ID: 1068306326

View in Genome Browser
Species Human (GRCh38)
Location 10:55213026-55213048
Sequence GTGTTTGAACAGAAGGAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 230}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068306326_1068306329 14 Left 1068306326 10:55213026-55213048 CCTAATTCCTTCTGTTCAAACAC 0: 1
1: 0
2: 1
3: 29
4: 230
Right 1068306329 10:55213063-55213085 ACATGATTAAAATAGCATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068306326 Original CRISPR GTGTTTGAACAGAAGGAATT AGG (reversed) Intronic
902072807 1:13755096-13755118 GTTTTTCAACAGTAGGAGTTCGG + Intronic
902435916 1:16397979-16398001 GTGTCTGAACAGAAGGGCATGGG + Exonic
903021617 1:20399243-20399265 GTGGTGGAAAAGAAGGAATTTGG + Intergenic
903298593 1:22362057-22362079 GTATTTGCAGAGAAGGAAGTAGG + Intergenic
904121787 1:28203241-28203263 GTGGTTGGACAGAAGGATTGTGG - Intronic
909322489 1:74307300-74307322 GTCTTTTAAGAGAAGCAATTAGG - Intronic
913126670 1:115797099-115797121 TTGTTTGAACAGATGGGATTGGG - Intergenic
916371860 1:164106713-164106735 GTGTCAGAACACAAGGAGTTTGG + Intergenic
917994125 1:180417281-180417303 GTGTTTGAGCAGAGGGAATGTGG - Intronic
918955597 1:191203023-191203045 GTGTTTGAAAAGCAAGAAATGGG + Intergenic
919993408 1:202725628-202725650 ATGTTTCATCAGAAGGGATTGGG + Exonic
920411742 1:205766972-205766994 TTCTTTGAACAGAAGAAATTTGG - Intergenic
920634279 1:207684032-207684054 CAGATTGCACAGAAGGAATTCGG - Intronic
920719910 1:208377488-208377510 GTTTTTGTACAGAAAGAACTGGG + Intergenic
921991798 1:221374779-221374801 CTGTTGGCACAGAAGGAAGTGGG - Intergenic
922083164 1:222317994-222318016 GTGTTTGACAAGTTGGAATTTGG - Intergenic
922407142 1:225326445-225326467 GAGTTTGAAGAGAAGGTATGGGG + Intronic
922942044 1:229475722-229475744 GTGTTTTAACAGAAGCACCTGGG - Exonic
923804137 1:237239658-237239680 GTGTTAGAAAAGAAATAATTTGG + Intronic
1063111129 10:3038344-3038366 CTATTTAAACAGAAGGTATTTGG - Intergenic
1063191662 10:3700591-3700613 ATGTCTGAACAGAAAGAATTTGG + Intergenic
1064435772 10:15310181-15310203 GTGTTTGGTGAGCAGGAATTTGG + Intronic
1064740970 10:18434307-18434329 GTGATTTAACATAGGGAATTAGG + Intronic
1068306326 10:55213026-55213048 GTGTTTGAACAGAAGGAATTAGG - Intronic
1071205808 10:83275684-83275706 GTGTTTGAACACCAGGAAGATGG - Intergenic
1071975260 10:90948918-90948940 GTTTTGGAAGAGAAGGAATCAGG + Intergenic
1072265205 10:93720553-93720575 GTGTTTAAACACAAGGGATGTGG + Intergenic
1073275964 10:102311692-102311714 GAGTGGGAACAGAAGAAATTAGG - Intronic
1075309193 10:121397684-121397706 GTCTTTAGGCAGAAGGAATTTGG + Intergenic
1075329551 10:121563501-121563523 GTGTTTGTACATAGGGTATTGGG - Intronic
1078641210 11:13098421-13098443 GTGTTTGAATCCAAGGATTTGGG + Intergenic
