ID: 1068301824

View in Genome Browser
Species Human (GRCh38)
Location 10:55153316-55153338
Sequence TGGTGAAGGGAAGAGCAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 665
Summary {0: 1, 1: 0, 2: 2, 3: 63, 4: 599}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068301824_1068301834 20 Left 1068301824 10:55153316-55153338 CCAGCCTGCTCTTCCCTTCACCA 0: 1
1: 0
2: 2
3: 63
4: 599
Right 1068301834 10:55153359-55153381 GCTGCATCAGCCTGGAGGACAGG No data
1068301824_1068301830 -2 Left 1068301824 10:55153316-55153338 CCAGCCTGCTCTTCCCTTCACCA 0: 1
1: 0
2: 2
3: 63
4: 599
Right 1068301830 10:55153337-55153359 CAAGTTGCTCACCTTGACACGGG No data
1068301824_1068301829 -3 Left 1068301824 10:55153316-55153338 CCAGCCTGCTCTTCCCTTCACCA 0: 1
1: 0
2: 2
3: 63
4: 599
Right 1068301829 10:55153336-55153358 CCAAGTTGCTCACCTTGACACGG No data
1068301824_1068301832 12 Left 1068301824 10:55153316-55153338 CCAGCCTGCTCTTCCCTTCACCA 0: 1
1: 0
2: 2
3: 63
4: 599
Right 1068301832 10:55153351-55153373 TGACACGGGCTGCATCAGCCTGG No data
1068301824_1068301833 15 Left 1068301824 10:55153316-55153338 CCAGCCTGCTCTTCCCTTCACCA 0: 1
1: 0
2: 2
3: 63
4: 599
Right 1068301833 10:55153354-55153376 CACGGGCTGCATCAGCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068301824 Original CRISPR TGGTGAAGGGAAGAGCAGGC TGG (reversed) Intronic
900125754 1:1068384-1068406 TGGGGAAGGGAAGAGGGAGCTGG - Intergenic
900184797 1:1328039-1328061 CGGTGCAGAGCAGAGCAGGCAGG + Exonic
900745586 1:4358524-4358546 TGGTAACAGGAAGAGCCGGCTGG + Intergenic
900950857 1:5857687-5857709 AGGAGGAGGGAGGAGCAGGCGGG + Intergenic
901018554 1:6244931-6244953 TGAGGAAGGGAAGAGGAGGGCGG - Intronic
901276146 1:7992487-7992509 TGGGGAAAGGAAGAGGAGGTAGG - Intergenic
901919132 1:12523726-12523748 TGGGGAAGGGAAGGACAGGTGGG + Intergenic
902538957 1:17138844-17138866 GAGTGAAGGGAAGGGCAAGCTGG + Intergenic
902659329 1:17890454-17890476 TGGAGAGGGGAAGAAAAGGCGGG - Intergenic
902768597 1:18632693-18632715 TGAGGAAGGGGAGAGGAGGCAGG + Intronic
902806127 1:18862318-18862340 TGGTGCAGGAGAGACCAGGCTGG - Intronic
902840680 1:19072001-19072023 TGGGGAGGGGAGGTGCAGGCAGG + Intergenic
903604608 1:24566503-24566525 GGGGGAAGGGAAGAGGAGACAGG + Intronic
903753503 1:25645011-25645033 TAGTAAAGGGAAAAGCAGGCTGG - Intronic
904033369 1:27546841-27546863 AGGTGAAGGGAGAAGCAGGTTGG - Intronic
904433449 1:30479538-30479560 GGGTGGAGGGAAGAGTGGGCTGG - Intergenic
904788872 1:33002811-33002833 TGGGGAAGGGGAAAGCAGTCCGG - Intergenic
905105572 1:35561693-35561715 TGGTGCAGGGAAGAGAAGCAGGG + Intronic
905772873 1:40649697-40649719 TGGTGAGGAGAGGAGAAGGCTGG + Intronic
906196714 1:43934405-43934427 TGATGGAGGGAAAGGCAGGCAGG - Intronic
906283069 1:44567027-44567049 TGGTGAAGGGCAGAGAAGAATGG + Intronic
906526298 1:46495072-46495094 TGGGGCAGGGCAGAGCAGGCAGG + Intergenic
906562645 1:46770487-46770509 TGGAGATGGGAAGGGCAGGAGGG - Intronic
907841469 1:58161996-58162018 TGGTCCAGGGAAGAGAAGGGAGG + Intronic
908681896 1:66671330-66671352 TGGGGGTGGGAAGAACAGGCGGG + Intronic
911088786 1:94001253-94001275 TGGTGTAGGGTAGGGAAGGCAGG + Intronic
912176467 1:107164189-107164211 TTGAGGAGGGGAGAGCAGGCTGG + Intronic
912514028 1:110207011-110207033 AAGGGAAGGCAAGAGCAGGCTGG - Intergenic
912702319 1:111887617-111887639 TGGAGAAAGGAAGAGCCAGCAGG + Intronic
912758219 1:112342567-112342589 AGGTCAAGGGAAGAGGAGGAGGG - Intergenic
913197198 1:116467096-116467118 TGGTGAAGAGAAAAGGAGGGAGG + Intergenic
913223782 1:116680793-116680815 TGTTGAAGGGAAGAGCATTCTGG + Intergenic
913283994 1:117210772-117210794 GGGTGAAGGGAACAGCAGTGAGG - Intronic
913373540 1:118127398-118127420 TGGTGAAGGCAGGAGCAAGATGG + Intronic
914203726 1:145508904-145508926 TGTTGGTGGGAAGAGCATGCTGG - Intergenic
914482849 1:148082058-148082080 TGTTGGTGGGAAGAGCATGCTGG - Intergenic
914504993 1:148281152-148281174 TGGTGCAGGGAGGCCCAGGCTGG + Intergenic
914507571 1:148302996-148303018 TGGTGCAGGGAGGCCCAGGCTGG - Intergenic
914581110 1:149020007-149020029 TGTTGGTGGGAAGAGCATGCTGG - Intronic
914913260 1:151803016-151803038 TGGGGCAGGGAACAGCAGGGAGG + Intronic
915393047 1:155562008-155562030 TGGGGGAGGGGAGAGCAGGGAGG - Intronic
915409203 1:155687926-155687948 TGGGGGAGGGGAGAGCAGGGAGG - Intronic
915913146 1:159926458-159926480 AGGTAAAGGGTAGAGCAGGTGGG - Intergenic
916169307 1:161988632-161988654 TGGAGAAGGCCAGACCAGGCAGG - Intronic
916493645 1:165325941-165325963 TGGGGGAAGGAAGAGGAGGCAGG - Intronic
917683412 1:177391556-177391578 TGGTTAGGAGAAGGGCAGGCAGG + Intergenic
918275786 1:182952945-182952967 CGGTGAAGGGGAAAGCGGGCCGG - Exonic
918340338 1:183563358-183563380 TGGAGGAGGGAAGAGGAGGATGG - Intronic
919449325 1:197751842-197751864 AGGGGAAGGGAAGGGAAGGCAGG + Intronic
919793723 1:201308700-201308722 TGGGGAGGGGAAGAGATGGCTGG + Intronic
919801049 1:201354898-201354920 GGGTGCAGGGGAGACCAGGCTGG - Intergenic
920180137 1:204127363-204127385 TGGGGGAGGGGAGGGCAGGCAGG - Exonic
921125834 1:212177207-212177229 TGATGAAAGAAAAAGCAGGCGGG + Intergenic
921255808 1:213338295-213338317 TGGAGAAGCCAAGAGCAGGAGGG - Intergenic
923079576 1:230640975-230640997 TGGGGAAGGGCAGAGGAGACAGG + Intergenic
923255914 1:232221298-232221320 GGGTGAAGGGAAATGCAGGCTGG - Intergenic
924009299 1:239647159-239647181 TGGTGAGAGGAAGAGAAGGTAGG - Intronic
924100922 1:240601995-240602017 TGCTGAAAGGAAAAGTAGGCAGG - Intronic
924434149 1:244023664-244023686 GGGTGGAGAGAAGACCAGGCTGG + Intergenic
924482114 1:244445179-244445201 TGTTTAAAGGAAGAGCAGGATGG - Intronic
1062907511 10:1188861-1188883 TGGTGAGAGGAAGTGCAGTCAGG + Intronic
1063414544 10:5862858-5862880 GGGAGAAGGGAAGGGGAGGCTGG + Intronic
1063475736 10:6327462-6327484 TGGTCTAGGGAAGAGCAGAAAGG - Intergenic
1063629530 10:7721038-7721060 TGGAGAAGAGAAAAGCAGGCTGG + Intronic
1063698296 10:8359117-8359139 TGGTGAAGGCAGGAGCAAGCTGG - Intergenic
1064164113 10:12972265-12972287 GGGTGAGGGGAAGAGGAAGCTGG - Intronic
1064566099 10:16640705-16640727 AGGTGAAGGAATGAGAAGGCAGG - Intronic
