ID: 1068314284

View in Genome Browser
Species Human (GRCh38)
Location 10:55320895-55320917
Sequence CCATTGGTATGGAACTAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 1, 2: 2, 3: 37, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068314284_1068314292 30 Left 1068314284 10:55320895-55320917 CCACACTAGTTCCATACCAATGG 0: 1
1: 1
2: 2
3: 37
4: 141
Right 1068314292 10:55320948-55320970 CAGAAACAGAAAGCAGAATATGG No data
1068314284_1068314289 -2 Left 1068314284 10:55320895-55320917 CCACACTAGTTCCATACCAATGG 0: 1
1: 1
2: 2
3: 37
4: 141
Right 1068314289 10:55320916-55320938 GGTTCCTATCCAGGCTGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068314284 Original CRISPR CCATTGGTATGGAACTAGTG TGG (reversed) Intronic
906051373 1:42877136-42877158 CCATTGCTGAGGAACTAGTGTGG + Intergenic
906993706 1:50766933-50766955 CTATTGCTGGGGAACTAGTGTGG - Intronic
909061211 1:70881438-70881460 CCTTTGCTGGGGAACTAGTGTGG + Intronic
909673336 1:78212598-78212620 CCATTGTTGGGGAACTAGTGTGG - Intergenic
911784798 1:101932772-101932794 CCATTGCTGGTGAACTAGTGTGG - Intronic
912594588 1:110861368-110861390 CCATTGCTGGGAAACTAGTGTGG - Intergenic
912634406 1:111278650-111278672 CCATTGGTAGGGAAGAAATGTGG - Intergenic
914944369 1:152051062-152051084 CTATTGGCATGGATTTAGTGTGG - Intergenic
917696657 1:177532669-177532691 TCATTGCTGGGGAACTAGTGTGG - Intergenic
918272924 1:182920536-182920558 CCATTGATGGGGAATTAGTGTGG - Intronic
919168301 1:193922448-193922470 CTATTGGTATGGAAAAACTGAGG - Intergenic
920973102 1:210759285-210759307 CCATTGCTTGGGAGCTAGTGGGG - Intronic
1067801939 10:49365386-49365408 CTGTGGGTGTGGAACTAGTGTGG - Exonic
1068055379 10:52006245-52006267 CCCTTGCTAGGGAACAAGTGTGG - Intronic
1068065621 10:52127088-52127110 CCACAGGTATGGATCTACTGTGG - Intronic
1068314284 10:55320895-55320917 CCATTGGTATGGAACTAGTGTGG - Intronic
1071039395 10:81287805-81287827 CCATTGCTGGGGAACTAGTGTGG - Intergenic
1072384859 10:94914296-94914318 CCATTGCTGGGGAACTAGAGTGG + Intergenic
1074597278 10:114879184-114879206 CCAGTGCTGTGGAAATAGTGAGG - Intronic
1078946343 11:16072049-16072071 CCATTGCTGGGGTACTAGTGTGG - Intronic
1079805982 11:24931764-24931786 CCATTGCTGCTGAACTAGTGTGG + Intronic
1080149681 11:29036286-29036308 CCTTTGGTATTGAACTCATGGGG - Intergenic
1080324219 11:31050943-31050965 CCATTGCTGGTGAACTAGTGTGG - Intronic
1080356169 11:31448558-31448580 CTATTGGTATGAATCTAGAGAGG - Intronic
1082903994 11:58286042-58286064 CCATTGCTAGTGAGCTAGTGTGG - Intergenic
1083371505 11:62185839-62185861 CCATTGCTGGGGAACTAGTGTGG + Intergenic
1085220195 11:74867200-74867222 CCATTGCTGGAGAACTAGTGTGG - Intronic
1086251785 11:84824642-84824664 CCATTTGTATGGAAAAACTGAGG + Intronic