1078727907 11:13948399-13948421 TAGTTAGAAGAGAAGGAATTTGG + Intergenic
1080186986 11:29501844-29501866 GTGATTGAGAATAAGGAATTAGG - Intergenic
1082635610 11:55589703-55589725 GAGTTTGAAGAAAAGGAATTTGG - Intergenic
1083858919 11:65409067-65409089 GTGTTTGAACACAATGAGATTGG + Intronic
1085368028 11:75970794-75970816 ATGTTTTAACAGAAGAAATTGGG - Intronic
1090144658 11:124308574-124308596 TTGTTAGAACAGTAGGATTTTGG + Intergenic
1091389177 12:115340-115362 GGGTTGGAACAGAAGGAAGATGG + Intronic
1092095247 12:5836846-5836868 GTGTTATAAAAAAAGGAATTAGG - Intronic
1092129350 12:6097965-6097987 TTATTTGCACATAAGGAATTGGG - Intronic
1095886124 12:47190342-47190364 GGGTTAGAACAGATGGAACTTGG - Intronic
1098414633 12:70219107-70219129 GTTTTTGCAAAGAAGGACTTTGG + Intergenic
1100550462 12:95642162-95642184 GTGTTTGAACCCAAGCAATCTGG + Intergenic
1100740730 12:97589180-97589202 ATTTTTTAACAGAAGGATTTAGG + Intergenic
1100881583 12:99024424-99024446 TTGTTTGCACAGCAGGAAGTTGG - Intronic
1101927897 12:108988456-108988478 GTCTTTAAACAGATGGTATTAGG - Intronic
1102271658 12:111541706-111541728 GTGTATTAACAGAAGAACTTTGG - Intronic
1102783233 12:115583674-115583696 GTGTTTCAGCAGAAGGAAAGTGG - Intergenic
1103221114 12:119246405-119246427 GGGTTTGGACAGAAAGTATTTGG + Intergenic
1104498345 12:129261880-129261902 GTATTTTAACATAATGAATTTGG + Intronic
1106513263 13:30429860-30429882 GTGTCTGAACAGAAGGGGGTGGG + Intergenic
1108289955 13:48949139-48949161 GTGTATGAACTGAAGGAAAGAGG + Intergenic
1111878621 13:93927277-93927299 ATCTTTGCACAGAAGGTATTTGG - Intronic
1115848948 14:37572197-37572219 GTGTTGGAAGAGAAGAAATTTGG - Intergenic
1116065414 14:39975738-39975760 CTTTTTGAAAATAAGGAATTGGG - Intergenic
1116206611 14:41875312-41875334 GTGCTGGAACAGCAGGAGTTTGG - Intronic
1117222312 14:53618357-53618379 GTGATTTAATAGAGGGAATTAGG + Intergenic
1117743446 14:58843197-58843219 GTCTGTGGACAGAAGGAATTGGG - Intergenic
1118365413 14:65091185-65091207 GTATTTGAACTAAAGGAAATAGG - Intronic
1118777608 14:68982990-68983012 GAGTTTGAACACATTGAATTTGG + Intergenic
1119228498 14:72961979-72962001 CTGTTAGAACAGAGGGAAGTGGG - Intergenic
1120310439 14:82820161-82820183 GTATTTGAACCAAAGCAATTTGG - Intergenic
1121283626 14:92717505-92717527 GTGTTTGAAGAGAGAGATTTCGG - Intronic
1123695238 15:22874235-22874257 GTTTAAGAACAGAAGAAATTAGG - Intronic
1125379554 15:39073020-39073042 GTCTTTGATCTGATGGAATTTGG + Intergenic
1127866845 15:63040491-63040513 GTGGTTGGACAGTAGGATTTTGG - Intergenic
1128757843 15:70195557-70195579 GTGCATGAAGAGAAGGAACTAGG - Intergenic
1130423053 15:83767469-83767491 ATGTTTGAACAGGGGGAATTGGG + Intronic
1132127156 15:99237877-99237899 GAGTTTGAAGAGGAGGAATGGGG - Intronic