1065065437 10:21958940-21958962 TGGTAAAAGGAAGAGAAGGAAGG - Intronic
1065275975 10:24086014-24086036 TGGGGCAGGGAGGAGCAGTCAGG - Intronic
1065321109 10:24511016-24511038 AGGTGGAGGGAAGAGCATTCTGG + Intronic
1065736198 10:28754778-28754800 TGGTGAAGGGCAGGGAAGGAGGG + Intergenic
1066038969 10:31525583-31525605 GGGGGCAGGGAAGAGCAGGTAGG - Intronic
1066618180 10:37316967-37316989 ATGTGCAGGGAAGGGCAGGCAGG - Intronic
1067120483 10:43468381-43468403 TCGTGAAAGGAAGAGCCGGCCGG + Intronic
1068301824 10:55153316-55153338 TGGTGAAGGGAAGAGCAGGCTGG - Intronic
1068963757 10:62891438-62891460 TGGGGGAGGGGAGAGCGGGCAGG + Intronic
1069642157 10:69963033-69963055 TGGTGAAGGAAACAGGAGGATGG + Intronic
1070776709 10:79113984-79114006 TGGTGTGGTGAAGAGGAGGCGGG + Intronic
1070805715 10:79269617-79269639 TGGAGAAGGGAACAGAAGCCTGG - Intronic
1072315985 10:94203751-94203773 TGATGAAGAGAAGAGCAAACAGG + Intronic
1073047137 10:100646163-100646185 TGGTGGAGGGAGAGGCAGGCAGG + Intergenic
1073327455 10:102650919-102650941 TCGTGAAGGGGACGGCAGGCAGG + Intronic
1073543823 10:104333103-104333125 GGGTTAGGGGAAGGGCAGGCTGG - Intronic
1073638770 10:105228304-105228326 TGATGGAGGGCAGGGCAGGCAGG - Intronic
1074413732 10:113249315-113249337 TAGTGAGGGGAACAGGAGGCAGG + Intergenic
1074690303 10:115998288-115998310 TAGAGAAGGGAAGAGAAGGGAGG + Intergenic
1074907571 10:117878534-117878556 AGGAGAAGCCAAGAGCAGGCTGG + Intergenic
1075324376 10:121519006-121519028 TGGTGGAGAGAAGGGCAGGAGGG + Intronic
1075518020 10:123124986-123125008 TGGTGACTGGGAGACCAGGCAGG - Intergenic
1075668088 10:124244860-124244882 TGGTGAATGAAGGAACAGGCAGG + Intergenic
1075926630 10:126256402-126256424 TGGAGACTGGAAGAGCAGGGAGG - Intronic
1076369826 10:129945117-129945139 AGGTGAAGGGAGGGGCAGGGAGG + Intronic
1076383998 10:130044394-130044416 GAGTGAAGGGAAGCCCAGGCTGG - Intergenic
1076494636 10:130889058-130889080 ATGGGATGGGAAGAGCAGGCTGG - Intergenic
1077306251 11:1869916-1869938 GGGTGTGGGGAAGACCAGGCAGG - Intronic
1077490515 11:2858850-2858872 TGTTGTAGGGAAGAGGAGACGGG + Intergenic
1077700489 11:4436981-4437003 TGGTGAAGGGAAGACCTAGTGGG + Intergenic
1077898093 11:6469155-6469177 TGGTGAAGGGAAAGGCTGGGAGG + Intronic
1078407526 11:11083571-11083593 TGCTGAAGGTCAGAGCAGCCTGG + Intergenic
1078508479 11:11968647-11968669 TGCTGAAGGGCAGTGCAGCCAGG - Intronic
1078546848 11:12253100-12253122 GGGTGAAGGGGAGAGCAAGCTGG + Intronic
1078705211 11:13737310-13737332 TGGGGAAGGCACGAGCAGACAGG - Intergenic
1079332196 11:19542852-19542874 AGGTGAAGGGGAGAGCAAGGTGG - Intronic
1081756894 11:45551242-45551264 GGGACCAGGGAAGAGCAGGCTGG - Intergenic
1081761307 11:45577987-45578009 TGGTGAGGGGAGCAGCAAGCAGG + Intergenic
1081975165 11:47229248-47229270 GGGTGAAGAGTAGAGGAGGCCGG + Intronic
1081988083 11:47321697-47321719 TGGGGAGTGGAAGAGCAGTCAGG + Intronic
1083193325 11:61068191-61068213 TGGGGAGGGGAATGGCAGGCGGG + Intergenic
1083901458 11:65645483-65645505 TGGGAAAGTGAAAAGCAGGCAGG - Intronic
1084084287 11:66847810-66847832 TGGTGAAGGGAGCAGGAGGCTGG - Intergenic
1084544498 11:69807908-69807930 AGGGGAAGGGGAGAGAAGGCGGG - Intergenic
1084864044 11:72041333-72041355 GGGTGAAGGCACAAGCAGGCAGG + Intronic
1085525232 11:77160108-77160130 GGGTGGAGGGAGGGGCAGGCTGG + Intronic
1085575927 11:77602908-77602930 TGCGGAATGGAAGAGGAGGCTGG - Intronic
1085809479 11:79667345-79667367 CTGTGAAGGGAAGGGAAGGCAGG + Intergenic
1086112205 11:83211994-83212016 AGATGAAGGAAAGAGCTGGCAGG - Intronic
1086372830 11:86171867-86171889 TGGGGAAGGGTAGAGCAGAGGGG + Intergenic
1088451900 11:109990411-109990433 TGAGAAAGAGAAGAGCAGGCAGG + Intergenic
1088544667 11:110947401-110947423 TGGGCTAGGGAAGGGCAGGCTGG - Intergenic
1089146176 11:116331046-116331068 AGGAGAAGGCAAGGGCAGGCTGG - Intergenic
1089300886 11:117497963-117497985 GGGAGAAGGGAAGAGCAGAGGGG + Intronic
1089493212 11:118896336-118896358 GGATGGAGGGAAGAGTAGGCTGG + Exonic
1090060523 11:123460715-123460737 TGGGGCAGGGAAGGGGAGGCAGG + Intergenic
1090199717 11:124845613-124845635 TGATGGAGGGAAGAACAGGAGGG - Intergenic
1090347463 11:126082851-126082873 TTGTGAAGGGAATGGCAGACAGG + Intergenic
1090429100 11:126631003-126631025 TGGTGTGGGGAACACCAGGCAGG - Intronic
1091394604 12:146266-146288 TGAGGAAGGGGAGAGCAGGCTGG + Intronic
1091687451 12:2573589-2573611 TGGGTGAGGGAAGAGCAGCCTGG - Intronic
1091843504 12:3637156-3637178 CACTGAAGGGAGGAGCAGGCAGG + Intronic
1092125086 12:6069439-6069461 TTGTAAAGTGAGGAGCAGGCCGG - Intronic
1092155966 12:6281671-6281693 TGCTGAAGGGAAGATCTGGCAGG - Intergenic
1092934611 12:13348956-13348978 TGGTGGAGAGATGAGCAAGCTGG - Intergenic
1094102022 12:26775031-26775053 GGGTGAAAGGAAGAAAAGGCAGG - Intronic
1094359978 12:29620233-29620255 TGGTGCAGGGAAGATCAGAGAGG + Intronic
1096153796 12:49330854-49330876 TTGGGAAGAGAAGATCAGGCTGG - Exonic
1096194436 12:49640809-49640831 TGATGAAGGGGAGAGCATGGTGG + Exonic
1096259835 12:50083542-50083564 TGGATAGGGGAACAGCAGGCAGG + Exonic
1096451707 12:51748368-51748390 TGGGGTGGGGCAGAGCAGGCAGG - Intronic
1096538845 12:52291842-52291864 TGGCGAGGGGAAGAGAAGGGAGG + Intronic
1096648341 12:53050013-53050035 AAGTGGAGGGAAGTGCAGGCGGG - Intronic
1097576429 12:61399146-61399168 TAGTGAAAGCAAGAGCAGGAAGG + Intergenic
1098384856 12:69907958-69907980 TGGTTAAGGCCAGAGCAGGGAGG - Intronic
1098719300 12:73875317-73875339 TGGTGAAAGCAGGAGCAGGAGGG - Intergenic
1098983416 12:76984746-76984768 GGGCGGAGGGAAGAGCGGGCGGG - Intergenic
1099159960 12:79228782-79228804 TGGTGTAGTGAAGTGCTGGCTGG - Intronic
1100587392 12:95992902-95992924 AGGAGAAGGTAATAGCAGGCTGG - Intronic
1101593252 12:106140576-106140598 TGGGGAAGGGAAGAAGGGGCAGG - Intergenic
1101911112 12:108860686-108860708 GGGTGAGTGGAAAAGCAGGCCGG - Intronic
1102579569 12:113877629-113877651 TGCTGAAGGGAAGATCAGGATGG + Intronic
1102655701 12:114480782-114480804 TGGAGAAGGCAAGATCCGGCAGG + Intergenic
1102705700 12:114878444-114878466 GGGTGGAGGGAAGAGAAGGAGGG - Intergenic
1102712526 12:114940613-114940635 TGGTGGAGGGAGGAGGAGGGAGG - Intergenic
