ID: 1068305964

View in Genome Browser
Species Human (GRCh38)
Location 10:55208679-55208701
Sequence GGAGCAAATATGTGAAAAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 276}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068305964_1068305966 8 Left 1068305964 10:55208679-55208701 CCGGCTTTTCACATATTTGCTCC 0: 1
1: 0
2: 0
3: 22
4: 276
Right 1068305966 10:55208710-55208732 TTTCCTTTCCTACATACCCCTGG No data
1068305964_1068305967 9 Left 1068305964 10:55208679-55208701 CCGGCTTTTCACATATTTGCTCC 0: 1
1: 0
2: 0
3: 22
4: 276
Right 1068305967 10:55208711-55208733 TTCCTTTCCTACATACCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068305964 Original CRISPR GGAGCAAATATGTGAAAAGC CGG (reversed) Intronic
903038587 1:20511377-20511399 GGAGCAAGTAATTGAAAAGGAGG + Intergenic
903258533 1:22118620-22118642 TGAGGAAAGATGTGAACAGCTGG - Exonic
903946404 1:26966638-26966660 GGAGCAACCATGGGGAAAGCAGG - Intergenic
904241495 1:29149151-29149173 GGAGCAAGAAAGAGAAAAGCAGG - Exonic
907814797 1:57908136-57908158 GGAGCAATTCTGTTAAAAGAAGG - Intronic
908445786 1:64198403-64198425 GTTGCAGAGATGTGAAAAGCTGG - Intergenic
911497031 1:98644324-98644346 GAATCAAATATGTGATAAGGAGG - Intergenic
912141930 1:106740639-106740661 GTGGCAAACATATGAAAAGCAGG + Intergenic
913502444 1:119483572-119483594 GGAGCAGTTGTGTGAAAGGCAGG + Intergenic
914917140 1:151825823-151825845 TGAGCAAATCTGAGCAAAGCAGG - Intronic
917242468 1:172963560-172963582 CCAGCAAATATATGAAAAGAAGG + Intergenic
918754055 1:188313675-188313697 TAAGCAAATATATGCAAAGCTGG - Intergenic
920874357 1:209820467-209820489 AAAGTAAATATGAGAAAAGCTGG + Intergenic
921393321 1:214639558-214639580 GGAATAAATATTTGAAAAGATGG + Intronic
924948420 1:248861447-248861469 GGAGCAAACAGATGAACAGCTGG - Intergenic
1064455933 10:15487539-15487561 GGAGCAAAAGTGTGAAGAGAAGG + Intergenic
1064786203 10:18899067-18899089 GGATCAAATAAGTGAAAGGATGG - Intergenic
1065556958 10:26925589-26925611 GGAACAAATAATTGATAAGCTGG + Intergenic
1068305964 10:55208679-55208701 GGAGCAAATATGTGAAAAGCCGG - Intronic
1069033346 10:63621397-63621419 GAAACAAATATTTGAAAACCAGG + Exonic
1072073733 10:91947141-91947163 GTAGAAAATATGTGTAAATCAGG - Intronic
1072413845 10:95230827-95230849 GGGGCAAATATGGGAGACGCGGG + Intergenic
1075143512 10:119863064-119863086 GGAGAATATATTTGAAAATCCGG - Intronic
1075619470 10:123915168-123915190 GGAGCAAGTGTGTGAAGGGCAGG - Intronic
1076163474 10:128263693-128263715 TGAGCAAGTTTGAGAAAAGCCGG + Intergenic
1079771249 11:24462421-24462443 GGAGCAAATCTAAGAACAGCAGG - Intergenic
1080696369 11:34606256-34606278 GGAGCCAGTATGTAAAAATCAGG + Intergenic
1082690462 11:56296688-56296710 GTTGCAAATAGGTGAAAATCAGG + Intergenic
