ID: 1068316412

View in Genome Browser
Species Human (GRCh38)
Location 10:55349133-55349155
Sequence CCATGACTACAGAAGAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068316412 Original CRISPR CCATGACTACAGAAGAAACA TGG (reversed) Intronic
905635711 1:39550493-39550515 TCATGACTAAATATGAAACAAGG - Intergenic
905996288 1:42383514-42383536 GTCTGACTACAGAAGAAACTAGG - Intronic
906258007 1:44365453-44365475 CCAGGACGAGACAAGAAACAAGG + Intergenic
907146877 1:52242691-52242713 CCATCAGTACATAAGAAACTAGG - Intronic
908118472 1:60963886-60963908 CCATCACTACAGCTGAAATATGG + Intronic
909003182 1:70243514-70243536 CCTTGACTGCTGAAGTAACAAGG + Intronic
913573106 1:120141390-120141412 CCTTGACTACTGAAGAAAGTAGG + Intergenic
914294362 1:146306187-146306209 CCTTGACTACTGAAGAAAGTAGG + Intergenic
914555406 1:148756970-148756992 CCTTGACTACTGAAGAAAGTAGG + Intergenic
916497459 1:165357975-165357997 ATATGACTCCAGAAGAAAGAGGG + Intergenic
916541708 1:165762410-165762432 CCATGACTGCATAGAAAACAGGG + Intronic
918535586 1:185570799-185570821 GCATGAGCACAGAAGAATCATGG + Intergenic
919217155 1:194572164-194572186 ACATGGCTGCTGAAGAAACAGGG - Intergenic
921111749 1:212044997-212045019 CCATGAATACAGAGGTCACATGG + Intronic
922240674 1:223753495-223753517 CCATGAAGGCAGAAGAATCAAGG - Intronic
923606748 1:235451029-235451051 CCGTGATCAAAGAAGAAACAGGG + Intronic
923977873 1:239285063-239285085 TCAAGACTACAAAACAAACAAGG - Intergenic
924208411 1:241739187-241739209 ACATGCCTACTAAAGAAACAAGG + Intronic
1064967488 10:21029865-21029887 CAATGACTACAGAGGAGGCAGGG + Intronic
1067525141 10:47033972-47033994 CCATGACTAGAGCAGCAAAAGGG + Intergenic
1068316412 10:55349133-55349155 CCATGACTACAGAAGAAACATGG - Intronic
1068442791 10:57080355-57080377 AAATGACCACAGAAGAAAGAAGG - Intergenic
1069162987 10:65113025-65113047 GCATGACTACAGAAGAGATGGGG + Intergenic
1069892144 10:71658661-71658683 CAATGGGTACAGAAGAGACAGGG - Intronic
1073498123 10:103912499-103912521 CCTTGACTACACAGGACACAGGG - Intronic
1074920110 10:117999576-117999598 CCAAGACTACAAATGAAACCTGG + Intergenic
1077704690 11:4473298-4473320 CCATTTCCAGAGAAGAAACAGGG + Intergenic
1077829200 11:5846124-5846146 CTATGAATACAGAAGGAAAAGGG - Intronic
1078531314 11:12138921-12138943 CCATGTCTATAAAATAAACAAGG - Intronic
1079333087 11:19549513-19549535 CCCTGACTACAGAGGAAGGAGGG + Intronic
1080053911 11:27885393-27885415 TCAAGACTACAATAGAAACAGGG + Intergenic
1081918204 11:46748035-46748057 CCCTGACTCTAAAAGAAACAAGG + Intronic
1085142307 11:74157033-74157055 CGATGACTAGGGAAAAAACAAGG - Intronic
1086216221 11:84384810-84384832 CAATGACTCCAGAAGCCACAAGG + Intronic
1087517562 11:99183069-99183091 CCATGACTAAATAAGAAAAATGG - Intronic
1089207882 11:116779528-116779550 GCTTGACTACAGAAAAAAAAGGG + Intronic
1089231783 11:116983734-116983756 CCATGTTTACAGTAGATACAGGG - Intronic
1089758584 11:120706322-120706344 CCAGGAGTCCAGAAGAAACTGGG - Intronic
1090288379 11:125519962-125519984 CAGTGACTACAGAAGCAACTGGG - Intergenic
