ID: 1068303045

View in Genome Browser
Species Human (GRCh38)
Location 10:55170581-55170603
Sequence CTGGTAGAAAGCATAATTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068303041_1068303045 6 Left 1068303041 10:55170552-55170574 CCTAGTAGCAGGTATATGTACAG 0: 1
1: 0
2: 2
3: 7
4: 122
Right 1068303045 10:55170581-55170603 CTGGTAGAAAGCATAATTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068303045 Original CRISPR CTGGTAGAAAGCATAATTGA TGG Intronic
No off target data available for this crispr