1082773608 11:57228683-57228705 GGAGAAAAGGTGAGAAAAGCTGG - Intergenic
1082888547 11:58113685-58113707 GGAACAAATATGTCAAGTGCAGG - Intronic
1083609344 11:63997778-63997800 GGAGTAGATAGGTGAAAAGCAGG - Exonic
1084376258 11:68779937-68779959 GAAGCAAGCATGTGAAAATCTGG - Intronic
1084381793 11:68817574-68817596 GGAGCAACCATGGGAAGAGCAGG + Intronic
1084517181 11:69643334-69643356 GGAGCAGATATGTCAGAGGCGGG - Intronic
1084600350 11:70141832-70141854 GGAGCAGAAATGTGAACAGCTGG - Intronic
1084713249 11:70857351-70857373 GGAGCAGGTGTTTGAAAAGCGGG - Intronic
1086281570 11:85195419-85195441 GAAGAAAATAAGTGAAAAGGAGG + Intronic
1087655446 11:100917495-100917517 GGAGCAAATTTGGGAAAAGAGGG - Intronic
1087760915 11:102103610-102103632 GGGGAAACTATGTGAAAAGGAGG + Intergenic
1088208600 11:107425663-107425685 GAAGCAAATATGAGAGCAGCTGG - Intronic
1089131934 11:116219187-116219209 GGATCAAAGTTTTGAAAAGCTGG + Intergenic
1094022166 12:25926101-25926123 GGAGAATCTAAGTGAAAAGCAGG - Intergenic
1094356019 12:29578476-29578498 GGAATAAATATGGGTAAAGCTGG - Intronic
1095195150 12:39305538-39305560 GGAGCTAAAATGAAAAAAGCTGG - Intronic
1096783909 12:54006383-54006405 GGAGGAGATAAGTGCAAAGCAGG + Intronic
1098070592 12:66670221-66670243 GGAGAAAATAGTTGAAAGGCAGG - Intronic
1098698587 12:73592496-73592518 GAAGCATCTATGTGAAATGCTGG - Intergenic
1100433054 12:94547397-94547419 GGGCAAAATATGTGAAATGCAGG - Intergenic
1100965273 12:100006193-100006215 GAAGCAAATGTTTGAAAAGGAGG + Intergenic
1101145868 12:101839878-101839900 GGAGCAAATATGGAAAGAGTTGG + Intergenic
1103268113 12:119648068-119648090 GGACCAGCTATGTGAAAATCTGG - Intergenic
1105845008 13:24286540-24286562 GGAGCAAAAATGTTAAAGGCAGG + Intronic
1106589344 13:31086170-31086192 GGAGCAGAAATGAGAAACGCAGG - Intergenic
1110759547 13:79216341-79216363 GGAGGAAATATATGCAAAGCAGG - Intergenic
1110950676 13:81486253-81486275 GGAAAAAATATGTGAAATGATGG + Intergenic
1111244545 13:85518572-85518594 GAACCCAATATGTGAAAAGTTGG - Intergenic
1112667015 13:101586376-101586398 GGAGCCAAGCTGTGGAAAGCTGG - Intronic
1113283883 13:108824380-108824402 AAAGCAAATATATGAAAATCTGG + Intronic
1114366823 14:22036231-22036253 GGAGTAAATATTTAAAAACCAGG + Intergenic
1114842478 14:26281550-26281572 GGAGAAAATATGAGAAGAGGGGG + Intergenic
1115370806 14:32612004-32612026 GGAGCAATTATTTGAATAGAGGG + Intronic
1116238201 14:42308510-42308532 GAAGAAAATCTGAGAAAAGCAGG - Intergenic
1117651879 14:57915948-57915970 GTAGCAAATATCTGAAAATGTGG - Intronic
1118643147 14:67811398-67811420 GGAGCAAAAATTTAAAAAACTGG + Intronic
1118643244 14:67813132-67813154 GGAGCAAAAATTTAAAAAACTGG + Intronic
1119251717 14:73161273-73161295 GGAGAAAATATCTGCAAATCAGG - Intronic
