ID: 1068318706

View in Genome Browser
Species Human (GRCh38)
Location 10:55381857-55381879
Sequence GAGGGGTATTGGGATTGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 224}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068318706_1068318712 -8 Left 1068318706 10:55381857-55381879 CCCATCCAATCCCAATACCCCTC 0: 1
1: 1
2: 0
3: 15
4: 224
Right 1068318712 10:55381872-55381894 TACCCCTCACGCTGATTGGCTGG No data
1068318706_1068318715 -5 Left 1068318706 10:55381857-55381879 CCCATCCAATCCCAATACCCCTC 0: 1
1: 1
2: 0
3: 15
4: 224
Right 1068318715 10:55381875-55381897 CCCTCACGCTGATTGGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068318706 Original CRISPR GAGGGGTATTGGGATTGGAT GGG (reversed) Intronic
900016671 1:155567-155589 GATGGGGATTGGGCTGGGATGGG - Intergenic
900046932 1:514159-514181 GATGGGGATTGGGCTGGGATGGG - Intergenic
900069135 1:755877-755899 GATGGGGATTGGGCTGGGATGGG - Intergenic
902680969 1:18043480-18043502 GAGGGGTGATGGGGATGGATGGG - Intergenic
903365179 1:22801727-22801749 GAGGGGGAAGGGGATGGGATGGG - Intronic
906058311 1:42932554-42932576 GAGGGGTGTTGGGATGGGTTGGG - Intronic
906287127 1:44594750-44594772 TTGGGGAATTTGGATTGGATTGG + Intronic
907417284 1:54323362-54323384 GAGGGGTCTTGGGATTCGAGAGG - Intronic
911249131 1:95555204-95555226 GAAGAGTCTTGGGAGTGGATGGG + Intergenic
911523870 1:98961018-98961040 TTGGGGTAGTGGGATTGTATAGG - Intronic
912679082 1:111717239-111717261 GAGAGGTAATGGGATTGAGTAGG + Intronic
916487719 1:165274216-165274238 TAGAGGTATTGGCAATGGATGGG - Intronic
916802680 1:168229607-168229629 GAGTGGTAGTGGGATTGGCATGG - Intronic
918946160 1:191068221-191068243 TTGGGGTATAGGTATTGGATAGG - Intergenic
922104496 1:222501269-222501291 GATGGGGATTGGGCTGGGATGGG - Intergenic
922264815 1:223973782-223973804 GATGGGGATTGGGCTGGGATAGG - Intergenic
924346671 1:243078788-243078810 GATGGGGATTGGGCTGGGATGGG - Intergenic
1064282482 10:13964254-13964276 GAGGGGGATTGTGTTTGGTTTGG - Intronic
1065086864 10:22187377-22187399 TAGGGGTATGGGTTTTGGATTGG - Intergenic
1065885732 10:30075273-30075295 GAGGGGAACTAGGATTGTATTGG - Intronic
1066729678 10:38426061-38426083 GATGGGGATTGGGCTGGGATGGG + Intergenic
1068318706 10:55381857-55381879 GAGGGGTATTGGGATTGGATGGG - Intronic
1068770918 10:60819671-60819693 GTAAGATATTGGGATTGGATTGG + Intergenic
1069097171 10:64273124-64273146 GAGAGTGATTGGGAGTGGATAGG - Intergenic
1070422485 10:76250880-76250902 GAGGGGTATTGGGGATGGCAAGG + Intronic
1070770133 10:79077418-79077440 GAGAGGTGGTGGGATTGGCTGGG + Intronic
1073569437 10:104564147-104564169 GTGGGGCATTGGGAGTGGAGTGG + Intergenic
1073580933 10:104664923-104664945 GGGGGCTATGGGGATGGGATCGG + Intronic
1074111178 10:110423716-110423738 CATGGCTATTGGGATTGAATGGG + Intergenic
1075332547 10:121584348-121584370 GAGGGGTTATGGGATTGGTTGGG - Intronic
1075332562 10:121584388-121584410 GAGGGGTTATGGGATAGGTTGGG - Intronic
1075332577 10:121584428-121584450 GAGGGGTTATGGGATCGGTTGGG - Intronic