1086315578 11:85588710-85588732 CAATTGCTATGAAGCTAGTGTGG + Intronic
1086814646 11:91353994-91354016 CCCTTAGTATGGAATTAGTGAGG - Intergenic
1087918066 11:103832551-103832573 CCATTGCTGGGGAACTATTGCGG - Intergenic
1088096022 11:106102406-106102428 GCATTGGTATGGAAGAAGTGGGG + Intergenic
1088507879 11:110543411-110543433 CTATTGCTGGGGAACTAGTGTGG - Intergenic
1089143188 11:116304275-116304297 CCATTAGCATGGAAGTAGTGTGG - Intergenic
1089706923 11:120284681-120284703 CCATTTGAATGGAAACAGTGTGG + Intronic
1090495485 11:127207088-127207110 CCATTGCTGGGGAACTAGTGTGG - Intergenic
1090640686 11:128726554-128726576 CCATTGGTATGGAGCTTAGGCGG - Intronic
1092680522 12:10974758-10974780 CCATTGCTGCTGAACTAGTGTGG - Intronic
1093101000 12:15029336-15029358 CCATTGGTGGGAAACTAGTGTGG + Intergenic
1093195294 12:16123324-16123346 CCAGTGGTTTTGAACCAGTGGGG + Intergenic
1093261109 12:16939502-16939524 CCATTAATAGAGAACTAGTGTGG + Intergenic
1095225922 12:39676062-39676084 CCATTGCTGGAGAACTAGTGTGG - Intronic
1097512714 12:60564343-60564365 CCAATGCTAGGGAACTAGTGTGG + Intergenic
1100249436 12:92802011-92802033 CCATTGCTATAAAAGTAGTGTGG - Intronic
1100926753 12:99557692-99557714 CCATTGCTAGAGAACTAGTGTGG + Intronic
1106060067 13:26281603-26281625 CCATTGCTGGGGAGCTAGTGTGG - Intronic
1107445557 13:40467457-40467479 CCATTGCTGTGGAAGTTGTGAGG - Intergenic
1108903098 13:55436662-55436684 CCATTACTTGGGAACTAGTGAGG - Intergenic
1110876250 13:80514035-80514057 TTAATGGCATGGAACTAGTGGGG - Intergenic
1113208303 13:107942622-107942644 CCATTGTTAGAGAACAAGTGTGG - Intergenic
1126227536 15:46289170-46289192 CCATTGCTATGGAACTAGTGCGG + Intergenic
1131353595 15:91723958-91723980 CCAGTGGTAGGGAGGTAGTGAGG - Intergenic
1134797825 16:17057752-17057774 CCATTGGCATGGAAATGGAGAGG + Intergenic
1135800257 16:25488103-25488125 CCATTGCTGGGGAACTACTGTGG + Intergenic
1137627816 16:49920748-49920770 CCATGGATATGTAACCAGTGGGG + Intergenic
1140148133 16:72332525-72332547 CCATTACTGGGGAACTAGTGTGG + Intergenic
1142150474 16:88510390-88510412 CCATGGGGATGGAAGCAGTGGGG - Intronic
1142953926 17:3507162-3507184 CTATTGATATGGAAATGGTGGGG + Intronic
1149495494 17:57114758-57114780 CCATTGTTATGGAGCTGGGGTGG + Intronic
1150533647 17:66013242-66013264 CCATTGCTGGAGAACTAGTGTGG + Intronic
1156144203 18:34156661-34156683 ACAGTGGTATGGAAGTAGAGAGG - Intronic
1157205256 18:45692405-45692427 CCATTGCTGGGGAACTTGTGTGG - Intergenic
1159905925 18:74092403-74092425 CCATTGTGGGGGAACTAGTGTGG + Intronic
1163949995 19:20575522-20575544 CCATTGCTAGGGAGCTAGTATGG + Intronic
1163968010 19:20765864-20765886 CCATTGCTAGGGAGCTAGTGTGG - Intronic
1164634355 19:29781678-29781700 TCATTGGCATGGCTCTAGTGGGG + Intergenic
