ID: 1068301830

View in Genome Browser
Species Human (GRCh38)
Location 10:55153337-55153359
Sequence CAAGTTGCTCACCTTGACAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068301822_1068301830 26 Left 1068301822 10:55153288-55153310 CCAAGATCACCTGAGTGGGAGGT 0: 1
1: 0
2: 0
3: 9
4: 143
Right 1068301830 10:55153337-55153359 CAAGTTGCTCACCTTGACACGGG No data
1068301823_1068301830 17 Left 1068301823 10:55153297-55153319 CCTGAGTGGGAGGTGAAATCCAG 0: 1
1: 0
2: 1
3: 12
4: 182
Right 1068301830 10:55153337-55153359 CAAGTTGCTCACCTTGACACGGG No data
1068301824_1068301830 -2 Left 1068301824 10:55153316-55153338 CCAGCCTGCTCTTCCCTTCACCA 0: 1
1: 0
2: 2
3: 63
4: 599
Right 1068301830 10:55153337-55153359 CAAGTTGCTCACCTTGACACGGG No data
1068301825_1068301830 -6 Left 1068301825 10:55153320-55153342 CCTGCTCTTCCCTTCACCAAGTT No data
Right 1068301830 10:55153337-55153359 CAAGTTGCTCACCTTGACACGGG No data
1068301820_1068301830 27 Left 1068301820 10:55153287-55153309 CCCAAGATCACCTGAGTGGGAGG 0: 1
1: 0
2: 1
3: 6
4: 137
Right 1068301830 10:55153337-55153359 CAAGTTGCTCACCTTGACACGGG No data
1068301818_1068301830 29 Left 1068301818 10:55153285-55153307 CCCCCAAGATCACCTGAGTGGGA 0: 1
1: 0
2: 0
3: 12
4: 106
Right 1068301830 10:55153337-55153359 CAAGTTGCTCACCTTGACACGGG No data
1068301819_1068301830 28 Left 1068301819 10:55153286-55153308 CCCCAAGATCACCTGAGTGGGAG 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1068301830 10:55153337-55153359 CAAGTTGCTCACCTTGACACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068301830 Original CRISPR CAAGTTGCTCACCTTGACAC GGG Intronic
No off target data available for this crispr