1075332631 10:121584586-121584608 GAGGGGTTATGGGATCGGTTGGG - Intronic
1075332646 10:121584626-121584648 GAGGGGTTATGGGATCGGTTGGG - Intronic
1075332661 10:121584666-121584688 GAGGGGTTATGGGATCGGTTGGG - Intronic
1075332676 10:121584706-121584728 GAGGGGTTATGGGATTGGTTGGG - Intronic
1075332716 10:121584823-121584845 GAGGGGTTATGGGATCGGTTGGG - Intronic
1075332757 10:121584940-121584962 GAGGGGTTATGGGATCGGTTGGG - Intronic
1076793263 10:132787524-132787546 GACTGGGATTGGGATTCGATTGG + Intergenic
1076973261 11:150636-150658 GATGGGGATTGGGCTGGGATGGG - Intergenic
1078730087 11:13965503-13965525 GTGGGGAACTGGGACTGGATAGG + Intronic
1079031786 11:16991654-16991676 GAGAGGTAATGGGGTTGGAGAGG + Intronic
1079077211 11:17391387-17391409 GTGGGGGATAGGGATTGGTTAGG - Intergenic
1080913824 11:36634311-36634333 GAGGTTCATTGGGATGGGATAGG + Intronic
1081869218 11:46375735-46375757 CAGGGGTGTTGGGAGTGGAGCGG + Intronic
1083156666 11:60827555-60827577 CATGGGTCTTGGAATTGGATGGG + Intergenic
1084360407 11:68665240-68665262 GAGGGGTCCTGGGCTTGGCTTGG + Intergenic
1085092466 11:73729755-73729777 CTGGGGTATTGGCTTTGGATTGG - Intronic
1087101412 11:94368972-94368994 AAGGGGTATTGGGTTAGTATGGG - Intergenic
1089002897 11:115067119-115067141 GAGTTGTATTGGGCTTGGCTGGG - Intergenic
1090180811 11:124697732-124697754 TAGGGGTTTTGGGATAGGAGTGG - Intergenic
1090395269 11:126414482-126414504 CAGGGGCATTGGGAATGGGTGGG + Exonic
1092256001 12:6927392-6927414 TTGGGATAATGGGATTGGATTGG - Intronic
1100480632 12:94974848-94974870 GAAGGGTAGTGGGGTTGGTTTGG + Intronic
1101321490 12:103676942-103676964 GAGGGGGATGGGGTTGGGATGGG - Intronic
1101333869 12:103779215-103779237 GGGGGTTATGGGGCTTGGATGGG - Intronic
1102691264 12:114762997-114763019 GAAGGGTATTGGGATTGGATGGG - Intergenic
1103021796 12:117540221-117540243 GAGAGGTGTTGGGATGGGAGGGG - Intronic
1107355467 13:39561172-39561194 GAGGGGTATGGGGAGTGGGGAGG - Intronic
1108641856 13:52390185-52390207 GATAGGTCTTGGGGTTGGATGGG - Intronic
1113182947 13:107652599-107652621 GGGGGATATTAGGATGGGATTGG - Intronic
1113785635 13:113000855-113000877 GAGGGGTGCTGGGTTTGGGTGGG - Intronic
1119260795 14:73237247-73237269 AAGGGGAAATGGGATTGGAGAGG + Intergenic
1120603823 14:86546497-86546519 AAGGGATCTTTGGATTGGATGGG + Intergenic
1121509758 14:94503559-94503581 GAGGGGTATGTGGGTTGGAAAGG + Intronic
1121631287 14:95423495-95423517 GATGGGCATAGGGATTTGATGGG + Intronic
1121631293 14:95423512-95423534 GATGGGGATGGGGATTTGATGGG + Intronic
1121631299 14:95423529-95423551 GATGGGGATGGGGATTTGATGGG + Intronic
1121631304 14:95423546-95423568 GATGGGCATGGGGATTTGATGGG + Intronic
1121631319 14:95423597-95423619 GATGGGGATGGGGATTTGATGGG + Intronic
1121631325 14:95423614-95423636 GATGGGGATGGGGATTTGATGGG + Intronic
1121631337 14:95423648-95423670 GATGGGGATGGGGATTTGATGGG + Intronic
1121631343 14:95423665-95423687 GATGGGGATGGGGATTTGATGGG + Intronic