927565208 2:24105576-24105598 CCCTTGCTGGGGAACTAGTGTGG - Intronic
928609207 2:32975930-32975952 CCATTGCTGGGGAACTTGTGTGG + Intronic
929549156 2:42878486-42878508 CCATTGGTTTGGCCCCAGTGAGG - Intergenic
930486398 2:52017146-52017168 CCATTGCTAGTGAACTAGTGTGG + Intergenic
933940108 2:87238206-87238228 CCAATGGTATGGAAACACTGTGG - Intergenic
936353032 2:111727572-111727594 CCAATGGTATGGAAACACTGTGG + Intergenic
936795834 2:116203571-116203593 CCACTGCTAGGGAAGTAGTGTGG + Intergenic
937410548 2:121670938-121670960 CCATTGCTAGGAAGCTAGTGTGG - Intergenic
938990379 2:136622475-136622497 CCATTGCTGGGGAACTAGTGTGG + Intergenic
941560797 2:167041288-167041310 CCATTGCTGGGGAGCTAGTGTGG - Intronic
943073655 2:183170960-183170982 CCATTGCTGGGGAACTAGTGTGG + Intergenic
944633291 2:201649635-201649657 CCACCTGTATGGCACTAGTGTGG - Exonic
945573822 2:211504579-211504601 CCATTGCTAGAGAGCTAGTGTGG - Intronic
1170865432 20:20151018-20151040 CCATTGCTGGGGAGCTAGTGTGG - Intronic
1177657374 21:24035830-24035852 CCATTGCTGGGGAGCTAGTGTGG - Intergenic
1180896431 22:19337003-19337025 CCATTGCTGAGGAGCTAGTGTGG - Intronic
1181171009 22:21010077-21010099 CCATTGCCATGGATCAAGTGGGG + Intronic
949601329 3:5601093-5601115 CCATTGTTCAGGAGCTAGTGTGG - Intergenic
950708763 3:14800568-14800590 CCATGGCTATGCAACCAGTGTGG + Intergenic
951168026 3:19506184-19506206 CCCTTGCTGGGGAACTAGTGTGG + Intronic
951723508 3:25727547-25727569 ACATTGCTATGGAAACAGTGAGG - Intronic
955865068 3:63373190-63373212 CCCTTGCTGGGGAACTAGTGTGG - Intronic
957307231 3:78473229-78473251 CCATTATTTGGGAACTAGTGTGG - Intergenic
957633125 3:82744063-82744085 CCATTACTGTGAAACTAGTGTGG - Intergenic
958160568 3:89812611-89812633 CCATTGCTGGGGAACTAGTGTGG - Intergenic
958594454 3:96202814-96202836 CCATTACTAGGGAGCTAGTGTGG - Intergenic
958638026 3:96770508-96770530 CCCATGGGATGCAACTAGTGTGG - Intergenic
958790187 3:98643477-98643499 CCATTGATGGGGAGCTAGTGTGG + Intergenic
962655547 3:137541238-137541260 CCATTGCTGGGGAACTAGTGTGG + Intergenic
964171053 3:153769502-153769524 CCATTGCTAGAGAGCTAGTGTGG - Intergenic
964486243 3:157187522-157187544 CCACTGCTGGGGAACTAGTGTGG - Intergenic
965635437 3:170775784-170775806 CAATGGGTATGGATGTAGTGGGG - Intronic
966964849 3:184980847-184980869 CCATTGCTGGGGAACTAGTGGGG + Intronic
967659660 3:192091166-192091188 CCATTGCTGGGGAACTAGTGAGG - Intergenic
969837213 4:9851539-9851561 CCATTGCTGGGGAATTAGTGTGG - Intronic
972097224 4:35363779-35363801 CCATTGATAATGAGCTAGTGTGG + Intergenic
972363576 4:38351554-38351576 CCATTGCTGGGGAGCTAGTGTGG - Intergenic
973831457 4:54764185-54764207 CCATTGTTGTTGAGCTAGTGTGG + Intergenic
975614042 4:76229371-76229393 CCATTGCTAGGGAGCTAGTGTGG + Intronic