1119953515 14:78770463-78770485 GGAGCAAAGATGTGCAAGGATGG + Intronic
1120383402 14:83811935-83811957 AAAGCATATATGTGTAAAGCTGG + Intergenic
1120618523 14:86735456-86735478 GAAGCAAATATGGGGAAATCGGG - Intergenic
1120731220 14:88003356-88003378 GAAGCAAATTTCTTAAAAGCTGG + Intergenic
1121080940 14:91107895-91107917 GGAGCAAAGATGTGGAGATCAGG + Intronic
1124150333 15:27172206-27172228 GGAGCAAAAATGTGATATGACGG + Intronic
1124866182 15:33493592-33493614 GGTGCCAATAGGTGAAAAGTTGG - Intronic
1125812740 15:42555579-42555601 TTAGCATATATGTGAAAAGAGGG - Intronic
1127757577 15:62107868-62107890 GGAGGAAATGAGGGAAAAGCAGG - Intergenic
1128348825 15:66875587-66875609 TGCGCAAATATGTGAAGAGCGGG + Intergenic
1129342015 15:74892431-74892453 GGGGCAAATCAGGGAAAAGCTGG - Intronic
1131417543 15:92273649-92273671 GCAGCAAACATGTGCAGAGCCGG - Intergenic
1131887471 15:96932769-96932791 TGTGCAAATATTTGCAAAGCAGG + Intergenic
1131931925 15:97452229-97452251 GGAGCACAGATTTGAAAAGGTGG + Intergenic
1137929170 16:52570376-52570398 TGAGCAAAGACTTGAAAAGCAGG - Intergenic
1140071260 16:71652105-71652127 GGAGAAAATATTTGCAAAACAGG + Intronic
1140203940 16:72918205-72918227 CAAGCAAATAAGTCAAAAGCAGG + Intronic
1140729702 16:77844981-77845003 GAGGCAGTTATGTGAAAAGCAGG + Intronic
1141006284 16:80355758-80355780 GTAGCAAATGTGAGAAAAGAGGG + Intergenic
1141315489 16:82958751-82958773 GTAGCAGTCATGTGAAAAGCAGG + Intronic
1143318658 17:6053194-6053216 AGAGTCAGTATGTGAAAAGCTGG - Intronic
1144391183 17:14795025-14795047 AAAGCAAATGTGTGAAAAACAGG - Intergenic
1145023115 17:19447392-19447414 GGAGCAGCTCTCTGAAAAGCTGG + Intergenic
1145198682 17:20919603-20919625 GAAGCAACTATGGCAAAAGCAGG - Intergenic
1148586189 17:48782454-48782476 GGAGAAAATATTTGCAAACCAGG - Intronic
1149931492 17:60760837-60760859 TGACCAAATATTTGAAATGCTGG - Intronic
1149996097 17:61406707-61406729 GCAGCAAATATTTTAAAAGTTGG + Intronic
1150258169 17:63766281-63766303 GTACCAAATAAGAGAAAAGCAGG - Intronic
1150854950 17:68743587-68743609 GGAAAAAAAAAGTGAAAAGCCGG + Intergenic
1151729734 17:75904287-75904309 GGAGCAAATATTTTAGGAGCTGG + Intronic
1151823934 17:76513069-76513091 TAAGCAAACATGTGAACAGCGGG - Intergenic
1152071283 17:78134938-78134960 GGACCAGAAATGTGAACAGCAGG - Exonic
1153860906 18:9204682-9204704 GGAGCAAAAATGGGAAAATGTGG - Intronic
1153942795 18:9991894-9991916 GGAGCATAGGTGTGAGAAGCTGG - Intergenic
1154939226 18:21094344-21094366 GGAGAAAATATGTGCAAACAAGG + Intronic
1156042425 18:32837401-32837423 AGAGCAGAAATCTGAAAAGCAGG - Intergenic
1156276250 18:35585344-35585366 TGAGCAAATCTATGAAAAACAGG - Intronic
1156354635 18:36330629-36330651 GGATCAAGCCTGTGAAAAGCTGG + Intronic
1156567297 18:38207316-38207338 GGACAAAATATGTGTAAAACAGG - Intergenic