1121631353 14:95423699-95423721 GATGGGGATGGGGATTTGATGGG + Intronic
1121631359 14:95423716-95423738 GATGGGGATGGGGATTTGATGGG + Intronic
1121631365 14:95423733-95423755 GATGGGGATGGGGATTTGATGGG + Intronic
1121631377 14:95423767-95423789 GATGGGGATGGGGATTTGATGGG + Intronic
1121631383 14:95423784-95423806 GATGGGGATGGGGATTTGATGGG + Intronic
1121631402 14:95423852-95423874 GATGGGGATGGGGATTTGATGGG + Intronic
1121631414 14:95423886-95423908 GATGGGGATGGGGATTTGATGGG + Intronic
1121631424 14:95423920-95423942 GATGGGGATGGGGATTTGATGGG + Intronic
1121631430 14:95423937-95423959 GATGGGGATGGGGATTTGATGGG + Intronic
1121631436 14:95423954-95423976 GATGGGGATGGGGATTTGATGGG + Intronic
1121631442 14:95423971-95423993 GATGGGGATGGGGATTTGATGGG + Intronic
1121784990 14:96650989-96651011 AAGTGGTATTGGCATAGGATAGG - Intergenic
1122347708 14:101070797-101070819 GAGGGGGACTGGGAATGGAAAGG + Intergenic
1124556381 15:30729521-30729543 AAGGGGAATGGGTATTGGATGGG + Intronic
1124674892 15:31676249-31676271 AAGGGGAATGGGTATTGGATGGG - Intronic
1126655841 15:50976552-50976574 GAGAGGTATTCAGATTGGAAAGG + Intronic
1133909473 16:10051866-10051888 GAAGGGTAATGGGATTAGGTAGG + Intronic
1134600189 16:15527784-15527806 GGTGGGTATTGGGACTAGATGGG - Intronic
1138167245 16:54814421-54814443 GAGGGGTATGGGGGTTGGGGGGG + Intergenic
1138251546 16:55505659-55505681 GAGGGTTGGTGGGATTGGAGGGG - Exonic
1138483023 16:57316707-57316729 GTGGGGTATTGGCACTGGAGGGG + Intergenic
1142446990 16:90146890-90146912 GATGGGGATTGGGCTGGGATGGG + Intergenic
1142460502 17:88441-88463 GATGGGGATTGGGCTGGGATGGG - Intergenic
1142941333 17:3382105-3382127 GCGGGGTACTGGGATAGGGTAGG + Intergenic
1142959649 17:3544580-3544602 TGGGGCTGTTGGGATTGGATGGG + Exonic
1146416079 17:32634508-32634530 TAAGGATAGTGGGATTGGATGGG + Intronic
1148431863 17:47649680-47649702 GAGGGAGATTGGGATGGGGTAGG - Intronic
1148547442 17:48528964-48528986 GAGGGCTAATGGGGTTAGATGGG + Exonic
1154132259 18:11747609-11747631 TAGGGGTACTGGGGATGGATAGG + Intronic
1154132266 18:11747628-11747650 TAGGGGTACTGGGGATGGATAGG + Intronic
1155422401 18:25669278-25669300 GAGTGGTATTGGGAGTGAGTAGG + Intergenic
1157588097 18:48817986-48818008 GAGCGATCTTGGAATTGGATTGG + Intronic
1160255158 18:77242249-77242271 GTGGGGTATTTGGATTGGCTAGG + Intergenic
1160650217 19:220941-220963 GATGGGGATTGGGCTGGGATGGG - Intergenic
1160982840 19:1824073-1824095 TAGGCGTAGTGGGATTGGATTGG - Intronic
1162797433 19:13094228-13094250 GAGGGGTTTTAGGAATGGGTTGG - Intronic
1163568899 19:18068694-18068716 GAGGGGGATGGGGATGGGGTTGG - Intronic
1164932583 19:32186875-32186897 GAGGGGCATTGGGGGTGGAGAGG - Intergenic
1165384935 19:35504846-35504868 GGGGGGTGTTGGGAATGGGTGGG - Intronic
1165956259 19:39503721-39503743 GAGGGGATTTGGGATTGGTGGGG - Intronic
1167673678 19:50871273-50871295 GAAGGGTGTGGGGATTGAATTGG + Intronic
926756660 2:16241890-16241912 GGGTGGTATTGGGATTCCATGGG + Intergenic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