977394478 4:96454125-96454147 CCATTGTTGAGGAACTAATGTGG + Intergenic
978607983 4:110503575-110503597 CCCTTGCTGTGGAACTAGTGTGG + Intronic
980456208 4:133046820-133046842 CCATTGCCAGGGACCTAGTGTGG - Intergenic
980816254 4:137950466-137950488 CCATTGCTAGGGAACCAGTGTGG + Intergenic
981063129 4:140448729-140448751 CCTTTGCTAGAGAACTAGTGTGG + Intronic
983628550 4:169827129-169827151 CCATTACTGTGGAACTAGTGAGG - Intergenic
986620498 5:9667891-9667913 CCATTGCTGGGGAACTAGTGCGG - Intronic
986846137 5:11755969-11755991 CCATTGCTGAAGAACTAGTGTGG + Intronic
990009425 5:50978132-50978154 CTATTGCTCTGAAACTAGTGGGG + Intergenic
992314179 5:75535972-75535994 CCATTGCCTGGGAACTAGTGTGG + Intronic
993488611 5:88517947-88517969 CTTTTGGTATAGAACTACTGAGG - Intergenic
997188236 5:131902765-131902787 TCATTGCTGGGGAACTAGTGGGG - Intronic
998776447 5:145609290-145609312 CCATTGCTGGGGGACTAGTGTGG + Intronic
1001851329 5:174969481-174969503 CCATTGCTGGGCAACTAGTGTGG + Intergenic
1001886404 5:175294275-175294297 CCATTGCTGGGGAACTAGTGTGG - Intergenic
1005860970 6:29900149-29900171 ATATAGGTAAGGAACTAGTGGGG + Intergenic
1007266146 6:40597628-40597650 CTATTGGTATTGAGCTAGTTTGG + Intergenic
1007438709 6:41838733-41838755 CCATTGTTGGGGAGCTAGTGTGG - Intronic
1008259787 6:49350619-49350641 CCATTGCTAGGGAGTTAGTGTGG - Intergenic
1009497784 6:64373090-64373112 CCATTGCTAGGGAGCTATTGTGG + Intronic
1009621502 6:66084197-66084219 CCACTATTATGGAACTATTGTGG + Intergenic
1009998304 6:70921620-70921642 CCATTGCTAGGGAACCAGTGGGG + Intronic
1010328811 6:74597064-74597086 CCATTTGAATGTATCTAGTGTGG + Intergenic
1014022479 6:116606866-116606888 CCATTGCTTGGGAGCTAGTGGGG - Intergenic
1014235099 6:118945149-118945171 CCATTGCTGGGGAATTAGTGTGG - Intergenic
1015852697 6:137590046-137590068 CCATTGCTACAGACCTAGTGTGG - Intergenic
1016237738 6:141888199-141888221 CCATTTATGGGGAACTAGTGTGG - Intergenic
1016577180 6:145583184-145583206 CCATTGCTGTGGAACTAGTGTGG + Intronic
1018132549 6:160746662-160746684 CCCTTGTTAGAGAACTAGTGTGG + Intronic
1018147056 6:160901151-160901173 CCATTGCTGGGGAGCTAGTGTGG - Intergenic
1018781673 6:167073549-167073571 CCATTGCTGGGGAGCTAGTGTGG + Intergenic
1020332252 7:7031832-7031854 CCATTGCTAAGGAACTAGTGTGG + Intergenic
1020407790 7:7856196-7856218 AAATTGGTATTGAAGTAGTGGGG - Intronic
1024441282 7:49421384-49421406 CCATTGTTTTGGAACTTGAGTGG + Intergenic
1024917119 7:54514594-54514616 CCATTGCTGGTGAACTAGTGTGG + Intergenic
1024920384 7:54547120-54547142 CCATTTGTATGTATCTAATGAGG - Intronic
1031341332 7:120605849-120605871 CCATTTGTATTGATATAGTGTGG + Intronic
1031669415 7:124524699-124524721 CCATTGCTAGGAAACTAGTGTGG + Intergenic
1032541802 7:132709095-132709117 CCATGGGTATGTCACTTGTGTGG + Intronic