1103113745 12:118307210-118307232 TGGGGGGGGGAAGAGGAGGCGGG - Intronic
1103191931 12:119008890-119008912 TGGTGAGAGGAGGAGGAGGCAGG + Intronic
1103339109 12:120211936-120211958 GGGGGCAGGGAAGGGCAGGCAGG - Exonic
1104786845 12:131455628-131455650 TGGTCATGGGAAGGGCAGCCCGG + Intergenic
1104857742 12:131909845-131909867 GGGGGAAGGGAAGGGAAGGCGGG - Intronic
1105008074 12:132735618-132735640 TAGTGAAGGGGAGAGAAGGAAGG - Intronic
1106349920 13:28920773-28920795 AAGGGAAGGGAAGAGCAGGAAGG - Intronic
1108236550 13:48413935-48413957 GGGTTAAGGGAAGAGCTGGGAGG - Intronic
1108485044 13:50915359-50915381 AGATAAAGTGAAGAGCAGGCAGG - Intronic
1108688834 13:52845368-52845390 TGGTGAAGGGGAGGGAAGGGAGG + Intronic
1110126474 13:71949437-71949459 TGGTGAAGGGCAGAGGGGGATGG - Intergenic
1110704524 13:78589377-78589399 GGGTCAAGGGGAGAGCGGGCGGG - Intergenic
1110868018 13:80420024-80420046 AGGAGAAGGGAAGAGAAGGGAGG - Intergenic
1112294384 13:98173834-98173856 TGGGGAAGTGAAGAGCAGTGTGG - Intronic
1112354116 13:98660302-98660324 TGGCTCTGGGAAGAGCAGGCTGG + Intergenic
1112388645 13:98962954-98962976 TTGTGAAGAAGAGAGCAGGCAGG + Intronic
1112799094 13:103091131-103091153 TGGTGATGGTATGAGGAGGCTGG + Intergenic
1113630205 13:111877225-111877247 TGGTGAAGGAAAGAGGAATCCGG + Intergenic
1113767058 13:112888286-112888308 AGGGGAGGGGCAGAGCAGGCTGG + Intergenic
1113907744 13:113827836-113827858 TGCTGAAGGGGAGAGAAGGCGGG + Intronic
1114563790 14:23613078-23613100 TGGTTAAGGGAAGAGAAGCCTGG + Intergenic
1114634824 14:24181640-24181662 TGGTGGAGGGCAGGGCAGGTTGG - Intronic
1115788778 14:36856120-36856142 GGGGGAAGGGAAAAGCAGGGTGG + Intronic
1116633535 14:47363746-47363768 TAAGGAAGGGAAGAGAAGGCAGG + Intronic
1116751883 14:48896759-48896781 TAATAAAGGGAAGTGCAGGCTGG + Intergenic
1117943010 14:60989246-60989268 TGATGTAGGCAAGAGCAGGTGGG - Intronic
1118621758 14:67620199-67620221 TGGCGAGGGGAAGAGCTGGCCGG + Intronic
1119164885 14:72484137-72484159 GGGTGAAGAGGAGAGCATGCTGG - Intronic
1119169597 14:72524325-72524347 TGGTGATGGGCATAGTAGGCTGG + Intronic
1119194734 14:72709012-72709034 GGCTGATGGGAGGAGCAGGCTGG - Intronic
1119509347 14:75198833-75198855 TGGGGAAGGGAGGAGCTGCCAGG - Intergenic
1119529855 14:75352516-75352538 TGGGGAAGGGAAGAGAGGGTGGG - Intergenic
1119696954 14:76720685-76720707 TGGGGAAGGGAAAATCAGACCGG + Intergenic
1119914647 14:78386424-78386446 AGGTGAAGGGAAGAACAGGAAGG + Intronic
1121717829 14:96088807-96088829 CGGTGAAGGGAGGAGAAGGCAGG + Exonic
1121856698 14:97276777-97276799 TGACGGAGTGAAGAGCAGGCAGG + Intergenic
1122706465 14:103625113-103625135 AGGCCATGGGAAGAGCAGGCTGG - Intronic
1122750532 14:103929242-103929264 TGGTGTAGGGAAAGGGAGGCAGG - Intronic
1122896621 14:104760757-104760779 ATGTGAAGGGAAGAGCCGACAGG - Intronic
1123477290 15:20598838-20598860 TAGGGAAGGGCAGAGCAGGCAGG - Intergenic
1123640723 15:22401526-22401548 TAGGGAAGGGCAGAGCAGGCAGG + Intergenic
1124207421 15:27733441-27733463 TGGCTGAGGGAAGAGCATGCTGG - Intergenic
1125484818 15:40104548-40104570 TGGAGAAGCGAAGAGAAGGCTGG - Intronic
1125657230 15:41367851-41367873 TGGTGAATGGAAGCCCAGGAGGG - Intronic
1125680660 15:41528190-41528212 GGGTGAAGGGAAGGGTGGGCAGG + Intronic
1126462280 15:48926831-48926853 TGGTGCTGGGAAGAGCATGCTGG + Intronic
1126947129 15:53833700-53833722 TTATGTAGGGAAGAGCAGGGGGG + Intergenic
1127560616 15:60132643-60132665 TGGGGAAGGGAAGAGAAGGGAGG + Intergenic
1128135060 15:65256791-65256813 TGGAGAAGCTAAAAGCAGGCAGG - Intronic
1128674126 15:69596249-69596271 TTGAGAAGGAAAGAGCAGGCAGG + Intergenic
1128756368 15:70186368-70186390 GGGAGAAGGGGAGAGCAGGCTGG + Intergenic
1128766865 15:70256555-70256577 CGGTGCAGGGAAGAGCAAGTGGG + Intergenic
1128874032 15:71187361-71187383 TGGTGAAGGGTATAGCTGTCAGG + Intronic
1129131756 15:73504682-73504704 TGGGGTAGAGAGGAGCAGGCAGG + Intronic
1129262856 15:74378527-74378549 GGGTGAAGGGGAGAGGAGGAGGG - Intergenic
1129367981 15:75068700-75068722 TGGGAAGGGGAAGAGCTGGCTGG + Intronic
1129657470 15:77533749-77533771 TGGGGAAGGGAAGGGGAGGAGGG - Intergenic
1129786679 15:78314425-78314447 GGGAGCAGGGCAGAGCAGGCTGG + Intergenic
1129843703 15:78758689-78758711 CAGAGAGGGGAAGAGCAGGCTGG - Intergenic
1130258100 15:82335111-82335133 CAGAGAGGGGAAGAGCAGGCTGG + Intergenic
1130332709 15:82934295-82934317 TGGTGGGCGGAAGAGGAGGCTGG - Intronic
1130596831 15:85254851-85254873 CAGAGAGGGGAAGAGCAGGCTGG - Intergenic
1130654395 15:85781986-85782008 TAATGAAGGGAGGAGCAGGCAGG - Intronic
1131455270 15:92578681-92578703 GGGTGAGGGGAACAGTAGGCAGG - Intergenic
1132383000 15:101379545-101379567 TGGTGAAGAGCAGAGCAAGAGGG - Intronic
1132525978 16:414945-414967 TGGTGGAGGGAAGGGAAGGAGGG - Intergenic
1132769721 16:1554628-1554650 TGGGGAAGGATAAAGCAGGCTGG + Intronic
1132769732 16:1554673-1554695 TGGGGAAGGATAAAGCAGGCTGG + Intronic
1132897310 16:2235142-2235164 AGGTGAGGGGTAGGGCAGGCGGG + Exonic
1133520113 16:6549082-6549104 GGGAGGAGGGAAGAGGAGGCGGG + Intronic
1133601532 16:7344747-7344769 TGGGGAAGGGCAGACCAGCCAGG + Intronic
1134009853 16:10843833-10843855 TGGGGAAGGGAAGAGAAGGGAGG - Intergenic
1134090354 16:11388289-11388311 TGATGAAGGGAAGAGCTCCCAGG - Intronic
1134807406 16:17137637-17137659 TGGGGAAGGGCAGAGCAGGAGGG - Intronic
1135617242 16:23921963-23921985 AGGGAAAGGGCAGAGCAGGCAGG + Intronic
1135806958 16:25551432-25551454 TGGTGGAGGGAGGAGGAGGATGG + Intergenic
1135850264 16:25957108-25957130 TGGTGAAGGCAGGAAGAGGCTGG + Intronic
1136487773 16:30584330-30584352 TGGTGATGGTAAGAGCAGAGAGG - Intronic
1136749732 16:32623476-32623498 GTGTGAAGGCAAGTGCAGGCTGG + Intergenic
1137613918 16:49835906-49835928 TGCTGATGGGAAGAAGAGGCAGG + Intronic
1137619182 16:49865259-49865281 TGGTGACTGGAAAAGCTGGCAGG + Intergenic
1137835116 16:51584241-51584263 TGGTGAAGGGATGAAAAGGAAGG + Intergenic
1138267818 16:55672372-55672394 TGGGGCAGGGAAGTGGAGGCGGG + Intronic
1138566664 16:57838443-57838465 TGCTGCAGACAAGAGCAGGCTGG - Intronic
1139528024 16:67528561-67528583 TGGGGAGGGGACAAGCAGGCGGG + Intronic