930030910 2:47057434-47057456 AAGAGGGATTGGGATTGGGTGGG + Intronic
933430282 2:82168550-82168572 CAGGGGTATTGGTAATGAATGGG - Intergenic
934475302 2:94589493-94589515 GAGGGGAATTGGGAGTGCAGGGG - Intronic
936505596 2:113103163-113103185 GAGGGGAGATGGGATTGGAATGG + Intergenic
938754222 2:134365034-134365056 GAGGTGAATCGGGATTGGGTAGG - Intronic
940029601 2:149247666-149247688 GAAGGGTATAGGGATTGGGAAGG - Intergenic
943538072 2:189177670-189177692 GGGGGGTACTGGGGTTGGATTGG + Intronic
945078435 2:206064064-206064086 GAAGTTTATTGTGATTGGATGGG - Intronic
945204607 2:207318888-207318910 AAAGGGTATTAAGATTGGATGGG + Intergenic
946074142 2:217059865-217059887 TAGGGGCATTGGAATTGTATGGG + Intergenic
946216138 2:218185242-218185264 GAGGGGTAATGAGGTGGGATGGG - Intergenic
1169953281 20:11072403-11072425 AAGTGGTATTGGGAGTGGAAAGG - Intergenic
1175238188 20:57526879-57526901 GAGGGGCAATGGGAGAGGATGGG + Intergenic
1175357876 20:58383205-58383227 AAGGGATTCTGGGATTGGATTGG + Intergenic
1178883649 21:36467672-36467694 GAGGGGTGCAGGGATGGGATGGG + Intronic
1185079120 22:48699968-48699990 ACGGGGTATTGGGAGTGGATGGG + Intronic
949184466 3:1173550-1173572 CTTGGGCATTGGGATTGGATGGG - Intronic
949538143 3:5011765-5011787 GAGGGGTATGGGGGTTGAGTCGG - Intergenic
952190619 3:31019187-31019209 CAGTGGTATTGGGCTTGGCTAGG - Intergenic
956572465 3:70712268-70712290 GATGGGTTTTGGGCTTGCATGGG - Intergenic
956921575 3:73935295-73935317 GAGGAGGATTGGGAATGGATGGG + Intergenic
957243218 3:77685591-77685613 GAGGGGTACTGAGACTGGCTTGG + Intergenic
958069393 3:88590548-88590570 GATGGGGATGGGGATTGGAATGG - Intergenic
961046085 3:123708908-123708930 GAGGGGAAGGGGGATTGGTTAGG + Intronic
961430304 3:126877171-126877193 GCGGGGAATGGGGATGGGATGGG + Intronic
967370560 3:188740391-188740413 GTAGGATATTGGGCTTGGATAGG - Intronic
967837236 3:193974945-193974967 GAGGGGCTTTGGGAGTGGATAGG - Intergenic
968367629 3:198199188-198199210 GATGGGGATTGGGCTGGGATGGG + Intergenic
968530709 4:1090017-1090039 GAGGGGTGACGGGATGGGATGGG + Intronic
969397070 4:6928831-6928853 GAGGGTTGTTGGGATTAAATGGG + Intronic
970342695 4:15123098-15123120 TAGGGGTTTTGGGAGTAGATGGG - Intergenic
972528207 4:39936960-39936982 GAGGGGTGTGTGGATGGGATGGG + Intronic
973250869 4:48058520-48058542 GAGGGGTATTGGCATCTAATGGG + Intergenic
973597578 4:52508107-52508129 CAGGGGTATTGGAATGGTATTGG - Intergenic
975861654 4:78683704-78683726 GTGGGGCTTGGGGATTGGATGGG + Intergenic
976466600 4:85376561-85376583 GAGGGGTTTTGGGAAAGAATGGG - Intergenic
978627874 4:110707967-110707989 GAGGGTAATTGGGAATGGTTAGG - Intergenic
979131109 4:117045907-117045929 GAATGCTATTGGGATTTGATAGG + Intergenic
979256044 4:118608900-118608922 GATGGGGATTGGGCTGGGATGGG + Intergenic
979332300 4:119431637-119431659 GATGGGGATTGGGCTGGGATGGG - Intergenic
979485130 4:121262361-121262383 GAGGGGTAGTGGTCTTGGGTGGG + Intergenic