1156850793 18:41723753-41723775 GGAGCAAGTAAGTGAACAGAGGG + Intergenic
1157550013 18:48575015-48575037 GGAGCAAAATTCTGAAAACCTGG - Intronic
1157794578 18:50561376-50561398 GCACCTACTATGTGAAAAGCAGG + Intronic
1158561330 18:58516257-58516279 GGACCAAATATGTGGATAGGAGG + Intronic
1161514598 19:4689579-4689601 GGAGCAGCTATGGGAGAAGCCGG + Exonic
1163129080 19:15260842-15260864 GGAGAAAATCTGCGAAAAGGAGG + Intronic
1163199068 19:15749546-15749568 GGAGAATATGTGTGCAAAGCTGG - Intergenic
1166997118 19:46724935-46724957 GGGACAAATATGTGGAAAGGGGG + Intronic
1167041632 19:47026278-47026300 GGAGCAGCTGTGAGAAAAGCTGG + Intronic
1167062570 19:47158928-47158950 GGATAAAATATGTGAACATCGGG + Intronic
1167158022 19:47750953-47750975 GGAGCAGCTATGGGAGAAGCTGG + Exonic
1168517602 19:57021401-57021423 GAAGGAAATGTGGGAAAAGCAGG - Intergenic
925500378 2:4497323-4497345 GGAGAAAATATATGAAAGACTGG - Intergenic
926931112 2:18041987-18042009 GGAGCTAATATGAGAACAGAAGG - Intronic
927815635 2:26214401-26214423 GAAGGAAATATGAGAAAAGTGGG + Intronic
929101223 2:38316154-38316176 GGAGCAAATAAGTGATACTCTGG + Intronic
929905367 2:46041155-46041177 GGTACAAATATGAGAAAAACTGG - Intronic
931521576 2:63103439-63103461 GGAGCAACAAAATGAAAAGCTGG - Intergenic
932971396 2:76547570-76547592 GGAGCAAAGATGTGGAATCCTGG + Intergenic
932995471 2:76846043-76846065 TGCGCATATATATGAAAAGCAGG - Intronic
933292574 2:80454220-80454242 GGATCAAATAAGAGAAAAGGAGG + Intronic
933425879 2:82112009-82112031 AGACCAAAAATGTGAAAAGGAGG + Intergenic
936578769 2:113677391-113677413 GGAGCTGATATTTGAAAAGTAGG - Intergenic
937133543 2:119531915-119531937 GATTTAAATATGTGAAAAGCAGG - Intergenic
937500854 2:122477086-122477108 AGAGCAAATGTTTGAAAAGAAGG + Intergenic
937959007 2:127440244-127440266 GGGGAAAATAGGTGAAAAGATGG - Intronic
938070958 2:128308150-128308172 GCAGGAAACATGTGAAACGCAGG + Intronic
940678785 2:156757450-156757472 GGAGCAGATATTTGTAAAGGTGG - Intergenic
943448964 2:188024337-188024359 GGAGCAAAAATATAAAAAGAAGG - Intergenic
944004980 2:194893571-194893593 AGATCAAAGATATGAAAAGCTGG - Intergenic
944511431 2:200469889-200469911 GGAGGAAAGAGATGAAAAGCAGG - Intronic
946380797 2:219347455-219347477 GGGGGAAATATATGAAAAGGAGG - Intergenic
946885737 2:224220692-224220714 AGAGCAAATCTGTGTAAAGCTGG - Intergenic
947134309 2:226961795-226961817 TGAGTTAATATGTGGAAAGCAGG - Intronic
948077620 2:235178120-235178142 GGAGCAAGTGTGGGACAAGCAGG - Intergenic
948682671 2:239646530-239646552 GGACAAAATATGTGAAACGATGG - Intergenic
1169103909 20:2977834-2977856 GAAGGAAATATGTGAACATCAGG + Intronic
1170388928 20:15851193-15851215 AGAGGAAACATGTGAGAAGCAGG + Intronic
1173041164 20:39464320-39464342 GAAGCAGCTTTGTGAAAAGCTGG + Intergenic