1140070554 16:71645709-71645731 TGGTGTACGGAAGAGCCAGCAGG - Exonic
1141138636 16:81482905-81482927 TGCTGAACGGACGAGCAAGCAGG - Intronic
1141150473 16:81561423-81561445 TGGTGGAGGGAAGGGTAGGGTGG + Intronic
1203051866 16_KI270728v1_random:882677-882699 GTGTGAAGGCAAGTGCAGGCTGG + Intergenic
1143017566 17:3899027-3899049 TGGGGAAGGGATGAGGTGGCAGG + Intronic
1143233562 17:5378677-5378699 TGTGGAAGGGGAGAGCAGGGTGG - Intronic
1143547934 17:7610742-7610764 AGGTGAAGGCAAGAGCAGGTGGG + Intronic
1143697021 17:8629320-8629342 TGGGGTAGGGGAAAGCAGGCGGG - Intronic
1144877707 17:18411067-18411089 GGGTGAAGGGAAGAAAAGGATGG - Intergenic
1145154522 17:20533336-20533358 GGGTGAAGGGAAGAAAAGGATGG + Intergenic
1145323441 17:21780556-21780578 TGGAGAAGGGTGGAGCAGGTGGG - Intergenic
1145829100 17:27900559-27900581 TGGATAAGGGAAGAGGTGGCAGG + Intergenic
1145936627 17:28718065-28718087 AGGTGCAGGGGAGAGCAGCCTGG - Intronic
1145995710 17:29103692-29103714 TGGTGAGGGGAGGCCCAGGCGGG - Intronic
1146527386 17:33578672-33578694 TGGTGTAGGGAAGAGGAGGGGGG - Intronic
1146569603 17:33941216-33941238 TGGTTCAGGGATGAGCAGGAAGG + Intronic
1147159176 17:38560661-38560683 AGGAGAAAGGCAGAGCAGGCAGG - Intronic
1147390187 17:40104341-40104363 TGTAGAAGTGAACAGCAGGCCGG - Intergenic
1147886508 17:43687933-43687955 TGAATGAGGGAAGAGCAGGCAGG + Intergenic
1148072097 17:44914591-44914613 AAGTGAGGGAAAGAGCAGGCAGG - Intronic
1148153736 17:45411159-45411181 GGGTGAAGGGAAGAGAGGCCAGG - Intronic
1148205327 17:45776108-45776130 TGGTGAAGGGGAGCCCAGGGAGG - Intergenic
1148382508 17:47210088-47210110 TGGTTAAGGTAAGAGGAGCCCGG + Intronic
1148784478 17:50139383-50139405 TGGTGGAGGGAAAGGCAGGCAGG - Intronic
1149394081 17:56221078-56221100 AGGTGAAGGGGGAAGCAGGCAGG + Intronic
1151187096 17:72372378-72372400 TGGTGGAGGGAAGCTCAGCCTGG - Intergenic
1151393218 17:73801844-73801866 TGGCGATGGGAGGAGCAGGGAGG - Intergenic
1151420290 17:73992739-73992761 TCGTGGAGGGGCGAGCAGGCTGG - Intergenic
1151508673 17:74545038-74545060 TGGAGAAGGCAATGGCAGGCAGG + Intronic
1151885962 17:76923577-76923599 TGGTGGAGGGATGGGCAGGGGGG - Intronic
1152071966 17:78138478-78138500 AGGTGAGGGGAAGAGGAGGGGGG + Exonic
1152135095 17:78499128-78499150 TGGAGAAAGGAAGAGCTGGGAGG + Intronic
1152249641 17:79205083-79205105 TGGTGGAAGGAAGACCAGGTAGG + Intronic
1152434954 17:80270858-80270880 TGGAGAAGGGCAGAGCTGTCAGG - Intronic
1152818756 17:82424912-82424934 TGGAGAAGGCTAGAGAAGGCTGG + Intronic
1152920348 17:83063437-83063459 GGGTGAGGGGGAGAGCAGGGAGG - Intergenic
1153679271 18:7484994-7485016 TCATGAAGGGAAGAGGAGGGAGG - Intergenic
1153816589 18:8795727-8795749 TGGTGGAGAGCACAGCAGGCTGG - Intronic
1153917438 18:9758446-9758468 TGGAGAAGGGAAGAGGGGGGAGG - Intronic
1155146333 18:23086717-23086739 TTGTGTAGGCAAGAGCAGGATGG - Intergenic
1155465464 18:26130176-26130198 TGGTGAAGGAAGAAGCAGGGTGG - Intergenic
1155662265 18:28263393-28263415 TGATGAAGGGGAAAGCAGACTGG + Intergenic
1155697602 18:28701412-28701434 AGGTGAGAGGAAGAGTAGGCAGG + Intergenic
1156449242 18:37257652-37257674 TGGTGGAGGGGAGAGGAGACAGG - Intronic
1158889287 18:61858390-61858412 TGGGGGAGGGAAGGGCTGGCAGG - Intronic
1159605317 18:70468792-70468814 TGGAGAAGGAAGGAGAAGGCAGG + Intergenic
1160701301 19:508655-508677 AGGGGGTGGGAAGAGCAGGCAGG + Intronic
1161242762 19:3231662-3231684 GGGTGAATGGATGAGCAGGTGGG + Intronic
1162561632 19:11421001-11421023 TGGTAAAGGGAAGGGGAGCCAGG - Intronic
1162907943 19:13834398-13834420 TGGGGCAGGGATGGGCAGGCAGG + Intergenic
1163157257 19:15446238-15446260 GGGAGAGGGGAAAAGCAGGCAGG - Intronic
1163885754 19:19963353-19963375 TGGTGAAAGGAAGCCCAGGTTGG - Intergenic
1163888745 19:19992316-19992338 TGGTGAAAGGAAGCCCAGGTTGG + Intergenic
1163935207 19:20436278-20436300 TGGTGAAAGGAAGTCCAGGTTGG - Intergenic
1164718112 19:30408388-30408410 TGGTGATGGGGAGGGGAGGCTGG - Intronic
1164777347 19:30863117-30863139 GGGAGAGGAGAAGAGCAGGCTGG + Intergenic
1164841672 19:31397667-31397689 TGGTGAATGCAAGAGCAAGTGGG - Intergenic
1165739447 19:38196644-38196666 AGGTCAAGGGAAGAGCAAGGAGG + Intronic
1166048953 19:40246854-40246876 TGGTGGAGGGGAGAGCTGGGAGG - Intronic
1166254116 19:41590168-41590190 TAGGGAAGGGAAGAGAAGGGAGG - Intronic
1166545549 19:43632744-43632766 AGGTGAAGGGATGAGCAGTGAGG - Intronic
1166970366 19:46563120-46563142 GGGAGAAGGGCTGAGCAGGCAGG + Intronic
1167289317 19:48615720-48615742 TGTTGAAGGGAAAAGCAGGCAGG + Intronic
1168288592 19:55346467-55346489 GGGTGAAGGGGAGATGAGGCCGG - Intronic
1168353104 19:55687592-55687614 AGGGGCAGGGAAGAGCAGGAGGG + Intronic
1168483468 19:56740939-56740961 AGGGGAAGGGAAGGGAAGGCAGG - Intergenic
1168527789 19:57102710-57102732 AGATGAAGGCAGGAGCAGGCTGG - Intergenic
1168562106 19:57393228-57393250 TAGAGAAGGGAAGAGTAGGCAGG - Intronic
925258306 2:2508035-2508057 CGGTGCAGCGCAGAGCAGGCTGG + Intergenic
925390438 2:3490471-3490493 TGCAGGAGGGAACAGCAGGCCGG + Intergenic
925900659 2:8507178-8507200 AGGTGAAGGGTAGCGAAGGCAGG - Intergenic
926309727 2:11666812-11666834 AGGAGAAGGGCAGAGCAGGCAGG + Intronic
928028252 2:27757000-27757022 TGGGAAAGGGAAGGGCAGACGGG + Intergenic
928235288 2:29533982-29534004 AGTTGAAGGGAAGAGGAGTCAGG + Intronic
928377792 2:30790041-30790063 TGGGGAAGGGAGAAGCAGGCAGG + Intronic
928472672 2:31589790-31589812 AGCTGAAGGGAAGGGCAGGCAGG + Intergenic
928696192 2:33852538-33852560 TGGTGAAAGCAGGAGCAAGCAGG + Intergenic
929923447 2:46190322-46190344 AGGTAAAGGGAAGGGCAGGCTGG - Intergenic
931310988 2:61080400-61080422 TGGTGAAGGGAGGAAAAAGCTGG - Intronic
931753545 2:65351463-65351485 TGGTGAAGTGGAGAAGAGGCTGG - Intronic
932375252 2:71229629-71229651 TGAAGAAGTGAAGAGCAGGAAGG + Intergenic
933169930 2:79113951-79113973 TGGTGGAAGGAATAGCAGACTGG + Intergenic
934055273 2:88246309-88246331 TGGGGTAGGGGAGAGAAGGCAGG + Intergenic
934525354 2:95048421-95048443 AGGTGATGGGAGGGGCAGGCAGG - Intronic
934716894 2:96549729-96549751 TGGGGGAGAGAAGAGCAGGCTGG - Intronic