979629887 4:122888516-122888538 GAGAGGTAATGGGATGGGAGAGG - Intronic
980775998 4:137437256-137437278 GAAGGCTATTGGGCTTGAATGGG + Intergenic
982039460 4:151381348-151381370 GAAGGGTATAGGGGTTGGAAGGG + Intergenic
984163567 4:176282672-176282694 GATGGGTATTTGGGTTGGAGTGG - Intergenic
984282138 4:177683306-177683328 GAGCGGTATAGTGTTTGGATTGG + Intergenic
989211955 5:38865697-38865719 CAGTGGTAGTGGGGTTGGATGGG + Intronic
989615679 5:43334932-43334954 GAGGGGTATTTAGATTGGGAGGG + Intergenic
991638597 5:68731621-68731643 GAGAGGTATTGGGATTCTCTGGG - Intergenic
992300389 5:75372331-75372353 GTGGGGTATGGGGTTGGGATGGG - Exonic
994668147 5:102732227-102732249 GACTGGTATTGGAATTGCATTGG + Intergenic
996605596 5:125317705-125317727 GAGGGGAATAGGGTTTGGAGGGG - Intergenic
998101731 5:139440135-139440157 GAGGGGTGTTGGAGTAGGATGGG - Intronic
998402996 5:141857737-141857759 GAGGGTTATTGGGGTAGCATAGG - Intronic
1000885199 5:166741832-166741854 GTGGGATATTGGCATTGAATGGG + Intergenic
1002726852 5:181304417-181304439 GATGGGGATTGGGCTGGGATGGG + Intergenic
1005965931 6:30726446-30726468 TAGGGGGGTGGGGATTGGATGGG + Intergenic
1006555648 6:34863925-34863947 GATGGGTATTGTAAGTGGATGGG + Intronic
1007107777 6:39295423-39295445 GAGAGGTTTTGTGATTGGAGTGG + Intergenic
1007597778 6:43062179-43062201 GAGGGGTAATGGGGTTGGAGGGG + Intronic
1007666627 6:43517229-43517251 GATGGGTCTTGGGATTGGCGTGG + Intronic
1007775883 6:44223997-44224019 GAGGGGTATGGGGATGGGGATGG + Intronic
1008292302 6:49731812-49731834 AAAGGGTATTGGGCTTGGAAAGG + Intronic
1013610758 6:111792875-111792897 GGGGTGTATTGGGACTGGATGGG + Intronic
1013641607 6:112088259-112088281 GATGGGTATTTAGATGGGATAGG + Intronic
1014763271 6:125381709-125381731 GAGGGCAATAGGGATGGGATGGG - Intergenic
1016612468 6:146006921-146006943 GAAGGGTATTGGGGGTGGATAGG + Intergenic
1020011726 7:4809051-4809073 GAGGGGCAGTGGCATTGGAACGG - Intronic
1022841233 7:34165810-34165832 TAGGTGTATTGGCATTGGGTTGG + Intergenic
1023020038 7:36003719-36003741 GAAGGGGCTTGGGAATGGATGGG + Intergenic
1023589366 7:41764881-41764903 GAGAGAGAATGGGATTGGATAGG - Intergenic
1024304938 7:47921625-47921647 GATGGGTATTTGGTTTGGGTTGG - Intronic
1026269781 7:68826355-68826377 GTGGAGTAGTGGGATTGGCTGGG + Intergenic
1026494320 7:70889306-70889328 TAGGGGAATTGAGGTTGGATGGG - Intergenic
1026506838 7:70991980-70992002 GAAGGGTTCTGGGAATGGATTGG - Intergenic
1027602785 7:80259989-80260011 AGGGGGAATTGGGATTGGGTTGG + Intergenic
1029673975 7:102053576-102053598 GAGGGGTAGTGGGGCTGGAAAGG - Intronic
1029961106 7:104689953-104689975 GAGGGCTATTGTGATGGGAAAGG + Intronic
1030275027 7:107711467-107711489 GAGAGGTATTGTGAGTGGCTGGG + Intronic
1030522667 7:110617674-110617696 GATGGGTGTTGGGGTTGTATAGG + Intergenic
1030657298 7:112182449-112182471 GAGGGGTGTTAGCATTGCATTGG + Intronic
1030890748 7:114996242-114996264 GGGAGGTAATAGGATTGGATCGG + Intronic
1030908755 7:115220194-115220216 GAGAGGTATTTGTATTGAATAGG + Intergenic
