTTCTCCTCCCACTCTGG - Intergenic
1143903641 17:10193318-10193340 CTGCATTTTACCTCCCTCTTGGG + Intronic
1145097400 17:20042464-20042486 CTGGACTTCCACTCCCACCCAGG - Intronic
1146774249 17:35597995-35598017 CTGGATTGCACCTTCCTCTCTGG + Intronic
1147775540 17:42898235-42898257 ATGGAGTTGACATCCCACTCTGG - Intergenic
1148565317 17:48629209-48629231 CTGGAGTTCAACTCCAGCTCAGG + Intronic
1155004396 18:21714979-21715001 CTAGATTGCAGCTCCCACTTGGG + Intronic
1155701997 18:28757442-28757464 CTGCATTTTACCTCCACCTCTGG + Intergenic
1156592850 18:38510906-38510928 GTGGATTTCCCCTCCTCCTCTGG + Intergenic
1158395493 18:57076134-57076156 CTGCATTTAACCTCCCCCACTGG + Intergenic
1160133600 18:76251904-76251926 CTGGATTACCCGGCCCACTCTGG + Intergenic
1160621808 18:80176512-80176534 CTGAGTCTCAGCTCCCACTCAGG + Intronic
1161303496 19:3554807-3554829 CTGTATTTCACCCCCAAGTCTGG - Intronic
1164637352 19:29801197-29801219 CTTGATTTCACAGCCCTCTCAGG - Intergenic
1165586418 19:36920109-36920131 CTGGCTTTCACCTCCACATCTGG - Intronic
1167213590 19:48149354-48149376 CTGGCTGCCACCTCCCTCTCTGG - Intronic
1167620018 19:50555534-50555556 CTGGATCTCAGCTCCATCTCGGG - Intronic
1168723370 19:58567390-58567412 CTGGATTTCTTCTCCCATCCTGG + Intronic
926939847 2:18123811-18123833 CTTGATCTAACCTCCCTCTCAGG - Intronic
927141656 2:20135164-20135186 CTGGATGCCAGCTCCCACCCTGG + Intergenic
927406702 2:22778504-22778526 CTGAGTTTCTCCTCCCACTCTGG + Intergenic
929625704 2:43404424-43404446 CTGAAGTGCTCCTCCCACTCTGG + Intronic
932327110 2:70870683-70870705 CTCCCTCTCACCTCCCACTCTGG + Intergenic
933841367 2:86288851-86288873 CTTGACTTCACCTGCCACTGAGG - Intronic
934025156 2:87996362-87996384 CTGGCTTTCACCTTCCTCCCAGG - Intergenic
935413371 2:102788720-102788742 AGGGATTCCACCTTCCACTCTGG - Intronic
936058231 2:109277655-109277677 TTGGATGTCCTCTCCCACTCAGG + Intronic
938085940 2:128402128-128402150 CTGGATTTCTACCCCCACCCTGG - Intergenic
938160946 2:128983898-128983920 GTGGACCCCACCTCCCACTCAGG + Intergenic
940238083 2:151531975-151531997 CTAGATACCATCTCCCACTCTGG - Intronic
943129550 2:183839190-183839212 CTAGATTGCAGCTCCAACTCAGG + Intergenic
943668728 2:190638010-190638032 CTTACTTTCACCTCCCTCTCGGG - Intergenic
946821926 2:223638973-223638995 CTGGATTCCACTTTCCACCCAGG - Intergenic
946959697 2:224971075-224971097 CTGGATTTCATCTTCCAGTGAGG + Intronic
947139047 2:227004274-227004296 AGGGAATTCACCTCCCACGCAGG + Exonic
947855325 2:233320125-233320147 TTGGATTTCACCTCCCCATGTGG + Intronic
1169475644 20:5928894-5928916 CTGCATTTCATCTTCCACCCTGG + Intergenic
1170926832 20:20732793-20732815 TGGGATTTCACCTCTCACTGGGG - Intergenic
1171237687 20:23540913-23540935 CTGGATTCCCCCTCCCGCCCAGG + Intergenic
1172179406 20:32991987-32992009 CTGGGTTTCAGCACCCACACAGG - Intronic
1173619526 20:44426118-44426140 CTGGTTTTCTCCTACCCCTCTGG - Intronic
1176940151 21:14913423-14913445 CTGGTTTTCACATCCTACTAAGG - Intergenic
1177160512 21:17542418-17542440 CTTGATGTCACCTCCTACTAAGG - Intronic