1133540555 16:6748709-6748731 ATGTATGAACAGAAGTTATTTGG + Intronic
1134508338 16:14825331-14825353 GTGTCTGAACAGAAGGGCATAGG + Intronic
1134696034 16:16224096-16224118 GTGTCTGAACAGAAGGGCATAGG + Intergenic
1134975793 16:18570592-18570614 GTGTCTGAACAGAAGGGCATAGG - Intergenic
1137390944 16:48081146-48081168 ATGTTTCAACAGGAGGATTTTGG + Intergenic
1139777626 16:69326490-69326512 GTGTTTAAGCAGTAGGAATGAGG - Exonic
1141215927 16:82023866-82023888 GTGTTTGATAAGAAGTAAGTAGG + Intergenic
1143564196 17:7711785-7711807 GTGGCTGATCAGAAGGAAGTAGG + Intergenic
1143593654 17:7901116-7901138 GTCTGAGAACAGGAGGAATTGGG + Intronic
1144995316 17:19264128-19264150 TTGTTTGAACAAAAAGCATTTGG + Intronic
1147205587 17:38835186-38835208 CTGTTAGAACAGAGGGAAGTGGG + Exonic
1147310781 17:39595148-39595170 GTGAATGAAGAGAAGGAATTGGG - Intergenic
1147664885 17:42140342-42140364 GTGTCTGAACAGGAGGCATTTGG - Intronic
1147754622 17:42760579-42760601 GTGTCTGAAGGGAAGGTATTTGG + Intronic
1148339405 17:46864343-46864365 GTATGTGAAGAGAAGGAGTTGGG - Intronic
1148567908 17:48644616-48644638 GGGCTTGAACGGAAGGAATGAGG - Intergenic
1149081792 17:52666607-52666629 GTGTTTTAGGAGAAAGAATTGGG + Intergenic
1149852387 17:60046100-60046122 CTGTTAGAACAGTAGAAATTAGG + Exonic
1153064108 18:1025487-1025509 GTGTTTGAAAAGAATTAAATTGG + Intergenic
1153136704 18:1925743-1925765 ATGTGAGAACAGAAGGAGTTTGG - Intergenic
1153364326 18:4237095-4237117 GTGTTAGGACAGAGGGAAGTCGG + Intronic
1154265929 18:12878881-12878903 GTGATGGCTCAGAAGGAATTTGG - Intronic
1156824112 18:41409229-41409251 AAGTTTGAACAGAAGGATTAGGG + Intergenic
1156859573 18:41820194-41820216 GTATTAGAACTGAAGGAAATGGG - Intergenic
1158003642 18:52647355-52647377 GTTTTTGAATAGAAGTAATCAGG - Intronic
1158325010 18:56304129-56304151 ATGTTTGAAGAGAATGATTTGGG + Intergenic
1159953037 18:74498825-74498847 GTGTTTGAAGAGGAGGAAGAGGG + Intronic
1160257034 18:77255971-77255993 GTGTTAGAAAAGAATGTATTTGG + Intronic
1161708300 19:5832735-5832757 GTGTTTGAACAAAGGGAGCTTGG + Intronic
1162463577 19:10827964-10827986 GTGTTTGAACAGAAGCCAGGTGG + Intronic
1164906620 19:31973489-31973511 GTGTTTGACCAGCAGGACTAGGG - Intergenic
1165622071 19:37256658-37256680 GAGTTTGCACAGATGTAATTTGG + Intergenic
1165633684 19:37322875-37322897 GAGTTTGCACAGATGTAATTTGG + Intronic
1166341012 19:42136903-42136925 ATGTTTGAATTGAAGGAAATGGG - Intronic
1167478428 19:49713971-49713993 GTGTTGGGGCAGCAGGAATTAGG - Intergenic
925182536 2:1826578-1826600 GTGTTTGACGGGAAGCAATTGGG - Intronic
926534461 2:14093441-14093463 GGGTTTGAACACAAGCAGTTGGG - Intergenic
929392968 2:41493405-41493427 TTGTTAGAAAAGAAGTAATTTGG - Intergenic