1173129990 20:40383210-40383232 GGAGCCACCATGTGAAAATCTGG + Intergenic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1174719838 20:52799855-52799877 GGAGCACATATGTGAAGATGTGG - Intergenic
1174721832 20:52821068-52821090 AAAGCAAACATGTGAAAAGTTGG + Intergenic
1175646379 20:60676440-60676462 GGAGCAAAGAAATGAAAAACTGG + Intergenic
1177562602 21:22775771-22775793 GCAGCAAATATGTGTAATACAGG - Intergenic
1178519765 21:33279026-33279048 GGAGCATATATGTGCTAATCAGG + Intronic
1179483363 21:41692685-41692707 GGAACAAAAATTAGAAAAGCTGG + Intergenic
1182832112 22:33312867-33312889 GAAACACATATGTGAAAAGAGGG + Intronic
1183124606 22:35764151-35764173 GTATCATCTATGTGAAAAGCTGG + Intronic
1183259017 22:36782258-36782280 GCAGCAAATAAGTCAAAAGGCGG - Intergenic
949463933 3:4324663-4324685 GAAGTAAACATGTGAAAAGAGGG + Intronic
951491847 3:23279656-23279678 GGAGAGAATATTTGTAAAGCTGG + Intronic
951792905 3:26506104-26506126 GGAGAAAATATTTTAAAAGCAGG - Intergenic
952168336 3:30776542-30776564 GGAGCAAAGATGTGGAGAGATGG - Intronic
952503947 3:33990366-33990388 GGAGGGAATCTGTGGAAAGCAGG - Intergenic
955025267 3:55161385-55161407 TAAACAAATATGTGAAAAGCTGG + Intergenic
955667931 3:61369892-61369914 GGAGCAAGTATGTGAATCCCTGG + Intergenic
956014135 3:64863262-64863284 GGTTCCAATATCTGAAAAGCTGG + Intergenic
957840686 3:85664871-85664893 GGAAAAAATATCTGAAAAGGAGG - Intronic
957970223 3:87374382-87374404 GGAACAGAGTTGTGAAAAGCTGG + Intergenic
959035253 3:101355130-101355152 GGAGGAAATATTTGCAAAGTAGG - Intronic
959358185 3:105358506-105358528 GGAGCTAAAATGTGGAAAGAAGG + Intergenic
959540883 3:107536920-107536942 TGAGTAAATATCTGAAAAACTGG + Intronic
960218242 3:115070171-115070193 GGTGAAAAAATGTAAAAAGCTGG - Intronic
960446542 3:117756479-117756501 GGAGGAAGTATGAGAAATGCTGG + Intergenic
960756028 3:121013583-121013605 GGAGAAAATATTTGCAAACCAGG - Intronic
962082716 3:132157592-132157614 GGAGCAAACAGATGAAAAGAAGG - Intronic
963204034 3:142614563-142614585 GGAGCAAATATATAAAAATTAGG - Intronic
964419237 3:156483943-156483965 GCAGAAAATATGTGAAGAGCTGG + Intronic
964601758 3:158508917-158508939 GGAGAAAATATCTGCAAATCAGG - Intronic
965125512 3:164623812-164623834 GGAGAAAATATGTGAAAGCTGGG - Intergenic
965361540 3:167746484-167746506 GGAGAAAATATTTGCAAATCAGG + Intronic
966676675 3:182597459-182597481 TGTGAAAATATGTGAAAAGCAGG - Intergenic
967327095 3:188251941-188251963 GGAGCAAATATCTGAGAGACTGG - Intronic
967387706 3:188927599-188927621 GGAGAAAATATTAGAAAAGAAGG - Intergenic
968347954 3:198027089-198027111 GAAGTACATATGTGAAAAGGTGG - Intronic
969668754 4:8577664-8577686 GGAGGAAAAATGAGAAAAGCGGG + Intronic
970561236 4:17284104-17284126 GTTACAAATATGTGAAGAGCAGG - Intergenic