935146619 2:100399788-100399810 TGGTGGTGGGAAGAGCATCCTGG + Intronic
936160335 2:110079948-110079970 TGGTGAAGGTGTGGGCAGGCTGG + Intergenic
936184329 2:110291406-110291428 TGGTGAAGGTGTGGGCAGGCTGG - Intergenic
936263171 2:110979607-110979629 TGGTGACGGGAAGAGCACAGGGG + Intronic
937286810 2:120758992-120759014 GGGTGCAGGGAAGATCATGCAGG - Intronic
937305613 2:120868716-120868738 TGGTCGAGGGAAGAGGGGGCGGG + Intronic
937356911 2:121203495-121203517 TGGGGAAGGGAAGGCCAGCCAGG - Intergenic
937479310 2:122242199-122242221 GGGTGAAGTCAAGAACAGGCAGG + Intergenic
937624029 2:124024207-124024229 TGTTGAAGGTAAGAGGAGGGTGG + Intergenic
937624152 2:124025062-124025084 GGGGGAAGGGAAGAGAAAGCCGG + Intergenic
939035028 2:137120522-137120544 TGGGGAAGGGGAGAGCAGGGAGG + Intronic
939584166 2:143986861-143986883 TGGTTAAAGGAAGATCAGGAGGG + Intronic
940478166 2:154192415-154192437 TGGGGCAGGGAAGAGCTGGGAGG - Intronic
941201415 2:162515887-162515909 AGGTGAAAGGAAGAGTTGGCAGG - Intronic
941735076 2:168965290-168965312 TGGGGGAGGGAAGAGGAGGGTGG - Intronic
941804291 2:169694650-169694672 TGGGGATGGGAGTAGCAGGCAGG - Exonic
942053598 2:172162892-172162914 TGGAGCAGGCAGGAGCAGGCAGG - Intergenic
942305522 2:174603418-174603440 TGGGGAAGGCTAGCGCAGGCTGG + Intronic
942546898 2:177074779-177074801 TGGTAGAGGAAAGAGCAGGCTGG - Intergenic
942726690 2:179016817-179016839 TGGTAAAGAGCAGAGTAGGCTGG + Intronic
944089304 2:195887824-195887846 TGGGGAGGGGAAGAGGAGGGAGG - Intronic
944463607 2:199978182-199978204 GGGTGGTGGGAAGGGCAGGCAGG - Intronic
944572348 2:201057370-201057392 TAGTGACGAGAAGAACAGGCTGG - Intronic
945532524 2:210973924-210973946 TGATGAGGGGAAGAACAGCCAGG - Intergenic
946555120 2:220847844-220847866 ATGAGAAGGGAAGAGGAGGCGGG + Intergenic
946823440 2:223653226-223653248 TGGGGAAGGCAGGAGCAGTCAGG + Intergenic
947751647 2:232535662-232535684 AGGTGTGGGGTAGAGCAGGCAGG + Exonic
948536160 2:238649323-238649345 TGGTGAAGGGATGTGTGGGCAGG - Intergenic
948855841 2:240730183-240730205 TGGATCAGGGAGGAGCAGGCTGG + Intronic
948947805 2:241230018-241230040 AGGTGCAGGGGTGAGCAGGCGGG - Intronic
1168791546 20:580355-580377 TGGAGAAGGGCAGAGCTGGTGGG + Intergenic
1169280228 20:4260898-4260920 TGGATAAGGGAAGAGGAGGGAGG + Intergenic
1170548468 20:17455059-17455081 GGGAGAAGGGCAGAGCAGACAGG + Intronic
1170776801 20:19381870-19381892 TGGTGACTGGAGGGGCAGGCAGG + Intronic
1171086572 20:22243511-22243533 TGGTAAACGGGAGAGCAAGCAGG - Intergenic
1171343905 20:24451510-24451532 TGGTGAATGGCTGAGCTGGCAGG - Intergenic
1171959887 20:31485840-31485862 TGGGGAAGGGAAAAGAAGGAAGG + Intergenic
1172898201 20:38315445-38315467 GCATGAAGGGAAGAGCAGGGAGG + Intronic
1172954868 20:38748852-38748874 AGGTGAAGGGCGGAGTAGGCTGG + Exonic
1173465177 20:43275074-43275096 TGGTAAAGGAATGAGCTGGCTGG + Intergenic
1173525449 20:43729224-43729246 TGGTGACGAGAAGGGCAGACTGG - Intergenic
1173596954 20:44264600-44264622 TGGGCAGGGGAAGAGTAGGCTGG - Intronic
1173823675 20:46034043-46034065 CTGGGAAGGGAAGCGCAGGCTGG - Intronic
1174181959 20:48680578-48680600 TTGTGCAGGGAATAGCAGGGAGG - Intronic
1175551938 20:59822936-59822958 TGGGGAGGGGAAGGGCTGGCAGG + Intronic
1175933328 20:62503620-62503642 TGGGGAGGGGAAGGGGAGGCTGG + Intergenic
1175945473 20:62556562-62556584 TGAAGGAGGGGAGAGCAGGCAGG + Intronic
1176109342 20:63404385-63404407 TGGGGGAGGAAAGAGCAGGCGGG + Intergenic
1176109354 20:63404419-63404441 CGGGGGAGGAAAGAGCAGGCGGG + Intergenic
1176233202 20:64042328-64042350 TGGGGAGGGGAAGAGCGGGGAGG - Intronic
1177296635 21:19184510-19184532 TAGTAAAGGGAAGAGCAATCCGG - Intergenic
1179242089 21:39601640-39601662 TGCAGAAGGGAAGAGTGGGCAGG + Intronic
1181024022 22:20117517-20117539 GGGCGGAGGGAAGAGCGGGCGGG + Intronic
1181179355 22:21055986-21056008 TGGAAAAGGGAGGGGCAGGCAGG - Intronic
1181394966 22:22614777-22614799 TGTGTAAGGGAAGAGCAGGATGG - Intergenic
1181427098 22:22850792-22850814 GGCTGGAGGGAAGAGCAGCCTGG - Intronic
1182373099 22:29826009-29826031 AGGTTAAGGGAAGAGAAAGCAGG + Intronic
1182434768 22:30323414-30323436 CAGGGAAGGTAAGAGCAGGCAGG + Intronic
1182561333 22:31161707-31161729 TGTTCCAGGGAAGAGAAGGCTGG - Intronic
1182885337 22:33769003-33769025 TGGTGAAGTGAGGAGCAGAGAGG - Intronic
1182940891 22:34276087-34276109 TGATGAAGAGAAGAGCTGGCAGG - Intergenic
1183069945 22:35389110-35389132 TTGGGAGGGCAAGAGCAGGCAGG + Intronic
1183454878 22:37917217-37917239 TGGTGAGGGGGTGTGCAGGCCGG + Intronic
1184059338 22:42072781-42072803 GAGTGAGGGAAAGAGCAGGCAGG - Intergenic
1184077201 22:42189033-42189055 TTGTGGAGGGACAAGCAGGCAGG + Intronic
1184140269 22:42574299-42574321 TGGAGGAAGGAAGGGCAGGCTGG + Exonic
1184304543 22:43587662-43587684 TGGAGAAGGGAAGATGAGCCTGG - Intronic
1184394119 22:44222582-44222604 TGGTGAGGGGCTGAGCATGCTGG + Intergenic
1184485599 22:44776904-44776926 GGGTGATGGACAGAGCAGGCAGG - Intronic
1184673591 22:46028228-46028250 TGGATAATGGCAGAGCAGGCGGG - Intergenic
1184927585 22:47654113-47654135 TTGTGAAGGGGAGACAAGGCTGG + Intergenic
1185197537 22:49481749-49481771 TGGTGATGAGCAGAGCAGGACGG + Intronic
949337829 3:2995467-2995489 TGGAGAAGTGATGGGCAGGCTGG - Intronic
950145633 3:10647788-10647810 TGATGAATAAAAGAGCAGGCAGG + Intronic
950390638 3:12693912-12693934 AGGTGGAGGGAGAAGCAGGCTGG + Intergenic
950548397 3:13652579-13652601 AGTTGAAGGGAGGAGCAGGCTGG + Intergenic
950851162 3:16063581-16063603 TGGTAAAGGGAACATGAGGCTGG - Intergenic
951335709 3:21419142-21419164 TGGGGAAGGGAAGAAAAGGAAGG - Exonic
953538116 3:43791238-43791260 TGGGCAAGGGAAGAGCAGCTGGG - Intergenic
953729844 3:45437991-45438013 AGGTTAAGGGGAGAGCAGGAGGG + Intronic
953882814 3:46700435-46700457 TGGTGAAGGCCTGCGCAGGCTGG - Intergenic
956223803 3:66933573-66933595 AGGTGAAGAGAAGAGGGGGCTGG + Intergenic
957151051 3:76486800-76486822 TAATGAATGGAAGAGCAGACAGG + Intronic
958170111 3:89928487-89928509 TGGTGAAGGGGAGAGCTAGGAGG + Intergenic
958196023 3:90243802-90243824 TGGGGAGGGGAGGGGCAGGCAGG + Intergenic
958418502 3:93905769-93905791 TTGTAAAGGTAAGAGCAGGATGG - Exonic