1091138977 11:133219142-133219164 GCATGACTGGGGAAGAAACACGG + Intronic
1094217684 12:27961886-27961908 AAATGACTAAAGAAGTAACAGGG + Intronic
1095532072 12:43200344-43200366 CAATGACTAGAGTAGTAACATGG + Intergenic
1095619589 12:44235246-44235268 CCATGACAACAAAAGAAAAAGGG - Intronic
1097033554 12:56106660-56106682 CCATGATTATGGAAGAAACAGGG + Exonic
1097036293 12:56126650-56126672 GCAGAACTACAGAAGGAACATGG - Exonic
1098798029 12:74918063-74918085 ACATGAGTACATAAGGAACATGG + Intergenic
1101270480 12:103138495-103138517 CACAGACTATAGAAGAAACATGG - Intergenic
1101674148 12:106902491-106902513 CTAGGTCTACAGATGAAACAAGG - Intergenic
1103810092 12:123606477-123606499 CCATGACCACAGAAGCACCGAGG - Intronic
1105332827 13:19433872-19433894 GCATGACTGCAGAAGAAATGGGG + Intronic
1105878866 13:24585909-24585931 GCATGACTGCAGAAGAAATGGGG - Intergenic
1106194633 13:27482847-27482869 CCATTGATAGAGAAGAAACATGG + Intergenic
1108626166 13:52230734-52230756 GCATGACTACAGAAGAGATGGGG + Intergenic
1108659900 13:52575748-52575770 GCATGACTACAGAAGAGATGGGG - Intergenic
1109151227 13:58849784-58849806 CCATGAAAACAGAAAAAAGAAGG - Intergenic
1110471245 13:75862568-75862590 CCATAAGTACAGAAGACAAAGGG - Intergenic
1112323870 13:98430499-98430521 CCATGACTCCAGGAGAGTCAGGG + Intronic
1116391407 14:44395248-44395270 CAAAGAATACAGAAGAGACATGG - Intergenic
1116664398 14:47756628-47756650 CCTTAACTACAGAAGGAAAAGGG + Intergenic
1117083366 14:52174726-52174748 CCATGAAGACAGAAGGAAAATGG - Intergenic
1117950360 14:61076742-61076764 CCATGACTCAAGAGGACACAAGG - Intronic
1121864304 14:97348054-97348076 CCATGAATACATAGGAAACAAGG + Intergenic
1122756706 14:103986158-103986180 ACAGGATTACAGAAGAAACCTGG - Intronic
1124821659 15:33052317-33052339 GGAAGACTACAGAAAAAACATGG + Intronic
1125095032 15:35841057-35841079 CCATGACGACAGAAGCATAAGGG - Intergenic
1125530774 15:40412058-40412080 CCTTGACAACAGAAGCAAGAAGG + Intronic
1126787992 15:52194397-52194419 CCATGAATGAAGAAGAAAGATGG - Intronic
1134235543 16:12462659-12462681 CCATGATTTCAGAATAAACAAGG + Intronic
1138831331 16:60378713-60378735 ACATGAAGACAGAAGAAAAAGGG + Intergenic
1139140812 16:64260287-64260309 GCATCACTGCAGAATAAACAAGG - Intergenic
1139236578 16:65345825-65345847 CCTTGAAGACAGAAGAAGCATGG - Intergenic
1139500521 16:67360547-67360569 GTAGTACTACAGAAGAAACAAGG - Intronic
1143633845 17:8153221-8153243 CCAGGACTACAGAGGGACCAAGG + Intronic
1146306954 17:31737424-31737446 CTATGGCAACAGAAGAGACAGGG - Intergenic
1148103166 17:45105042-45105064 CCATGTCTCCAGCAGAAACCGGG + Intronic
1149203004 17:54209941-54209963 CATTGACCACAGAATAAACAAGG + Intergenic
1151060659 17:71089973-71089995 CCAAGAATTCAGAAGAAAGATGG - Intergenic
1155593334 18:27453474-27453496 CCATGATTATGGCAGAAACAGGG - Intergenic
1156001551 18:32390541-32390563 CCAAGACTTAAGAGGAAACATGG - Intronic
1156111187 18:33729457-33729479 ACATGAGTACAGAGCAAACAGGG - Intronic
1156865995 18:41889447-41889469 CCTTGAGTAAAGAATAAACAAGG - Intergenic
1157147033 18:45174289-45174311 CCATCAGTAAAGAAGAAAAATGG - Intergenic