971313884 4:25550844-25550866 GGAGCACAAATGTGAGAATCTGG + Intergenic
971527084 4:27634065-27634087 GGAGCAACTATTAGAAAATCAGG - Intergenic
971798356 4:31257461-31257483 GGAGCAACTATCTTAAAAGAAGG + Intergenic
972393274 4:38633351-38633373 TCAATAAATATGTGAAAAGCTGG - Intergenic
972814384 4:42628244-42628266 GTAACAACTATGTGAAAAGCTGG + Intronic
973572867 4:52258169-52258191 GGGGCAGATATTTGAAAAACTGG - Intergenic
974087326 4:57275353-57275375 GTAACAAATATGTGTAAAGCAGG - Intergenic
974302744 4:60089924-60089946 GGAGAAAATTTGTGAAAAAAAGG + Intergenic
974461091 4:62188789-62188811 GGAGCAATAATGTGATAAACCGG + Intergenic
976112973 4:81696728-81696750 GGAGCAAGAATGTGAATAACAGG + Intronic
976712769 4:88090406-88090428 GGGACAGGTATGTGAAAAGCAGG + Exonic
977876239 4:102154033-102154055 GGAGAAAAAATGTTAAAATCAGG + Intergenic
978135235 4:105249820-105249842 GGAGAAAATATCTGCAAACCAGG - Intronic
981135600 4:141207444-141207466 GGAGAAGAAATGTGGAAAGCAGG + Intronic
982069103 4:151679625-151679647 GAAGCCAATATGTGCAATGCAGG - Intronic
983823897 4:172232850-172232872 GGAGCAAATAATTCAAAAGATGG - Intronic
984242788 4:177237406-177237428 GAAGCCACCATGTGAAAAGCAGG + Intergenic
986917852 5:12645585-12645607 GGAGCAAATCTGTCATAATCAGG + Intergenic
986927655 5:12777483-12777505 GTAGGAAGTAAGTGAAAAGCAGG + Intergenic
988338286 5:29935275-29935297 AGTTTAAATATGTGAAAAGCAGG + Intergenic
990072074 5:51795044-51795066 GAATCAAATAAGTTAAAAGCAGG - Intergenic
991134850 5:63169447-63169469 GAAGCAAATGTGAAAAAAGCAGG - Intergenic
991170446 5:63618688-63618710 GGAGAAGCTATGTGAAAATCTGG - Intergenic
991442874 5:66669558-66669580 GGAGCAAATACCAGGAAAGCAGG + Intronic
992378377 5:76212267-76212289 GGAGCAATGATGGGTAAAGCTGG - Intronic
992480094 5:77142657-77142679 GGAGGGAATCTGTGGAAAGCAGG + Intergenic
995562191 5:113394581-113394603 GGGACAAACATGTGCAAAGCAGG - Intronic
995694072 5:114860072-114860094 GTAGCAAACATGTCAAAAGTAGG + Intergenic
996532268 5:124538626-124538648 TGAGCAAATATTTGAAAGGAGGG - Intergenic
997730530 5:136169557-136169579 TGAGCAATTATGAGTAAAGCTGG + Intronic
998147565 5:139738930-139738952 GGAGCACAGATGTGCACAGCAGG - Intergenic
999359947 5:150975580-150975602 GGAGAACATGTTTGAAAAGCAGG - Intergenic
999713064 5:154335541-154335563 GGAGAAAATGTGGGAAATGCAGG + Intronic
1000809007 5:165837577-165837599 GGAGCAAGTATGTGAGAAGAGGG + Intergenic
1000895621 5:166851959-166851981 AGAGCAAATTTTTGAAAATCAGG + Intergenic
1001015209 5:168134731-168134753 GAAGCAAATTTGTGAAAGGGAGG - Intronic
1001173385 5:169442895-169442917 TGAACACATATGTGAAAAGGTGG + Intergenic
1001297466 5:170508361-170508383 GGAGCAAATATGGGACTATCGGG - Intronic
1002757883 6:179026-179048 GGGCCAAATAAGGGAAAAGCTGG - Intergenic
