ID: 1068310429

View in Genome Browser
Species Human (GRCh38)
Location 10:55267044-55267066
Sequence CCATCGCATGCACTGTGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068310423_1068310429 23 Left 1068310423 10:55266998-55267020 CCCTAGAGGTTTGAGCAGCGGGG 0: 44
1: 186
2: 236
3: 219
4: 157
Right 1068310429 10:55267044-55267066 CCATCGCATGCACTGTGAGGAGG No data
1068310421_1068310429 24 Left 1068310421 10:55266997-55267019 CCCCTAGAGGTTTGAGCAGCGGG 0: 51
1: 207
2: 230
3: 198
4: 180
Right 1068310429 10:55267044-55267066 CCATCGCATGCACTGTGAGGAGG No data
1068310425_1068310429 22 Left 1068310425 10:55266999-55267021 CCTAGAGGTTTGAGCAGCGGGGC 0: 41
1: 183
2: 223
3: 189
4: 213
Right 1068310429 10:55267044-55267066 CCATCGCATGCACTGTGAGGAGG No data
1068310426_1068310429 -2 Left 1068310426 10:55267023-55267045 CCACAGATGCAAGCTGCACTACC No data
Right 1068310429 10:55267044-55267066 CCATCGCATGCACTGTGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068310429 Original CRISPR CCATCGCATGCACTGTGAGG AGG Intronic
No off target data available for this crispr