929554734 2:42919027-42919049 GTCTGTGAACAGAAGGGGTTGGG + Intergenic
929627100 2:43420656-43420678 GTTTTTGAGCAGAAGGAATGAGG - Intronic
930783217 2:55244612-55244634 GTCTTTAAAAAGAAGGAAATTGG + Intronic
931503584 2:62898865-62898887 GTGTTTTAAAAAAATGAATTTGG + Intronic
932222504 2:70010548-70010570 GTGTTTCATGATAAGGAATTTGG + Intergenic
933287161 2:80397154-80397176 GAGTTTGTACATAAGGAATTGGG - Intronic
933606179 2:84386553-84386575 GTGTTTGAGCAGGAGAGATTAGG + Intergenic
935626785 2:105178113-105178135 GTGTTTTAACATAAGAATTTGGG + Intergenic
935856878 2:107284194-107284216 ATGTCTGGACAGAAGGAAATTGG - Intergenic
936573032 2:113632264-113632286 GAGTTTGAACTGAAAGAAATGGG + Intronic
937757953 2:125563684-125563706 GTGTTATAAAAGAAGGTATTGGG - Intergenic
937862878 2:126724852-126724874 GTGTTTAACCAGAAGGAAGAGGG - Intergenic
938451868 2:131428210-131428232 GTGTTTTAGCAGAAGGAAGTTGG + Intergenic
938528265 2:132157610-132157632 CTGTTTGAACAGAAAGAGCTTGG + Intronic
939388831 2:141539153-141539175 GTGCATGAATACAAGGAATTTGG + Intronic
939770782 2:146314500-146314522 GTATTTTAACAAACGGAATTTGG + Intergenic
940299629 2:152163509-152163531 GTGTTTGAACAATATGAAATTGG + Intronic
940896024 2:159082206-159082228 GTGTCTGAACAGAAGGGCATGGG + Intronic
942001646 2:171653718-171653740 TTCTTAGAAAAGAAGGAATTTGG + Intergenic
942385595 2:175439473-175439495 GTGTTTGAGCAGAAAGAAATAGG - Intergenic
945111863 2:206367634-206367656 GGGTGTGTACAGATGGAATTTGG - Intergenic
945379697 2:209125538-209125560 GTGTTTGGAAAAGAGGAATTGGG - Intergenic
945921379 2:215758242-215758264 ATGTTTTAATAGAAGAAATTAGG + Intergenic
945964224 2:216168959-216168981 GTGTAGGAAAAGAAGGCATTAGG - Intronic
946067447 2:217000406-217000428 GTTATTGAAAAGAAGGAATGAGG - Intergenic
946662340 2:222015016-222015038 GTGTCTGAAGGGAAGGAAGTGGG - Intergenic
948315452 2:237025227-237025249 TGGCTTGAACAGAAGGAATGGGG + Intergenic
948572213 2:238924833-238924855 GTGTTTGAATAGCAGGCATTGGG - Intergenic
1169994045 20:11536602-11536624 GAATTTGAAGAGAAGGAATTAGG - Intergenic
1172232829 20:33348469-33348491 GTGAGTGAACAAAAGGAGTTTGG - Intergenic
1172468708 20:35175455-35175477 GTCTTTGAGAAGAAGGAGTTAGG - Intronic
1174872344 20:54194903-54194925 GTGTTTGAACAAGAGGCCTTGGG + Intergenic
1177752655 21:25304725-25304747 GTGTCAGAACAGAAGGAAGGCGG + Intergenic
1177804714 21:25863307-25863329 GGTTTAAAACAGAAGGAATTTGG - Intergenic
1180238245 21:46478887-46478909 GCATTTGATCAGAAGTAATTAGG - Intronic
1180790615 22:18573724-18573746 GTGTTAGAACAGGGGGACTTGGG - Intergenic
1181231122 22:21421590-21421612 GTGTTAGAACAGGGGGACTTGGG + Intronic
1181247526 22:21513278-21513300 GTGTTAGAACAGGGGGACTTGGG - Intergenic
1181566309 22:23740799-23740821 GAATTTGAACAGAGGGAATGAGG + Intergenic