1178398053 21:32259845-32259867 CTGTCTTTCTCCTCCCACACTGG - Intergenic
1178737452 21:35165903-35165925 CTGGCTTGCAACTCCTACTCTGG + Intronic
1179435255 21:41358314-41358336 CTGGATTTCTGTTCCCTCTCTGG - Intergenic
1180963947 22:19776042-19776064 GTGGCTTACACCTTCCACTCGGG - Intronic
1182980847 22:34669383-34669405 CTGCATTTCAGCCCCAACTCTGG - Intergenic
1183278589 22:36918809-36918831 CTGGATTCCCACTCTCACTCTGG - Intronic
1183935237 22:41258138-41258160 CTGGATGTCACCTGGCACTCGGG - Intronic
1184223357 22:43114844-43114866 CAGCATTTCACCTCCTTCTCAGG + Intronic
949543414 3:5051967-5051989 CTGCATTTCAAATCCCACTTGGG + Intergenic
953056964 3:39395768-39395790 CTGGATTTCATCTGCTACTTGGG + Intronic
955773541 3:62410248-62410270 GTGGATTTCAACTATCACTCAGG - Intronic
956336377 3:68168539-68168561 CTGGATTTCAACTCCTAGACTGG - Intronic
961830813 3:129622145-129622167 CTGGATTCCACCTCGCCTTCCGG - Intergenic
963856581 3:150259898-150259920 CTGGACTTCACCTCAAACCCTGG + Intergenic
966017272 3:175156061-175156083 CTGAATTTTACCTACCACTTTGG - Intronic
966105777 3:176331960-176331982 CAGGATTTCCACTCCCACTTTGG + Intergenic
969116301 4:4872658-4872680 CGGGATTTCCCCTCGCCCTCGGG + Intergenic
977449201 4:97173341-97173363 CTGGATTCCAATTCTCACTCTGG + Intergenic
977691642 4:99918585-99918607 CTGGACTTCCACTCCCACTTAGG - Intronic
980964012 4:139502985-139503007 CAGGGTTTCACCGCCCAGTCTGG - Intronic
981941146 4:150282821-150282843 CCAGATCTCACCTTCCACTCAGG + Intronic
982290837 4:153781070-153781092 CTGATTTTCACTTCCCACTGAGG - Exonic
983515938 4:168656702-168656724 CTGGATTTCCCCCCACAATCTGG - Intronic
984085669 4:175308273-175308295 CTTGATTTCACATCACATTCTGG + Intergenic
986151771 5:5136607-5136629 TTGCATCTCAGCTCCCACTCTGG + Intergenic
986321912 5:6638262-6638284 CTGGACTGCACCTCCACCTCTGG - Intronic
986503189 5:8422853-8422875 CTGGATTTCTCCTAACACGCTGG - Intergenic
986583675 5:9292380-9292402 CTGTATTTCAGTTCCCTCTCAGG - Intronic
986633915 5:9801419-9801441 CTAGCTTGCAGCTCCCACTCAGG + Intergenic
990943561 5:61228008-61228030 CTGGACCTCACCTCCAACGCAGG + Intergenic
993742304 5:91556097-91556119 CTGGATGACACCTCCCAGTAGGG + Intergenic
997143173 5:131405043-131405065 CTGGTTTTCACCTCCCTCTCTGG - Intergenic
997263197 5:132479159-132479181 CAGGATTTCAGTTCCCACTTTGG + Intergenic
1001630725 5:173173304-173173326 CTAGATCTCACCTCCAACACAGG - Intergenic
1003159618 6:3624059-3624081 CTGCCTTTTCCCTCCCACTCAGG + Intergenic
1003522758 6:6872622-6872644 CTGGATTTCACCACACACAATGG + Intergenic
1006395843 6:33787169-33787191 CTGGACTTCCCCTCCCATTACGG - Intronic
1006402378 6:33825349-33825371 CTGGCTTTCCCCACCGACTCAGG - Intergenic
1007255840 6:40528066-40528088 CTGGGTTTGAATTCCCACTCTGG - Intronic
1007458252 6:41997582-41997604 CTGGTTTTGAGCTCCCACTTTGG - Intronic
1008409478 6:51157433-51157455 GTGGGTCTCACATCCCACTCTGG - Intergenic
1012244580 6:96912234-96912256 CTGGATTTCACCCTCCTCACTGG + Intergenic
1015333244 6:132005786-132005808 CTGGGCTTCACCTCCAACACAGG + Intergenic