1159346795 18:67216297-67216319 CCAGGGCTACTGAAGAATCAAGG - Intergenic
1160217345 18:76944110-76944132 CCATGACTACTGAATTAACTTGG - Intronic
1163195412 19:15716271-15716293 CCATCACTCCAGAAGCTACAAGG - Intergenic
1166654259 19:44598829-44598851 CCATCTCTACAGAAGGAAGAAGG - Intergenic
1167198291 19:48045881-48045903 ACAGGACCACAGAAGAAACCAGG + Intergenic
1168676383 19:58280894-58280916 CTATGACTATAGAAGACATAAGG - Intronic
925165472 2:1713279-1713301 CAATTACCACAGAAGAAAGAAGG + Intronic
927016794 2:18971920-18971942 CAATGACTACAGAAGAGATTTGG - Intergenic
928118748 2:28566647-28566669 CCATCACTTCAGTAGAAAAACGG - Intronic
928254100 2:29707181-29707203 CCATGACAACAGGAGAAGCCTGG + Intronic
928667765 2:33567695-33567717 CATTTACAACAGAAGAAACAAGG + Intergenic
928913485 2:36446689-36446711 TCATGCCAACAGAAGAAAAAAGG - Intronic
929400756 2:41578737-41578759 CCAAGACAACATAAGAAAAAAGG + Intergenic
930090744 2:47529697-47529719 TCATGACTACAGAGAAACCATGG + Intronic
930705722 2:54502965-54502987 TCATGACCACAGAGGGAACATGG - Intronic
930731244 2:54729963-54729985 CCATCTCTACAGAAAATACAAGG + Intronic
931886402 2:66622722-66622744 CCAAGACTAAACAAGAAAGAAGG - Intergenic
932249897 2:70234030-70234052 CCTTGGCTACAGAAAAAACCAGG - Intronic
932679769 2:73815054-73815076 CCATCACTACAAAGGAATCAAGG - Exonic
933168671 2:79100681-79100703 CCATCACTCCAGAAGGCACAGGG - Intergenic
933771353 2:85746410-85746432 CCCTGCCTAAGGAAGAAACATGG - Intergenic
933821690 2:86118241-86118263 CCAAAACTACAGAACAAAGAGGG - Intronic
935081398 2:99800272-99800294 ACATCACCACAGAAGATACATGG + Intronic
937336794 2:121067220-121067242 CTATGTCTTCAGAAGAAACCTGG + Intergenic
937814649 2:126237837-126237859 GCATGGCCTCAGAAGAAACAGGG + Intergenic
939195043 2:138961359-138961381 CCATGCCAAGAGAAGAATCAGGG - Intergenic
940238754 2:151540308-151540330 CCATCACAACAGAAGAAAAAAGG + Intronic
943083012 2:183279283-183279305 CCCTGACTGCAGGAGAAACTGGG + Intergenic
944634893 2:201666179-201666201 CCAGAACTACAGAAGATAGATGG + Intronic
945635180 2:212340247-212340269 CCATTGCTATAGAAGAAAGAAGG - Intronic
945875096 2:215269779-215269801 CAATGACTAGATAAGAAGCAAGG + Intergenic
946061561 2:216946222-216946244 CCAGGACTCCAGAATAAAAATGG - Intergenic
946892495 2:224292363-224292385 CAATGACTACAAAATAGACAGGG - Intergenic
947189132 2:227483487-227483509 CCAGGAGTACAGTAAAAACAAGG - Intronic
948057138 2:235016947-235016969 CGTTGACTTCAGAAGATACAGGG + Intronic
948592743 2:239061887-239061909 CCATGACTAAAGTAGAAAATTGG + Intronic
949075120 2:242052342-242052364 CCTTGAGTCCAGAAGAGACACGG - Intergenic
1170072086 20:12380221-12380243 CCATGATTATGGAAGAAACAGGG + Intergenic
1171009628 20:21501741-21501763 CCATGACTTCCTCAGAAACAAGG - Intergenic
1173075338 20:39813212-39813234 CCATCATTACTGAAGCAACATGG + Intergenic
1174621157 20:51875677-51875699 CCCTGCCTACAAAAGAAAAAAGG - Intergenic
1176095052 20:63337469-63337491 CCCAGACTACAGAAGAACCAGGG + Intergenic
1179921091 21:44508037-44508059 CCAGGAGTTCAGAAGTAACAGGG + Intronic