1182869934 22:33637110-33637132 TTGATGGAACAGAGGGAATTGGG - Intronic
1183811159 22:40258812-40258834 CTGTTTCAACTGAAGAAATTTGG - Intronic
1183989900 22:41590683-41590705 ATGTGTGGACAGAAGGAATAAGG - Intergenic
1184310102 22:43635756-43635778 GTGTTTGGAGGGAAGGAATCAGG - Intronic
1185427156 22:50778610-50778632 GAGTTTGAACTGAAAGAAATGGG - Intronic
949643220 3:6063586-6063608 GTTTTTAAACAGAAGGAAATAGG + Intergenic
950300051 3:11868969-11868991 GTATATGAACAGAAAAAATTTGG - Intergenic
952189338 3:31005840-31005862 GGATTTAAACAGAAGAAATTAGG - Intergenic
952276702 3:31884036-31884058 TTGTTTGAACAGGATGCATTTGG - Intronic
953847301 3:46438046-46438068 GTCATTGAACAGAAGGTTTTTGG + Exonic
955094542 3:55784069-55784091 ATGTTTGAACAGACAGAAATGGG + Intronic
956595448 3:70961655-70961677 GTGTTTCAGCAGTAAGAATTAGG + Intronic
957466898 3:80605198-80605220 TTGTTTGAAATGAAGGAATATGG + Intergenic
959132265 3:102371321-102371343 TTGATTGAAAAGAAGAAATTAGG - Intronic
959195111 3:103170381-103170403 GTGGAGGAAGAGAAGGAATTAGG + Intergenic
959759911 3:109948839-109948861 TTTTTTCAATAGAAGGAATTAGG + Intergenic
960366232 3:116776241-116776263 GTTTTTGTACATAAGAAATTTGG + Intronic
960600776 3:119456205-119456227 GTGTTTTAAAAGAAAGAAGTTGG - Intronic
960646324 3:119888583-119888605 GTGTTTGAACAATATGAAATCGG + Intronic
964069104 3:152610572-152610594 TTGTTTGAAAAGAAGTGATTTGG - Intergenic
964284655 3:155104639-155104661 ATGTTTAAACAGAAGGAACATGG + Intronic
965939523 3:174161625-174161647 GTATAGGAAAAGAAGGAATTAGG + Intronic
966064449 3:175801134-175801156 GAGTTTGAAAAGATGGAATCAGG - Intronic
966476520 3:180354554-180354576 TTTTATGAAAAGAAGGAATTAGG - Intergenic
966832390 3:184020880-184020902 GTGTTTCATCTGAAGGAAGTAGG + Intergenic
967354313 3:188550950-188550972 TTGTTTCTACAGAAGGAGTTTGG + Intronic
967466996 3:189819087-189819109 GTGTTTTCATAGTAGGAATTTGG + Intronic
970077976 4:12246520-12246542 GTGTTACAGCAGAAGAAATTAGG - Intergenic
970338843 4:15083480-15083502 GGGTTTGGACAGAACGAGTTTGG - Intergenic
971376503 4:26059913-26059935 GTGTTTCAACACAGGGATTTTGG - Intergenic
975545480 4:75556277-75556299 GTGGTTAAAGAGAAGGAAGTTGG + Intronic
976303132 4:83534611-83534633 GTGTTTGAAAGCAAGGACTTTGG + Intergenic
976358707 4:84151749-84151771 GCGTCTGCACAGAGGGAATTAGG - Intergenic
977414932 4:96721231-96721253 GTGGTTGAACTGACGGAAGTAGG - Intergenic
982582657 4:157198600-157198622 GTGTTTTTACAGAAGTATTTTGG + Intergenic
984733561 4:183090022-183090044 GGATTTGAATGGAAGGAATTTGG + Intergenic
985148993 4:186927242-186927264 ATGTTTTAACAGAAGAATTTTGG - Intergenic
985770358 5:1806135-1806157 GTTTTTGAAAAGAAGGAATTAGG + Intronic