1015685151 6:135850865-135850887 CTGGGTTACACTTCCCACTCTGG - Intergenic
1018076402 6:160218236-160218258 CTTGATTTTACCTCCCCATCTGG - Intronic
1018845205 6:167551208-167551230 GGGGATGTCCCCTCCCACTCTGG + Intergenic
1018974861 6:168556487-168556509 CTTTATTTCACATCCCACGCGGG + Intronic
1027423516 7:78040282-78040304 CTAGAATTCAGCTCTCACTCCGG - Intronic
1029969256 7:104773215-104773237 CTGGACTTCACCCCCCATCCTGG + Intronic
1035042808 7:155942833-155942855 CAGGAGTTCAGCGCCCACTCTGG + Intergenic
1037085261 8:14841369-14841391 TTGGATTTCACCTTGCATTCAGG + Intronic
1038995716 8:32920765-32920787 CTGCATTTCCCCTACCTCTCTGG - Intergenic
1039850048 8:41357343-41357365 CTGGAATTCACCTCCCAGTAGGG - Intergenic
1040042736 8:42932658-42932680 CTGGATTTCTTCTTCCTCTCAGG - Intronic
1041789117 8:61671952-61671974 CTGGATATCACTTCATACTCAGG + Intronic
1042660205 8:71146112-71146134 CTGGATTTCAGCCTCCTCTCTGG + Intergenic
1042729404 8:71915054-71915076 CTGGATTTCTCTTCACACTAGGG + Intronic
1044852427 8:96442123-96442145 CTGGATTTAAGCTCTCCCTCTGG + Intergenic
1045345309 8:101288667-101288689 CTGGAAGTCATCTGCCACTCAGG - Intergenic
1048299173 8:133238927-133238949 CTGGACATCACCCCCAACTCGGG - Exonic
1048884843 8:138901803-138901825 CTGGCTTGCACCTACCTCTCCGG + Intronic
1049117762 8:140704584-140704606 CTGGTATTCAATTCCCACTCAGG + Intronic
1049960379 9:732554-732576 CTGCATTTCATCTTCCACCCTGG - Exonic
1050008469 9:1159933-1159955 TTGGGTTTCACTTCGCACTCAGG + Intergenic
1050151081 9:2620609-2620631 CTCGATGTGCCCTCCCACTCTGG + Intergenic
1050155038 9:2657751-2657773 CTTGATGTGCCCTCCCACTCCGG - Exonic
1050253812 9:3773284-3773306 CTGGTTTTCCTTTCCCACTCAGG - Intergenic
1051429722 9:16969547-16969569 CTGCATTTCTACTCCCACTAGGG - Intergenic
1051700206 9:19814311-19814333 CTGGCTTCCACCTCTCACTTTGG - Intergenic
1051748164 9:20315548-20315570 CTGGCTCTCACCTCACAGTCAGG - Intergenic
1055244128 9:74219942-74219964 CTGTCTTGCAGCTCCCACTCAGG + Intergenic
1055786292 9:79872571-79872593 CTGGACTTCAACTAGCACTCTGG + Intergenic
1056526218 9:87445416-87445438 CTGGATGTCACCTCCTCCCCAGG - Intergenic
1058954449 9:109932244-109932266 CGGCATTTCACCTCCGACTTCGG + Intronic
1059850155 9:118329310-118329332 CTGGATTTGTCCTGCCACTTTGG + Intergenic
1061159095 9:128882860-128882882 CTGGATCTCGCCTCGCCCTCGGG - Exonic
1187079916 X:15975241-15975263 CTGGAGTCCACCTCCCTCTCCGG + Intergenic
1187814061 X:23211799-23211821 CTGAATTTCACCTTCCTCTTGGG - Intergenic
1188368257 X:29336733-29336755 CTGGATTTCCCCCCTCAATCTGG - Intronic
1190594315 X:52037738-52037760 CTGTGTTTCACATCCCTCTCAGG - Intergenic
1194452729 X:94064219-94064241 CTGGATTTCCCCTCAAATTCAGG + Intergenic
1199286062 X:146055601-146055623 CTGCATTTCACTTCCTACTTTGG - Intergenic
1199408406 X:147490566-147490588 CTGGATTGCACCCCCCAACCAGG + Intergenic
1199881227 X:151975156-151975178 CTGGCTTCAACCTCCCTCTCTGG + Intergenic
1200243980 X:154513014-154513036 CTGGATCTCCCCTGCCACTTGGG + Intronic
1201566424 Y:15369420-15369442 CTGGAAGACACCTCCCACTTGGG + Intergenic