1002901474 6:1413193-1413215 TGAGCCAATATTTAAAAAGCAGG - Intergenic
1003062550 6:2874847-2874869 GGTGCATATTTGTGAAAGGCTGG + Intergenic
1008325596 6:50177244-50177266 GGAGAAAATATTTGCAAAGTAGG - Intergenic
1008493243 6:52107342-52107364 AGAGCAAATATGGGACAAGGGGG - Intergenic
1010864488 6:80957655-80957677 GGAGAAAATATTTGCAAAGTTGG + Intergenic
1012685125 6:102237077-102237099 ACAGCAAATATGTGAAAAATTGG - Intergenic
1012801534 6:103835301-103835323 GGAGAAAATATTTGCAAACCAGG - Intergenic
1014286492 6:119504545-119504567 TGAGCAAGAATGTGGAAAGCTGG + Intergenic
1016361578 6:143273245-143273267 TGAGAAAATATCTGAAAAGCAGG + Intronic
1017054903 6:150427939-150427961 GGAGGACAGAGGTGAAAAGCAGG + Intergenic
1017762179 6:157578109-157578131 GGAGAAAATATGTGCAAACTAGG - Intronic
1017964796 6:159254807-159254829 TGAGCAAATGTGTGGAAAGTGGG - Intronic
1018133124 6:160751235-160751257 TGAACAAAGATGTGGAAAGCTGG + Intronic
1018700026 6:166419106-166419128 TGATGAAATAAGTGAAAAGCAGG + Intronic
1018774575 6:167000902-167000924 AGAGCACATATGTGCAAAGTGGG - Intronic
1019383798 7:741980-742002 GGAGCAAATGTGGGAAGGGCGGG - Intronic
1022768184 7:33439211-33439233 AGAGCAAATATAGGAATAGCAGG - Intronic
1023177841 7:37450603-37450625 GGAGGAAAGATGTGAAGACCCGG - Intergenic
1023187595 7:37548334-37548356 AAAGCAAACATGTGAAAAGAGGG + Intergenic
1023873410 7:44274662-44274684 GGAGGTACTATGTGCAAAGCAGG + Intronic
1024871990 7:53974431-53974453 GTAGGAAATATTTTAAAAGCTGG - Intergenic
1027502966 7:78978501-78978523 TGATCAAATAGGTGAAACGCAGG + Intronic
1028186463 7:87791547-87791569 GAAACAAAAATGTAAAAAGCAGG + Intronic
1028414800 7:90568100-90568122 GGAGCATATATGTGAACAGAGGG + Intronic
1028866483 7:95719716-95719738 GATGCAAAAATGTGAAAAGAGGG + Intergenic
1032192926 7:129774686-129774708 AGTGCCAATATGGGAAAAGCAGG - Intergenic
1032958534 7:137002065-137002087 AGAAAAAATATGAGAAAAGCCGG + Intronic
1033191034 7:139279831-139279853 GGATGAAATCTGTGTAAAGCTGG + Intronic
1033295778 7:140133398-140133420 GAAGAAAAAAGGTGAAAAGCTGG + Intronic
1033315135 7:140290989-140291011 TGAACAAATATTTTAAAAGCTGG - Intergenic
1034846288 7:154449145-154449167 GGAGAAAATATTTGCAAATCAGG + Intronic
1035796173 8:2359170-2359192 GGAGCATAAAGGAGAAAAGCAGG + Intergenic
1036912726 8:12771003-12771025 GAAGCAAAAATATGAAAGGCAGG + Intergenic
1037713795 8:21378912-21378934 GGAGAAAATATTTGAAAACTAGG - Intergenic
1037782832 8:21882434-21882456 GGAGGAAATGTGTCAAAAGGAGG - Intergenic
1038077965 8:24099203-24099225 GGGGCAAGTTTGTGAAAAGCTGG - Intergenic
1038457193 8:27683707-27683729 GGGGCAAATATGAGTAAAGTTGG - Intergenic
1038481163 8:27902601-27902623 GGAGGAACTATGTGGAAAGATGG - Intronic