1032048362 7:128629636-128629658 GATGGGGATTGGGCTGGGATGGG + Intergenic
1032421377 7:131782627-131782649 CAGGGGAAGTGGGAATGGATGGG - Intergenic
1032812708 7:135437820-135437842 GAGAGGTAATGGATTTGGATAGG - Intronic
1034422165 7:150995882-150995904 GAGGGGTTTAGGGGTGGGATGGG - Intronic
1035453152 7:158992084-158992106 GAGGGGTGTTGGGAGTGAGTGGG + Intergenic
1038205419 8:25459812-25459834 GAAGTGTATTGGGGATGGATGGG + Intronic
1039508670 8:38071416-38071438 GATGGGTATTGGGATTCAGTGGG + Intergenic
1039769084 8:40664666-40664688 GAGGGGATTTGGGAGTGGCTTGG - Intronic
1040060222 8:43097360-43097382 GAGGGGGAGTAGAATTGGATGGG + Intronic
1040302177 8:46193788-46193810 GAGGGCTTCTGGGATTGGAGAGG - Intergenic
1040349161 8:46545807-46545829 GGGTGGGATTGGGATTAGATTGG - Intergenic
1047453502 8:124988310-124988332 GAGGGATATTATGATTGGAAAGG + Intergenic
1048183006 8:132213536-132213558 GAGGGTAACTGGGATTGGATTGG - Intronic
1048459968 8:134613598-134613620 GACGGGTATTGGGAACGGGTAGG - Intronic
1050181243 9:2924969-2924991 GGTGGGTATTGGGTTTGGGTGGG - Intergenic
1050786106 9:9403926-9403948 GAGGAATATTTAGATTGGATGGG + Intronic
1051126975 9:13815699-13815721 GAGTGGTAATGGGATTGGAGGGG - Intergenic
1051855928 9:21565374-21565396 GATGGGGAGTGGGAATGGATTGG - Intergenic
1052039849 9:23725632-23725654 CAGGATTATTGGGATTGGGTTGG - Intronic
1052099541 9:24428248-24428270 GAGAAGTACTGGGATTGGAGGGG + Intergenic
1052854745 9:33400288-33400310 GAGGGGAATTGGGAGTGCAGGGG + Intronic
1053682765 9:40496569-40496591 GAGGGGAATTGGGAGTGCAGGGG + Intergenic
1053932747 9:43124910-43124932 GAGGGGAATTGGGAGTGCAGGGG + Intergenic
1054280949 9:63128360-63128382 GAGGGGAATTGGGAGTGCAGGGG - Intergenic
1054295865 9:63332083-63332105 GAGGGGAATTGGGAGTGCAGGGG + Intergenic
1054393882 9:64636578-64636600 GAGGGGAATTGGGAGTGCAGGGG + Intergenic
1054428531 9:65141791-65141813 GAGGGGAATTGGGAGTGCAGGGG + Intergenic
1054501848 9:65879754-65879776 GAGGGGAATTGGGAGTGCAGGGG - Intronic
1055285567 9:74724910-74724932 GGGGGGTATTGGGGTGGGAAAGG - Intronic
1060193173 9:121605856-121605878 GGGGGTTATTGGGATTGTGTCGG + Intronic
1060443426 9:123663641-123663663 GAGTGGGATTGGGGTTGGAGGGG + Intronic
1062751970 9:138261893-138261915 GATGGGGATTGGGCTGGGATGGG + Intergenic
1187357658 X:18592427-18592449 GAGGAGCATTTGGATTAGATAGG + Intronic
1187750867 X:22463586-22463608 GAGGGCTCCTGTGATTGGATTGG - Intergenic
1189037337 X:37506220-37506242 GAGGGCATGTGGGATTGGATGGG + Intronic
1189333594 X:40156929-40156951 GAGGGGCATCGGGACTGGACCGG + Intronic
1189992012 X:46604305-46604327 GAGGGCTCATGGGTTTGGATAGG + Intronic
1190301614 X:49060472-49060494 GCATGGAATTGGGATTGGATTGG + Intronic
1195754739 X:108189819-108189841 GAGGGGTTTTGGGATGGCCTAGG - Intronic
1196032522 X:111106634-111106656 CAGGGCTATTGGGATGGGAGGGG - Intronic
1196582470 X:117393576-117393598 GATGGGTTTTGGAATTGCATGGG - Intergenic
1198882643 X:141297758-141297780 GAAGGGTAGTGGGATTGGGGTGG + Intergenic