ID: 1068301825

View in Genome Browser
Species Human (GRCh38)
Location 10:55153320-55153342
Sequence AACTTGGTGAAGGGAAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068301825_1068301829 -7 Left 1068301825 10:55153320-55153342 CCTGCTCTTCCCTTCACCAAGTT No data
Right 1068301829 10:55153336-55153358 CCAAGTTGCTCACCTTGACACGG No data
1068301825_1068301833 11 Left 1068301825 10:55153320-55153342 CCTGCTCTTCCCTTCACCAAGTT No data
Right 1068301833 10:55153354-55153376 CACGGGCTGCATCAGCCTGGAGG No data
1068301825_1068301832 8 Left 1068301825 10:55153320-55153342 CCTGCTCTTCCCTTCACCAAGTT No data
Right 1068301832 10:55153351-55153373 TGACACGGGCTGCATCAGCCTGG No data
1068301825_1068301830 -6 Left 1068301825 10:55153320-55153342 CCTGCTCTTCCCTTCACCAAGTT No data
Right 1068301830 10:55153337-55153359 CAAGTTGCTCACCTTGACACGGG No data
1068301825_1068301834 16 Left 1068301825 10:55153320-55153342 CCTGCTCTTCCCTTCACCAAGTT No data
Right 1068301834 10:55153359-55153381 GCTGCATCAGCCTGGAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068301825 Original CRISPR AACTTGGTGAAGGGAAGAGC AGG (reversed) Intronic
No off target data available for this crispr