1039751780 8:40485514-40485536 GGAGCAAATATGTGGTAAGTAGG - Intergenic
1040446139 8:47495616-47495638 GGAGCAAATATTTGAAACCTCGG - Intronic
1040757073 8:50789605-50789627 GGAGAAATTATGGGAAAAGCAGG - Intronic
1042296572 8:67224606-67224628 GAAACAAATATATGAAAAGACGG + Intronic
1044624646 8:94225351-94225373 CAAGCAAATAAATGAAAAGCAGG + Intergenic
1046366022 8:113234192-113234214 GGAGCCAAGATGTGAAAATGAGG - Intronic
1048405916 8:134120694-134120716 TAAGCACATATTTGAAAAGCAGG + Intergenic
1048461830 8:134627471-134627493 GAAGCCGAAATGTGAAAAGCAGG + Intronic
1050557885 9:6805850-6805872 GGAGCTTATAAATGAAAAGCAGG + Intronic
1051558046 9:18406940-18406962 TGAGAATAAATGTGAAAAGCAGG + Intergenic
1051859074 9:21603887-21603909 GCAGCAAATTCCTGAAAAGCAGG - Intergenic
1051932203 9:22399735-22399757 GGAGCAAGGATGGGAAATGCAGG - Intergenic
1052085301 9:24257910-24257932 TGACCAAATATGTGAACAGCTGG + Intergenic
1052406619 9:28069409-28069431 GGAGCTATTATGGGAAGAGCAGG + Intronic
1055170978 9:73257734-73257756 CAAACAAATATGTGAAAAGATGG + Intergenic
1056074359 9:83023460-83023482 GGAGTAAATAAGTCAAAAGCAGG - Intronic
1056207378 9:84333542-84333564 TGAGCAAATATTTAAAAAGTTGG + Intronic
1056248303 9:84720907-84720929 AGAGCAAATAAATGAAAAGTTGG + Intronic
1058236993 9:102502574-102502596 GGAAGAACTATGTTAAAAGCAGG + Intergenic
1061656945 9:132099459-132099481 GAAGCACATATGTTTAAAGCAGG - Intergenic
1186268807 X:7862672-7862694 GGAGAAAATCTGTCAAAATCTGG + Intergenic
1186269261 X:7867075-7867097 TGTGCAAATTTGAGAAAAGCTGG - Intergenic
1186403256 X:9278923-9278945 GGAGGAAGAATGTGAAAAGATGG + Intergenic
1186835146 X:13430233-13430255 GTAGCAAATATCAGAAAAGGAGG + Intergenic
1188055186 X:25532332-25532354 GCAAAAAACATGTGAAAAGCTGG - Intergenic
1189251563 X:39604261-39604283 GGAGCCAATGTTTGAAAACCAGG + Intergenic
1189321326 X:40089398-40089420 GGAGACAGTATGTGAAAATCAGG - Intronic
1189870773 X:45381012-45381034 GGAGCCAACCTGTAAAAAGCGGG - Intergenic
1190331628 X:49239369-49239391 TGAGTTAATGTGTGAAAAGCTGG + Intronic
1190805650 X:53833760-53833782 GTAGCAAAGATGTGAAGAACAGG - Intergenic
1191996626 X:67102672-67102694 GGAGCAAATATTCTGAAAGCAGG - Intergenic
1192193334 X:69011058-69011080 TGAGCAAATAAATGAAAAACTGG - Intergenic
1193557871 X:82978690-82978712 GGAGAAAATATTTGCAAACCAGG + Intergenic
1195490106 X:105458232-105458254 GGAGAAAATATTTGCAAACCTGG - Intronic
1195808269 X:108800160-108800182 CTAACAAATATGTGAAAAGATGG - Intergenic
1196792533 X:119477260-119477282 AGAGCAAAATTGTGTAAAGCAGG - Intergenic
1197096273 X:122599682-122599704 GAAGCATATATGTGATAGGCTGG + Intergenic
1197293999 X:124694844-124694866 GGAGAAATTATGTGAAGGGCAGG - Intronic
1197333004 X:125178186-125178208 GGAGCAAAAATATGATAAGATGG - Intergenic