986850841 5:11811831-11811853 GTTGTTGAACAGCAGGAACTAGG + Intronic
987811582 5:22843228-22843250 GTGTTTTCACAGATAGAATTGGG - Intronic
988862915 5:35303508-35303530 GTGGGTGAGCAGTAGGAATTGGG + Intergenic
989117681 5:37971531-37971553 GGGTTGGAACAGGAGGAAGTGGG - Intergenic
989519785 5:42387935-42387957 GTGTTTGAAGTGAAGGTATGAGG - Intergenic
989544362 5:42655430-42655452 GTGTTTGAATAATAAGAATTTGG + Intronic
992857814 5:80881255-80881277 GTGTTTGAGCAGAGGGTATGTGG - Intergenic
993379913 5:87194927-87194949 GTTTGTGAACAGAAAGATTTGGG - Intergenic
994003620 5:94811421-94811443 CTGTTTGAACAGTTGGAGTTCGG - Intronic
995056471 5:107764916-107764938 GGGATTGAACAGAAGATATTTGG - Intergenic
995179987 5:109222109-109222131 GTGTTTTAAAAGAGGCAATTTGG + Intergenic
995403893 5:111772092-111772114 ATGTTAGTACTGAAGGAATTTGG - Intronic
995505414 5:112855275-112855297 GTGTTTGAAGAAAAGGAAGATGG - Intronic
995601597 5:113803711-113803733 GTGCTTGAAGAGAAGGGAATGGG - Intergenic
998031146 5:138869083-138869105 GTGATTGAACACAATGTATTTGG + Exonic
998204845 5:140151054-140151076 GTGTGAAGACAGAAGGAATTTGG - Intergenic
998380160 5:141718748-141718770 GGGTTTGAACAGAGGCAGTTTGG + Intergenic
999177136 5:149639568-149639590 GCATTAGAACAGAAGGAATTTGG - Intergenic
1001238440 5:170049502-170049524 GTGTTTGGACAGAGGAAATTAGG + Intronic
1001600555 5:172925604-172925626 GTGTTTGAATAGAAGGAAGGAGG - Intronic
1003455573 6:6278646-6278668 GTGCCTGAACAGAGGGAATTGGG + Intronic
1004060371 6:12190663-12190685 GAGTATGAAAGGAAGGAATTAGG - Intergenic
1005511588 6:26516762-26516784 GTGTCTGAAGAGGAGGAATAAGG - Intergenic
1005818054 6:29573707-29573729 ATGTTTGATCAGAAGGAACAGGG + Intronic
1007038379 6:38699388-38699410 GTGTTTGAACAATATGAAATCGG + Intronic
1007069213 6:39022737-39022759 GTGTCTGAACAGAAGGGCCTGGG + Intronic
1007085238 6:39139744-39139766 GTCTTTGAACAGAGGGAAATAGG + Intergenic
1008630052 6:53355908-53355930 GTATTTCAATAGAATGAATTAGG + Intergenic
1009425248 6:63506590-63506612 GTTTGTGAACAGAATGAATAAGG - Intergenic
1011052761 6:83171823-83171845 GTGTATGTACAGAATGAAATAGG + Intronic
1012209462 6:96501507-96501529 ATTTTTAAAAAGAAGGAATTTGG - Intergenic
1012557901 6:100538568-100538590 GTATCTGAGCAGCAGGAATTGGG - Intronic
1012987400 6:105889258-105889280 GTGGATGAACAGAAGGAAATGGG + Intergenic
1013490036 6:110637429-110637451 GTGTTTAAAGAAAAGGAAGTTGG + Intronic
1013717934 6:112985672-112985694 GTGTTTATACATAAGAAATTGGG - Intergenic
1015982867 6:138856677-138856699 GTGTTTTAACCAAATGAATTGGG - Intronic
1016899243 6:149084838-149084860 AAGTTTGAACAGAAGCAATGTGG + Intergenic
1017788601 6:157776042-157776064 GTGGATGAACAGAAGGAAAATGG + Intronic
1020857125 7:13443056-13443078 GTGTTAGAAGAGAAGGAGCTTGG - Intergenic