1038859764 8:31374832-31374854 CCATTGTTGGGGAACTAGTGGGG + Intergenic
1039667242 8:39547402-39547424 CCAGTGGTATGGAAGCAGTCTGG - Intergenic
1042084309 8:65090540-65090562 CCATTGCTGGGGAGCTAGTGTGG - Intergenic
1042212023 8:66390397-66390419 CCACTGGTATGGAGCAAGTATGG + Intergenic
1043131759 8:76471736-76471758 TCATTGCTAGGGAACTAGTGTGG + Intergenic
1043738475 8:83776212-83776234 CCATTTCTGGGGAACTAGTGTGG - Intergenic
1044489445 8:92794896-92794918 CCATTTACAAGGAACTAGTGTGG - Intergenic
1045586646 8:103545005-103545027 CCATTGCTGGGGAACCAGTGTGG - Intronic
1047164872 8:122426504-122426526 CCATTGCTGGGGACCTAGTGTGG - Intergenic
1051832579 9:21296627-21296649 CCATTGCTGTAGAACTAGTGTGG - Intergenic
1052694199 9:31854881-31854903 CCATTGCGGGGGAACTAGTGTGG - Intergenic
1058198569 9:102009428-102009450 CCATTGCTAAGGAACTGGTGTGG - Intergenic
1187121575 X:16412659-16412681 CCTTTGGTGTTGAACTAATGGGG - Intergenic
1187607693 X:20904814-20904836 CCATTGCTGGGGAACTGGTGTGG + Intergenic
1187961048 X:24566681-24566703 ACATTGGTAAGGAACTATTAAGG + Intronic
1189653239 X:43212178-43212200 CCATTGCTAGGGAACAAGTGTGG - Intergenic
1189678431 X:43487786-43487808 CCATTGTTGGGGAACCAGTGTGG - Intergenic
1189897900 X:45674312-45674334 CAATTGCTGGGGAACTAGTGTGG - Intergenic
1191004560 X:55697271-55697293 CCTTTGGTGTGGAACTCATGAGG + Intergenic
1191033058 X:55996391-55996413 CCATTGCTTAGGAGCTAGTGTGG + Intergenic
1191821608 X:65315782-65315804 CCATTGCTGTAGAACTGGTGTGG - Intergenic
1192691618 X:73371498-73371520 CCATTGCTGGGGAACTAGTGTGG + Intergenic
1192866041 X:75132947-75132969 CCATTGCTAGGGAGCTAGTGTGG - Intronic
1193032049 X:76908700-76908722 TCATTGCTTTGGAACTAGTGTGG - Intergenic
1193036458 X:76957000-76957022 ACATTGCTGGGGAACTAGTGTGG + Intergenic
1193276017 X:79589337-79589359 CTATTGTTGTGGAAATAGTGTGG + Intergenic
1193499575 X:82258798-82258820 CCATTTCTGGGGAACTAGTGTGG + Intergenic
1193578217 X:83230496-83230518 CCATTGCTGAGGAACTGGTGTGG + Intergenic
1193614259 X:83668419-83668441 CCATTGCTGAGGAGCTAGTGTGG - Intergenic
1193769512 X:85572244-85572266 CCATTGCTAGGGAGCTAATGTGG - Intergenic
1193979797 X:88168416-88168438 CCATTGCTAGGAATCTAGTGTGG + Intergenic
1194019290 X:88666987-88667009 CTATTGGTGCAGAACTAGTGTGG - Intergenic
1195155295 X:102116537-102116559 CCATTGCTAGGGTACTAGTGGGG - Intergenic
1196737608 X:118993135-118993157 CCATTGCTGGTGAACTAGTGTGG - Intronic
1198751846 X:139944080-139944102 CCACTGGTATGGATTTAGGGAGG + Intronic
1198841933 X:140866120-140866142 CCATTGCAGGGGAACTAGTGTGG - Intergenic
1198961077 X:142184021-142184043 CCATTGCTGGAGAACTAGTGTGG + Intergenic
1199400290 X:147390570-147390592 ACATTGGTGGGGAACTAGTGTGG - Intergenic