959405061 3:105951438-105951460 AGGGGAAGGGAAGAACAGCCAGG - Intergenic
959916992 3:111827377-111827399 CGGTTAAGGAAAGACCAGGCCGG + Intronic
961441696 3:126957392-126957414 TGCAGAAGACAAGAGCAGGCAGG - Intronic
961706724 3:128792702-128792724 TGGGGAAGGGAAAAAAAGGCTGG - Intronic
961969753 3:130948979-130949001 AGGAGAAGGAAAGAGCAGTCGGG - Intronic
962296986 3:134199459-134199481 AGGAGCAGGGCAGAGCAGGCGGG - Intronic
962374188 3:134846715-134846737 GGGGGCAGGGCAGAGCAGGCAGG + Intronic
962807564 3:138938201-138938223 TGGTGAAGGGAGGCGAAGCCAGG + Intergenic
963500083 3:146114828-146114850 TGGTGAAGGGAAGTCCCTGCAGG + Intronic
963786006 3:149535067-149535089 TGGTGAGGGCAGGAGCTGGCTGG - Intronic
965516772 3:169630005-169630027 TGGCCAATGGAGGAGCAGGCTGG - Intronic
965796004 3:172439314-172439336 AGGACAAGGGAAGAGCAGGCAGG - Intergenic
966137745 3:176719369-176719391 TGGTGTAGGGAGGAGCAAGGTGG - Intergenic
966597532 3:181737966-181737988 AGGTGAAGGCAAGAGTAGTCAGG - Intergenic
966680603 3:182638029-182638051 TGAGAAAGGGAAGTGCAGGCTGG + Intergenic
966895914 3:184444945-184444967 TGGAGAAGGAAAGAGAAGGGAGG - Intronic
966924297 3:184634464-184634486 TGGAGAAGGGATGGGCAGGAAGG - Intronic
967223741 3:187271826-187271848 TGATGAAGGGAAGACAAGGGGGG - Intronic
967427509 3:189344419-189344441 TGGAGAGGGGAGCAGCAGGCAGG - Intergenic
967814231 3:193785865-193785887 AGGTGAAGGGAAGAGAAAGCTGG - Intergenic
968810003 4:2795538-2795560 GGGTGAGGAGAAGGGCAGGCTGG + Intronic
968967458 4:3776372-3776394 TGGTCAAGGGACCAGCAGTCGGG - Intergenic
969256151 4:6003040-6003062 TGCTGCAGGGCAGAGCAGGTGGG - Intergenic
969257594 4:6013013-6013035 TGGTGAATGGCAGAGCCAGCAGG - Intergenic
969477223 4:7428544-7428566 TGGTGGTGGGAATAGCAGGTGGG + Intronic
969527533 4:7711521-7711543 AGGCCCAGGGAAGAGCAGGCTGG + Intronic
969580895 4:8064438-8064460 TGGTGAGGGGCCGAGCATGCTGG - Intronic
969713148 4:8855902-8855924 TGGGGAGGGGGAGGGCAGGCTGG - Intronic
970000383 4:11359146-11359168 TGGGGAGAGGAAGAGAAGGCAGG + Intergenic
970853011 4:20624258-20624280 TTGTGAGGGGAAGAGGAGGAAGG - Intergenic
971265709 4:25094583-25094605 TGGTGAAAGCAAGAGCAAGGAGG - Intergenic
972999472 4:44928115-44928137 TTTTGAAGGGAAGTGCAGACAGG + Intergenic
973530997 4:51836744-51836766 TGGGGGAGGGAAGAGGAGGATGG - Intergenic
974611713 4:64226956-64226978 TGGAGAAGGAAAGTGGAGGCAGG - Intergenic
974848062 4:67375627-67375649 TATGGATGGGAAGAGCAGGCTGG - Intergenic
975974462 4:80079234-80079256 TGGTGCAGGGAAGGACAGCCTGG + Intronic
976262269 4:83156832-83156854 AGGTGTAGTGAAGAGCTGGCTGG + Intergenic
976604268 4:86968074-86968096 TGGCCAAGGGAAGAGCAGGTGGG + Intronic
976999594 4:91481081-91481103 AGGGGAAGGGAAGGGAAGGCAGG - Intronic
977114368 4:93004360-93004382 TGGTGATGGGAAAAGGAGGCAGG - Intronic
977151371 4:93516699-93516721 TGGGGAAGGGAGGAGGAGGGTGG + Intronic
977406528 4:96606738-96606760 TCTTGAAAGGAAGAGCAGACAGG - Intergenic
978632890 4:110767448-110767470 TGGTGTAGGGAGGAGGAGGCTGG + Intergenic
978983275 4:114978772-114978794 TGGTGAGGGGAATAGCAGACGGG - Intronic
981295787 4:143129588-143129610 TGGTGAAGGGAAGTCCCTGCAGG + Intergenic
981554330 4:145976717-145976739 TGGGGAAGGGAAGAGAAAGAAGG - Intergenic
981939942 4:150271522-150271544 TGGTGGGGGGAGGAGCAGCCAGG + Intronic
982297436 4:153844128-153844150 TGGTGATGGGAAGTGAAGGCAGG + Intergenic
982315747 4:154030015-154030037 TGGGGAAGGGAAGAGAAAGATGG + Intergenic
983630795 4:169847365-169847387 TGGTGAAGGGCAGTGCAAGGGGG + Intergenic
984641243 4:182166327-182166349 TGATTGAGGGAAGAGCAGGGAGG + Intronic
984725885 4:183020195-183020217 TGGCTAAGGGACTAGCAGGCAGG + Intergenic
984745023 4:183206745-183206767 TGGTGATGGTTAGTGCAGGCTGG - Intronic
984930036 4:184838922-184838944 ATGTGAGGGGAAGAGCAGGCAGG + Intergenic
985051620 4:185997728-185997750 AGGTGGTGGGAAGTGCAGGCTGG + Intergenic
985087627 4:186329601-186329623 TGTTGAAAGGAAGAGGAGGCAGG + Intergenic
985578770 5:685782-685804 AGGTGTAGGGATGAGAAGGCGGG + Intronic
985815534 5:2125356-2125378 TGGTGAAGGCAGGGACAGGCAGG + Intergenic
985837407 5:2281127-2281149 GGGTGAGCGGAAGAGCAGGTAGG + Intergenic
985884903 5:2670180-2670202 GGGTGAGGTGCAGAGCAGGCCGG - Intergenic
985986622 5:3521692-3521714 AGGTGCAGGGAAGAGGGGGCAGG - Intergenic
986588924 5:9348465-9348487 AGTTGAAGGGAGGGGCAGGCTGG - Intronic
988153142 5:27413885-27413907 TGGGGAAAGGAAGAGGAGGAGGG - Intergenic
989187122 5:38636350-38636372 TGATGTGGGGAAGAGCAGGTAGG + Intergenic
989525274 5:42446445-42446467 AGGTGAAGGGAAAAGTAGGCAGG + Intronic
991499234 5:67259651-67259673 TGAGCAAGGGGAGAGCAGGCAGG + Intergenic
991956098 5:71997277-71997299 TTGTGAAGGGAAGAAAGGGCAGG - Intergenic
993729007 5:91400538-91400560 TAAAGAAGGGAAGAGAAGGCCGG - Intergenic
994002070 5:94792221-94792243 TGGAGAAGGGCAGTGCAGGCAGG - Intronic
994660065 5:102642278-102642300 AAGGGAAGGGAAGAGCAGGAAGG + Intergenic
996192501 5:120563461-120563483 AAGGGAAGGGAAGAGCAGGAAGG - Intronic
996337238 5:122398124-122398146 TGATGAATGCAAGAGCAGGAAGG + Intronic
996847186 5:127912870-127912892 TGGTGAAGGGTAGAGCAATGTGG - Intergenic
997199253 5:131999841-131999863 GGGTGAGGGGAAAAGCAGGGGGG - Intronic
997211718 5:132080820-132080842 TGGGGCAGGGAAGAGGAGGCTGG - Intergenic
998146861 5:139734035-139734057 CGGTGCAGGGCAGTGCAGGCAGG + Intergenic
998354816 5:141526175-141526197 TGGGGCAGGGAAGAGGAGGAAGG + Intronic
998379597 5:141714701-141714723 TTAAGGAGGGAAGAGCAGGCTGG + Intergenic
998504059 5:142657847-142657869 TGGTGAAAGGCAGAGAAGCCAGG - Intronic
998808842 5:145945572-145945594 TGGTCAAGGGAAGAAAAGGCAGG + Intronic
998992966 5:147838965-147838987 TGGTGAGGGAAAGAGGAGACAGG - Intergenic
999150335 5:149422446-149422468 AGGAGAAGGGAGGAGGAGGCCGG + Intergenic
999610683 5:153366070-153366092 AGGTAAAGGGAAGAGAATGCTGG + Intergenic
999671175 5:153960345-153960367 GGGTGAGGGGAAGCTCAGGCTGG - Intergenic
1000867072 5:166526944-166526966 TGGAGAACTGAAGAGCAGGAAGG + Intergenic
1001965662 5:175908297-175908319 TGCTGAAGGGAGGACGAGGCTGG + Intergenic