955473399 3:59310936-59310958 TCATGATTAAAGAAGAAAAAGGG - Intergenic
956073274 3:65477518-65477540 CAATAACAACAGAAGAAACAAGG + Intronic
958912366 3:100008439-100008461 CAATGACTACAGCAAACACATGG - Intronic
960519943 3:118643112-118643134 CCATGCCTACAGAAGACATATGG + Intergenic
962371869 3:134827551-134827573 TTGTGACTACAGCAGAAACAGGG + Intronic
964450757 3:156810549-156810571 CCGTGATTATGGAAGAAACAGGG - Intergenic
966018148 3:175169423-175169445 CCATGACTACATAACTAAGAGGG + Intronic
966672623 3:182544925-182544947 CCATGACCACAGAAACAAAAAGG + Intergenic
967690502 3:192468091-192468113 GCATGAATACATAAGAGACATGG + Intronic
968263599 3:197344564-197344586 GCCTGACTACAGAATAAAAATGG - Intergenic
969116831 4:4875513-4875535 CGATGACTTCAGAAGGAACTGGG - Intergenic
969502379 4:7560949-7560971 CCATGGCTGCAGAAGCAAGATGG + Intronic
974859510 4:67502569-67502591 CAAAGACTACAGAAAATACAAGG + Intronic
976593624 4:86873829-86873851 GGATGACCACACAAGAAACAGGG + Intergenic
977570469 4:98623851-98623873 ACGTGAATACAGAGGAAACATGG - Intronic
977910097 4:102524413-102524435 GCTTGACAACAGCAGAAACATGG + Intronic
978358770 4:107906240-107906262 TCATGACAACAGAGCAAACAAGG - Intronic
979396128 4:120191737-120191759 CCATCACCAAAGATGAAACAGGG - Intergenic
984397452 4:179219876-179219898 ACACGGCTAGAGAAGAAACAAGG + Intergenic
986352086 5:6889793-6889815 CCATGACTACAGCATGCACATGG - Intergenic
987210741 5:15679762-15679784 CCATGACTTCACCACAAACAGGG - Intronic
987761442 5:22167552-22167574 CCAGGCCTACAGAAGAGAAATGG - Intronic
988085083 5:26464758-26464780 CCATGACAAAAGGGGAAACAGGG - Intergenic
991235178 5:64385698-64385720 TCAGAAATACAGAAGAAACAGGG + Intergenic
991896236 5:71401020-71401042 CCAGGCCTACAGAAGAGAAATGG - Intergenic
993091026 5:83426696-83426718 CCAGGACTACAGAACCAAAAAGG + Intergenic
993094361 5:83464539-83464561 CCAGGATTTCTGAAGAAACAAGG - Intergenic
993372409 5:87108941-87108963 CCACCACTACATGAGAAACATGG - Intergenic
993392052 5:87330941-87330963 CCATGACTTCACAAGGCACATGG - Intronic
994479306 5:100313043-100313065 CCATTACTACAGGAGAGATATGG + Intergenic
994622605 5:102180588-102180610 CCAAGAATACAAAAGAAAAAAGG + Intergenic
994731647 5:103498858-103498880 CCATCAATACAGAAGGAAAATGG + Intergenic
994997636 5:107084199-107084221 CCAAGACAACAGCAGGAACATGG + Intergenic
995116707 5:108488731-108488753 AACTGACTATAGAAGAAACATGG + Intergenic
996183281 5:120446924-120446946 CCATAAACAAAGAAGAAACATGG + Intergenic
997763673 5:136476692-136476714 CCATGCTTGCAGAAGAAAGATGG - Intergenic
998531773 5:142891657-142891679 ACATTCCTACAGAAGAAACTTGG - Intronic
998635570 5:143951216-143951238 CCATAACTACACTCGAAACAGGG - Intergenic
999410713 5:151347457-151347479 ACATGACTGCTTAAGAAACAAGG + Exonic
999524848 5:152393435-152393457 CCTTGTTTACAGAATAAACATGG + Intronic
1000826639 5:166053454-166053476 CCATGACTGCAGAATAAATTTGG - Intergenic
1000909060 5:166999095-166999117 CCATCTCCACAGAATAAACAGGG - Intergenic
1002621378 5:180491039-180491061 GCCTGACTGCAGTAGAAACAAGG + Intergenic
1003790697 6:9544142-9544164 TCATGAAGACAGAAGAAAAATGG + Intergenic