1021176845 7:17459335-17459357 GTGTTTGAACAATATGAAATCGG - Intergenic
1021181767 7:17514607-17514629 TTATTTGAAGAGAAGGAAGTAGG - Intergenic
1022682622 7:32564421-32564443 ATCCTTGTACAGAAGGAATTAGG + Intronic
1023935703 7:44738299-44738321 GTGTTTATACAGATGGAACTGGG - Intergenic
1028876082 7:95824834-95824856 CGGTTTACACAGAAGGAATTCGG + Intronic
1029063548 7:97824791-97824813 GTGTTGGAATAGCAGGAAATAGG + Intergenic
1030513988 7:110518917-110518939 GTGGTTGAAGAGAAGGAAAGAGG - Intergenic
1030655161 7:112159528-112159550 GTGTTTTGACAGGAGGAAGTAGG - Intronic
1031853909 7:126899460-126899482 GTGTTTGATGACAAGGATTTGGG - Intronic
1032653531 7:133904197-133904219 GTATTTGAAGAAAAGGACTTGGG + Intronic
1036468005 8:9020599-9020621 TAATTTGAACATAAGGAATTTGG - Intronic
1039236322 8:35506608-35506630 GTGTTTGAACTGAAGTATTTCGG + Intronic
1042495723 8:69452857-69452879 ATGTTTGCACAGAAAGGATTTGG + Intergenic
1042690004 8:71487081-71487103 GTTTTTGAACAGAAGAGATTGGG - Intronic
1043860354 8:85309337-85309359 GTCTTTGGACAGAAGGATTAAGG + Intergenic
1046045817 8:108963148-108963170 GTGTTTGAAAAGCAGGAAGAAGG - Intergenic
1046468897 8:114642270-114642292 ATGTTTGAAAAGAATGAATAAGG + Intergenic
1048729887 8:137426648-137426670 GTGTGTGAAAACAAGGAAATTGG - Intergenic
1050258567 9:3817668-3817690 GGGTTTGAAGAGAAGGGGTTTGG - Intergenic
1051847317 9:21465857-21465879 TTTTTTGTAGAGAAGGAATTTGG - Intergenic
1052000106 9:23268098-23268120 TTGATTGAACAGAAGTGATTTGG + Intergenic
1052459604 9:28745449-28745471 TGGTATGAACAGAAAGAATTTGG - Intergenic
1057828268 9:98387849-98387871 CTGCTTGCAAAGAAGGAATTTGG - Intronic
1059996830 9:119918838-119918860 GTTTTTGAACAGTAGAAATTTGG - Intergenic
1060071048 9:120547732-120547754 GTGTGTGAACAAAAGGACATAGG + Intronic
1186798051 X:13065664-13065686 GGATTTGAACCGAGGGAATTTGG + Intergenic
1187217751 X:17293489-17293511 GAGTTTGAACAGAATGGATGGGG + Intergenic
1187654357 X:21453359-21453381 GAGTTTAAACAGAAGGATGTGGG + Intronic
1188547718 X:31327711-31327733 GGGGTTGAACAAAAGGCATTAGG + Intronic
1189186189 X:39057455-39057477 GTGCTTGCAGAGAAAGAATTTGG + Intergenic
1189192888 X:39126118-39126140 TTTTTTTAACAGAAGGAAGTGGG - Intergenic
1193658812 X:84231685-84231707 GTGTTTATACAGAAATAATTGGG - Intergenic
1194232269 X:91339153-91339175 GTGTTAGAAAAGAAATAATTTGG + Intergenic
1194980557 X:100435854-100435876 GTCTTTCAACAGAAGCAATTTGG - Intergenic
1195462661 X:105145140-105145162 GTGTTAGAAAAGCAGAAATTAGG - Intronic
1195960398 X:110380098-110380120 GTGTTTCAACAGATGGGAATGGG + Intronic
1201695713 Y:16823127-16823149 GTGTTGGAATATAAGGAAATGGG - Intergenic
1201917011 Y:19192745-19192767 GGGTTTGAAAAGTGGGAATTTGG - Intergenic