1001984390 5:176061290-176061312 TGCTGAAGGGTGGACCAGGCGGG + Intronic
1001991768 5:176122550-176122572 GTGTGAAGGCAAGTGCAGGCTGG + Intronic
1002028931 5:176414156-176414178 GGGTGCAGGGAAGAGGAGGGAGG - Intronic
1002233086 5:177782774-177782796 TGCTGAAGGGTGGACCAGGCGGG - Intronic
1002262894 5:178007007-178007029 TGCTGAAGGGCGGACCAGGCGGG + Intronic
1002282836 5:178143021-178143043 AGGTGAAAGGCAGAGCAGGCAGG - Intronic
1002935253 6:1666239-1666261 TGGTGCAGGGGAGAGGATGCTGG - Intronic
1003105289 6:3210639-3210661 TGAGGAAGGGAAGAGGAAGCAGG + Intergenic
1003109472 6:3241520-3241542 TGGAGGAGGGAAGAGAAGGAAGG - Intronic
1004285992 6:14321423-14321445 AGGTAAAAGGAAGAACAGGCAGG - Intergenic
1004591993 6:17060657-17060679 TGGTGAAGCACAGAGCAGGATGG + Intergenic
1005884867 6:30089775-30089797 TGATGAAGGGGAGGGCAGGGAGG - Intergenic
1005953317 6:30647128-30647150 TCGTGAAGGGGAAAGGAGGCCGG - Exonic
1006334368 6:33412820-33412842 TCCTGGAGGGAAGAGCAAGCTGG - Intronic
1006347851 6:33497861-33497883 TGGAGGGGGCAAGAGCAGGCAGG + Intergenic
1006430689 6:33993809-33993831 GGCGGAAGGGAAGAGGAGGCAGG - Intergenic
1006579435 6:35068357-35068379 TGGGGTGGGGAGGAGCAGGCAGG + Intronic
1006770329 6:36547529-36547551 GGGTGAAGGGAGGGGCAGGGCGG - Intergenic
1007369623 6:41417865-41417887 TGGTCCAGGTAAGACCAGGCAGG + Intergenic
1007728185 6:43929507-43929529 GGGGGCAGGGATGAGCAGGCTGG + Intergenic
1007958321 6:45936903-45936925 AAGTGAAGTGAAGAGCAGGTTGG + Intronic
1009555738 6:65163530-65163552 TGGTGAGGGGACGAGCGGGTGGG + Intronic
1010481124 6:76355603-76355625 GGGTGAAGGGAAAAGGAAGCGGG - Intergenic
1010717817 6:79250125-79250147 TGGTGAAGTGCAGAGAAGGTTGG + Intergenic
1011047560 6:83102328-83102350 TGGTTAAGAGAAGAGATGGCAGG + Intronic
1012942312 6:105428172-105428194 TGCTGGAGGGAAGAGCTGGTGGG + Intergenic
1013393098 6:109706361-109706383 TGGGGATGGTCAGAGCAGGCTGG - Intronic
1013858224 6:114601742-114601764 TGGTTAAGGGAAGAAAAGGAGGG - Intergenic
1015507694 6:134006608-134006630 TGGGTAGGGGAAGAGCAGGTGGG + Intronic
1015519176 6:134114401-134114423 TGGGGTAGGGAAGAGCGGGAGGG + Intergenic
1016888887 6:148985917-148985939 CTGTGAAGGGAAAAGGAGGCAGG + Intronic
1017820165 6:158043441-158043463 TATTGAAGGGAAGGGCAGGGCGG - Intronic
1018167451 6:161111927-161111949 TGGTGAAGTGAACAGCACCCTGG + Exonic
1018665503 6:166132873-166132895 AAGTGAAGGGAAGGGCAGGAAGG + Intergenic
1019197000 6:170288941-170288963 TAGGGAAGGTGAGAGCAGGCAGG - Intronic
1019305196 7:331031-331053 TGGGGAAGGGCAGTGCAGGGAGG - Intergenic
1019327800 7:446733-446755 TGGTGCAGGGTGGGGCAGGCAGG - Intergenic
1019427576 7:984671-984693 TGGCCTGGGGAAGAGCAGGCAGG + Intronic
1019587769 7:1814304-1814326 TGGTGATGGGGAAAGCAGGGTGG + Intergenic
1019799758 7:3079592-3079614 AAGAGAAGGGAAGATCAGGCCGG + Intergenic
1020786419 7:12578946-12578968 TGGTGAAGGGAGGGCCAGTCTGG - Intronic
1022021006 7:26399092-26399114 TGGGGAAGGAAAGAGGAGGCGGG - Intergenic
1022055849 7:26733637-26733659 TGGAGAAGGGGAGAGCAGGGAGG + Intronic
1022650319 7:32267988-32268010 TGGTGAAGGAAAAGTCAGGCTGG + Intronic
1022833184 7:34088546-34088568 TGGGGAAGGGGACAGCAAGCTGG + Intronic
1022896047 7:34751274-34751296 TGGTGAACAGAAGATGAGGCTGG + Intronic
1025212949 7:57031473-57031495 TGGAGAAGGGAACCTCAGGCAGG - Intergenic
1025659003 7:63545351-63545373 TGGAGAAGGGAACCTCAGGCAGG + Intergenic
1025764876 7:64434629-64434651 TGGGATAGGGAAGAGCAGGGTGG - Intergenic
1026621282 7:71952015-71952037 TGGTGGAGGGAGAACCAGGCAGG + Intronic
1027195502 7:76027292-76027314 TGGGGAAGGGAAGAGGGGACAGG + Intronic
1027801076 7:82749751-82749773 TGGCTAAGGGAAGAGAAGGAGGG - Intergenic
1029049133 7:97665497-97665519 TGGAGAGGAGAAGAGAAGGCAGG - Intergenic
1029365468 7:100113591-100113613 TGGGGGAGGGGAGAGCAGGGTGG - Intronic
1030066700 7:105665008-105665030 TGGTGACAGGAACAGCAGGGGGG + Intronic
1030145444 7:106349487-106349509 TGGTGTAGGGAGGAGAAGCCAGG + Intergenic
1030327786 7:108239561-108239583 TGGTGAAGGGATGAGTGGGGAGG + Intronic
1030710520 7:112743521-112743543 TGCAGAAGGGAAGAGTAGGAGGG + Intergenic
1032702152 7:134391698-134391720 TGGTGTGGAGAAGAGAAGGCAGG + Intergenic
1033050978 7:138003807-138003829 TGATGAAGGGGATACCAGGCTGG - Intronic
1033274567 7:139961690-139961712 TGGGGCAGTGAAGAGCAGCCTGG - Intronic
1034936558 7:155204018-155204040 TGGTGAAGGGATGGGCACTCGGG + Intergenic
1035249179 7:157585762-157585784 TGGGGATGGGAGGAGCTGGCCGG + Intronic
1035263423 7:157675644-157675666 TGGAAACGGGAGGAGCAGGCAGG + Intronic
1035357232 7:158283532-158283554 TGGTGGAGGGAATGGCATGCAGG + Intronic
1035484850 7:159214938-159214960 TTGTAAAGGGAAAAGCAAGCTGG + Intergenic
1035542880 8:455475-455497 TGGAGAAGGGCAGAGCAGTTGGG + Intronic
1035840905 8:2811130-2811152 TGGTGAATGGCAGACCAGGAAGG - Intergenic
1037062652 8:14534218-14534240 AGGAGAAGAGAAGAGCTGGCTGG + Intronic
1037577099 8:20217276-20217298 TGGAGAAGGGATGACCAGGAAGG + Exonic
1037630550 8:20651812-20651834 TGGGGAAGGGGAGAAGAGGCTGG - Intergenic
1037748181 8:21662853-21662875 TGGTGAAGGGAGGAACAGCCTGG - Intergenic
1038165379 8:25080707-25080729 TGGGGCAGGGGAGGGCAGGCAGG + Intergenic
1038401206 8:27286345-27286367 TGGGAGAGGGAAGAGGAGGCTGG - Exonic
1038722238 8:30047310-30047332 TGGAGAAAGGGAGAGGAGGCGGG - Intergenic
1039017044 8:33161476-33161498 CGGGGAAGGGAAGAGCAGATTGG + Intergenic
1039578436 8:38644325-38644347 TGGTGAAGGAAAGAGGAGGCTGG - Intergenic
1039725122 8:40207121-40207143 TGGGGATGGGAGGAGCAGTCAGG - Intergenic
1039828999 8:41198027-41198049 TGGTGGAGTGGAGAGAAGGCTGG + Intergenic
1039973616 8:42341108-42341130 TGGGGTAGGGAGGAGCATGCAGG - Intronic
1042320433 8:67469638-67469660 TGCTAAAGAGAAGAGCAGGAGGG - Intronic
1043452511 8:80382234-80382256 TGAAGAAGTGATGAGCAGGCAGG - Intergenic
1044154278 8:88823862-88823884 TGGTGATGGCAACAGTAGGCTGG - Intergenic
1044182052 8:89208364-89208386 TGGTGAGTGGAGCAGCAGGCAGG + Intergenic
1045329950 8:101146962-101146984 AAGTGAAGGAAAGAGCAGACAGG - Intergenic
1045694925 8:104798174-104798196 ACTGGAAGGGAAGAGCAGGCAGG - Intronic