1005386711 6:25292623-25292645 TCCTAACTACAGAAGAAACTGGG - Intronic
1005816381 6:29556090-29556112 ACCTGACTCCACAAGAAACAAGG + Exonic
1007761636 6:44136731-44136753 CCATGACTACGGAAAAAAGGTGG - Intronic
1007854996 6:44846470-44846492 ACCAGACTACAGAAGAAACAAGG + Intronic
1008257406 6:49320748-49320770 CCATAAAAACAGAAGAAACCTGG + Intergenic
1011146796 6:84227206-84227228 CCATCTCTACAGAAGAAAGCTGG - Intronic
1013689001 6:112617698-112617720 CCGTGATTATGGAAGAAACAGGG - Intergenic
1014858998 6:126440596-126440618 AGATGTCTACAGAAGAAAAAAGG + Intergenic
1014930505 6:127330328-127330350 CCATGGTTACAGAAGAAACACGG - Intronic
1015617116 6:135089043-135089065 ACATGCCTCCAGAAGACACAAGG - Intronic
1020111079 7:5448071-5448093 CCCTGTCTACAAAAGAAAAAAGG - Intronic
1020626803 7:10591244-10591266 ACATGACAACAGTAGAAACTGGG + Intergenic
1023686229 7:42738098-42738120 CCATGAGAACAGAAGAGAAAGGG - Intergenic
1024210664 7:47200614-47200636 CCACTGCTACAGAAGACACAGGG - Intergenic
1024838231 7:53550024-53550046 CAATAACGACAGAAAAAACATGG - Intergenic
1025782205 7:64611801-64611823 TCATGCCCACAGAAGAAAGATGG + Intergenic
1027998365 7:85456995-85457017 CAATGACTCCAGAAGTTACACGG - Intergenic
1033380231 7:140809705-140809727 ACAGAACTACAGTAGAAACAAGG - Intronic
1035702451 8:1646998-1647020 CCAGGACTTCAGCAGACACAGGG + Intronic
1037489014 8:19378872-19378894 CCATCTCTACAAAAAAAACATGG + Intronic
1038061378 8:23917598-23917620 CAGTGACAACAGAGGAAACAAGG - Intergenic
1038520684 8:28229765-28229787 GCATGACAACAGAAGGAACCTGG + Intergenic
1038849984 8:31266301-31266323 CCATTATTACCAAAGAAACAGGG + Intergenic
1045641173 8:104252651-104252673 CTATGATTAAAGAATAAACATGG - Intronic
1046543657 8:115619564-115619586 CAAAGGCTACAGAGGAAACAGGG - Exonic
1049082805 8:140456717-140456739 CTATGACTACCTTAGAAACACGG + Intronic
1050523658 9:6527238-6527260 CCAGGACTAGAGGAGAAGCAGGG + Intergenic
1050715660 9:8522286-8522308 CAATGACCGCAGAAGAAATAAGG + Intronic
1052038193 9:23707034-23707056 CCTGTTCTACAGAAGAAACAAGG + Intronic
1052875785 9:33561553-33561575 CCATGACTCCAAAGGAAAAATGG - Intronic
1056782843 9:89564314-89564336 CCAGGACTGCAGAGGACACACGG + Intergenic
1059974245 9:119698727-119698749 TCATGAATAAAGAAGAAAGAGGG + Intergenic
1060187961 9:121575352-121575374 CCAGGACCACAGAAGAAGGAAGG - Intronic
1185672227 X:1822008-1822030 ACATGCCAACAGAACAAACAGGG + Intergenic
1192285583 X:69732032-69732054 CCATGTCAACAGAATAAAGAAGG - Intronic
1192723832 X:73727397-73727419 CCATAACTACACTAGACACAAGG - Intergenic
1193744993 X:85266521-85266543 GGATGACTACAGAAGAAATGTGG - Intronic
1193919004 X:87403414-87403436 ACAGGACTAACGAAGAAACAAGG + Intergenic
1194757379 X:97753097-97753119 CCAAGACTACTGAAAAAGCATGG - Intergenic
1196179605 X:112675357-112675379 CCGTGACTACAGTAGAAATGAGG + Intronic
1196950231 X:120869619-120869641 CCATGATTATGGAAGAAATAGGG - Intergenic
1200153026 X:153960479-153960501 CCTTGACAACAAAAGAACCAAGG - Intronic
1202598481 Y:26568542-26568564 GCATGACTGCAGAAGAAATGGGG - Intergenic