1046740266 8:117820232-117820254 AGGTGAAAGGAAGAGCATCCAGG + Intronic
1047654901 8:126966518-126966540 TGGTGAAGTGAAGAGCATCCAGG - Intergenic
1048210272 8:132449246-132449268 TGGAGAAGGGATGCGGAGGCAGG - Intronic
1048964336 8:139604443-139604465 TGGTTGAGGGAACAGCAGGTGGG + Intronic
1049384912 8:142338322-142338344 TGGTTCAGTGAAGAGCAGGTGGG - Intronic
1050758081 9:9032895-9032917 TGGGGAAGGGACAAGAAGGCCGG - Intronic
1051161590 9:14214225-14214247 CTGTGAGGAGAAGAGCAGGCTGG - Intronic
1051540431 9:18210083-18210105 TGGTGAAGGAAAGAAAAGGAAGG - Intergenic
1051875602 9:21790217-21790239 AGGTGAAGGGAAGAGAGGGGAGG + Intergenic
1052079495 9:24186790-24186812 AGGTGTAAGGAAGATCAGGCAGG - Intergenic
1052323161 9:27190186-27190208 AGGTGAGGGGAAGAGGAGGCTGG + Intronic
1052602473 9:30652992-30653014 TGGGGGAGGGGAGAGCAGGAGGG - Intergenic
1052743305 9:32415100-32415122 TGGGGGTGGGAAGAGCATGCTGG + Intronic
1055419227 9:76119933-76119955 TGGTGATGGGAAGTGCTGGGGGG - Intronic
1055640687 9:78316633-78316655 TGGAGTTGGGAAGAGCAGGGTGG + Intronic
1056579859 9:87882914-87882936 TAGGGAAGGGCAGGGCAGGCAGG + Exonic
1056625391 9:88248936-88248958 TGGTCAAGGTGAGAACAGGCTGG + Intergenic
1056686235 9:88763476-88763498 AGGTGAATGGAAGAGAAGGAAGG + Intergenic
1057046786 9:91892327-91892349 TGCAGAAGGGCAGAGCAGCCTGG + Intronic
1057167161 9:92938040-92938062 TGGGGAGGGGATGAGGAGGCTGG - Intergenic
1057421919 9:94919634-94919656 TGATGAAGGAAAGAGAAGACAGG + Intronic
1057949495 9:99358714-99358736 CGGGGAAAGGGAGAGCAGGCAGG + Intergenic
1058059649 9:100481666-100481688 TGGAGAAGGGAAGAGCCTGGCGG + Intronic
1058410208 9:104723602-104723624 TGAAGAAGGGAAGAGGAGGAAGG - Intergenic
1058591640 9:106571674-106571696 TGGTGGAGGGAAGAGATGGTGGG - Intergenic
1058851359 9:109014052-109014074 TGGTGAAAGAATGAGCAGGGTGG - Intergenic
1058927622 9:109683086-109683108 TGGTGAAAGCAGGAGCAAGCGGG - Intronic
1059457739 9:114410428-114410450 TGGAGGAGGCCAGAGCAGGCAGG + Intronic
1059937923 9:119330334-119330356 TGCTGGAGGGAAGAGCATGGGGG - Intronic
1060006064 9:120000899-120000921 TGGTGAAGGGAGCAACTGGCTGG - Intergenic
1060093545 9:120766214-120766236 TGGGGAAGGAAAGAGTTGGCAGG + Intronic
1060624339 9:125096592-125096614 TGGGGACAGGAAGAGGAGGCTGG - Intronic
1060634530 9:125189575-125189597 TGGAGAAAGGAAGGGCCGGCCGG + Exonic
1060787869 9:126464792-126464814 TGGTCAAGGGCAGAGCTGGGTGG - Intronic
1060952481 9:127612752-127612774 GGGTGAAGGGAAGAGAGGGAGGG - Intronic
1061001636 9:127905986-127906008 TGGCGAAGCAAGGAGCAGGCTGG - Intergenic
1061862280 9:133474120-133474142 GGGGGATGGGAACAGCAGGCAGG - Intronic
1062177473 9:135171884-135171906 CAGTGAAGGGAAGGGCAGCCGGG + Intergenic
1062388355 9:136324155-136324177 TGGGGAAGGAAGAAGCAGGCCGG - Intergenic
1185535428 X:857840-857862 AGGGGAAGGGAAGAGAAGGAAGG + Intergenic
1185732690 X:2474003-2474025 AGGTGCAGAGAGGAGCAGGCTGG + Intronic
1185733289 X:2478225-2478247 AGGTGCAGAGAGGAGCAGGCTGG + Intronic
1186402481 X:9272373-9272395 GGGAGAGGGGAAGAGGAGGCGGG + Intergenic
1186411181 X:9345736-9345758 TGGTGAGGGGAGGAGAAGGATGG + Intergenic
1187046788 X:15655170-15655192 TGGTGGAGGGGAGCACAGGCAGG - Intronic
1187053017 X:15713365-15713387 TGGTGGAGGGGAGCACAGGCAGG - Intronic
1187175712 X:16894659-16894681 TGGTGTTGGGAAGACCAGGTGGG - Intergenic
1188057948 X:25563405-25563427 TGGTGATGGGAGGAGCAAGGGGG + Intergenic
1188523162 X:31060748-31060770 TTGTGAGAGGAAGAGCTGGCCGG - Intergenic
1189284202 X:39840147-39840169 AGGGGGAGGGGAGAGCAGGCTGG + Intergenic
1189326975 X:40118600-40118622 GGGTGAAGGGAAGATAAGACTGG - Intronic
1189335945 X:40171113-40171135 GGGTGTAGGCAGGAGCAGGCTGG - Intronic
1189404316 X:40705946-40705968 TGGTTTAGGGGAGAGGAGGCAGG - Intronic
1189477000 X:41363869-41363891 TGGTGAAATGAAGAGCGGTCAGG - Intronic
1190177972 X:48167174-48167196 TGGGGAAGGGAAGGGCAGAGGGG + Intergenic
1190180178 X:48185249-48185271 TGGGGAAGGGAAGGGCAGAGGGG - Intergenic
1190189870 X:48268272-48268294 TGGGGAAGGGAAGGGCAGAGGGG + Intronic
1190193193 X:48294472-48294494 TGGGGAAGGGAAGGGCAGAGGGG - Intergenic
1190199162 X:48345452-48345474 TGGGGAAGGGAAGGGCAGAGGGG - Intergenic
1190508806 X:51156416-51156438 TGAAGAAGGGATGAGCAGGAGGG - Intergenic
1190658614 X:52634772-52634794 TGGGGAAGGGAAGGGCAGAGGGG + Intergenic
1190665930 X:52695920-52695942 TGGGGAAGGGAAGGGCAGAGGGG - Intronic
1190673488 X:52762490-52762512 TGGGGAAGGGAAGGGCAGAGGGG + Intronic
1190677033 X:52791261-52791283 TGGGGAAGGGAAGGGCAGAGGGG + Intergenic
1190789560 X:53686370-53686392 TGGGGGAGGGGAGAGGAGGCGGG + Intronic
1191714204 X:64183020-64183042 TGGAAAAGGGTAGGGCAGGCTGG - Intergenic
1191850568 X:65582924-65582946 TGGAGAAAGGGAGAGCAGGAGGG + Intergenic
1192336369 X:70223716-70223738 TAGTGAAGGGAAGAGAAACCAGG + Intergenic
1192592010 X:72368184-72368206 TGGTGAACGGAAAGGCAGGCAGG - Intronic
1193200254 X:78681280-78681302 TGTTGAAGGAAAGAGCCGGTGGG + Intergenic
1194948903 X:100101416-100101438 TGCAGAAGGGAACAGCATGCAGG + Intergenic
1195176163 X:102317353-102317375 TGGGGAAGAGGAGAGAAGGCGGG - Intronic
1195182701 X:102369740-102369762 TGGGGAAGAGGAGAGAAGGCGGG + Intronic
1196384434 X:115133324-115133346 TGGTGAAGGAAGAAGCAGGGTGG + Intronic
1196580409 X:117372738-117372760 TGGTAAATGGCAGAGCAGCCTGG - Intergenic
1196640097 X:118049728-118049750 TGGTCAAGGGGAAACCAGGCAGG - Intronic
1196904627 X:120419271-120419293 AGGTGAAGGGAAGTGGAGGCTGG + Intergenic
1196960411 X:120994208-120994230 AGGTGAAGGGAAGCTGAGGCAGG - Intergenic
1197263133 X:124337391-124337413 AGGTGAAGGGGAGTGGAGGCTGG + Intronic
1197876578 X:131115063-131115085 GAGGGAAGGGAAGAGCAGGGAGG - Intergenic
1197888166 X:131239614-131239636 TTGTGAAGGGAAGGGCATGCTGG - Intergenic
1198640438 X:138750125-138750147 TGGGGAGGGGAAGAGGAGGTAGG + Intronic
1199393733 X:147309979-147310001 ATGTGGAGGGAAGAGCAGGAAGG + Intergenic
1199754600 X:150852426-150852448 TAGTGAAGGGAAGAGATGGGAGG - Intronic
1200212285 X:154352101-154352123 GGGTGGAGGAAAGAGCCGGCAGG - Intronic