ID: 1068322362

View in Genome Browser
Species Human (GRCh38)
Location 10:55435770-55435792
Sequence CTCTGCCAATGTACTATCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 99}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068322362 Original CRISPR CTCTGCCAATGTACTATCTA TGG (reversed) Intronic
905641266 1:39591624-39591646 CTCTCCCCATGTAATATCAATGG + Intergenic
908543665 1:65145269-65145291 CTCTGCCAATGTATGACCTTTGG - Intergenic
910904603 1:92162087-92162109 CGCTGCCAATATACAATCAATGG - Intergenic
914221435 1:145685682-145685704 CTCTGCCTATGTTCTTTCTGGGG - Intronic
914474001 1:148008549-148008571 CTCTGCCTATGTTCTTTCTGGGG - Intergenic
915772872 1:158447621-158447643 CTCTGCCAATGTACAATGTTGGG + Intergenic
920538234 1:206755572-206755594 CTCTGCCTATGCTCTATCAATGG - Intergenic
922361702 1:224828620-224828642 GTCTGATAATGTACTATCTCTGG - Intergenic
922903069 1:229153025-229153047 CTCTGCCTATGCTCTATCAATGG - Intergenic
923932119 1:238713127-238713149 CTCTGCCAATGGACAGGCTAAGG - Intergenic
1068322362 10:55435770-55435792 CTCTGCCAATGTACTATCTATGG - Intronic
1068650648 10:59518828-59518850 CTCAGCCAGTGGACTAACTATGG - Intergenic
1069522822 10:69138979-69139001 CTCTGACAATGTACTTACTATGG - Intronic
1074312304 10:112332701-112332723 CTCTGCCAATGTTCTTTGAAAGG - Intergenic
1075518080 10:123125435-123125457 CTCTGGGACTTTACTATCTAGGG - Intergenic
1081767113 11:45619087-45619109 CTCTGACAAGGTACTGTCTGAGG + Intergenic
1083091643 11:60206062-60206084 CTATTCCAAGGTACTTTCTATGG + Intronic
1083379029 11:62249288-62249310 CTCTCCCAATGAACTAACCATGG + Intergenic
1086205448 11:84252479-84252501 GACTGTCAATGTTCTATCTAGGG - Intronic
1088630336 11:111767884-111767906 GTCTGCGAATGTATTCTCTAGGG + Intergenic
1092150764 12:6246821-6246843 CTCTGCCACTTGACTTTCTATGG - Intergenic
1092517423 12:9229670-9229692 CTGTGAAAAGGTACTATCTACGG - Intergenic
1093125629 12:15324567-15324589 CTTTGCCAATGTATTTACTATGG - Intronic
1095791156 12:46168751-46168773 CTCTGCCTATGTTCTATAAATGG - Intergenic
1096728842 12:53589311-53589333 CTCTGCCAAAGTACTTTACAGGG - Intronic
1096815115 12:54196989-54197011 CTCTGCCTGTCCACTATCTATGG - Intergenic
1104702907 12:130920781-130920803 CTCTGCCAATGTGCATTTTATGG + Intergenic
1109850914 13:68062003-68062025 CTCTCTAAATGTACTGTCTATGG + Intergenic
1110447311 13:75600518-75600540 CTCTGCCTATGTTCTATAAATGG + Intronic
1110521649 13:76486256-76486278 ATCTGCCAATGCTCTTTCTATGG + Intergenic
1112707340 13:102085624-102085646 CTCTGACAATGTATTATCCTGGG + Intronic
1115159514 14:30377722-30377744 GTCTGCCAATGTAGACTCTAAGG + Intergenic
1115621839 14:35148508-35148530 CTCTGCCTATGCTCTATCAATGG - Intronic
1117166675 14:53041352-53041374 ATCTGCCAATGGACTATTTTTGG + Intronic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1117994440 14:61466072-61466094 GTCTGCCAATTCACTATCTTGGG - Intronic
1120023739 14:79558652-79558674 CTCTGCCTGTGTTCTATCAAAGG - Intronic
1123759613 15:23422367-23422389 ATCTGTGAATGTACGATCTAGGG - Intergenic
1124222762 15:27864237-27864259 CTCTGCCATTGTGCAAGCTAAGG - Intronic
1124901675 15:33829069-33829091 CTCTGCCCATGCTCTATGTATGG + Intronic
1125875608 15:43141350-43141372 CTCTGCCTGTGTTCTATATATGG + Intronic
1126439638 15:48673603-48673625 CTGTGTCAATGCACTGTCTAAGG + Intergenic
1134456734 16:14400529-14400551 ATCTGTGAATGTACGATCTAGGG + Intergenic
1140665892 16:77227180-77227202 CTCTCCCTATGAACTATTTAAGG - Intergenic
1144308320 17:13989555-13989577 CTCTCCCACTGCACTATGTATGG - Intergenic
1147111701 17:38267070-38267092 CTCACCCAATGTGCTATCCAAGG + Intergenic
1147898139 17:43765536-43765558 CTCTGACAATGTAATCTTTATGG - Intergenic
1148417875 17:47521730-47521752 CTCACCCAATGTGCTATCCAAGG - Intergenic
1152206298 17:78976399-78976421 CTCTGCCCCTGTTCTGTCTATGG - Intronic
1163272898 19:16264858-16264880 CTCAGGCAATGCACTATCTTTGG + Intergenic
925083185 2:1086085-1086107 CTCTGCTAATTTATAATCTAAGG + Intronic
929702947 2:44180534-44180556 CTCTGCCAATTTAATATTTCTGG + Intronic
931008878 2:57884547-57884569 CTCTGCCCATGCACTGTCCAGGG + Intergenic
940099992 2:150025977-150025999 CTCTGCCACTTTACTTGCTATGG - Intergenic
941727573 2:168880018-168880040 CTCTGCCTATGTTCTATAAATGG - Intronic
943298682 2:186170330-186170352 GCCTGCCAATGCACTACCTATGG - Intergenic
944367936 2:198946433-198946455 CTCTGCTAAAATACAATCTATGG + Intergenic
946785546 2:223239718-223239740 CTCTGCCACTTTGCTGTCTATGG + Intergenic
1170367248 20:15611299-15611321 CTCTGCCATTGTGTTATCTTTGG - Intronic
1172545548 20:35758321-35758343 CTCTGCCTATGTTCTATAAATGG + Intergenic
1173336882 20:42119502-42119524 CACTGCCAAGTTACTTTCTAGGG + Intronic
1177461330 21:21415049-21415071 CTCTGCCTGTGTTCTATCCATGG - Intronic
1180757869 22:18175624-18175646 ATCTGCCCATGTACTGTCTACGG - Intronic
1180768154 22:18359417-18359439 ATCTGCCCATGTACTGTCTGCGG - Intergenic
1180778152 22:18502973-18502995 ATCTGCCCATGTACTGTCTACGG + Intergenic
1180810877 22:18760284-18760306 ATCTGCCCATGTACTGTCTGCGG + Intergenic
1181197026 22:21194539-21194561 ATCTGCCCATGTACTGTCTACGG + Intergenic
1182917290 22:34046509-34046531 CTCTGCCACTCTGCCATCTATGG + Intergenic
1203229774 22_KI270731v1_random:100304-100326 ATCTGCCCATGTACTGTCTGCGG - Intergenic
950615091 3:14151820-14151842 CTCTGCCATTTTACTAACTGTGG + Intronic
952836689 3:37608563-37608585 AAATGCCAATGTACTATCTGGGG - Intronic
957961564 3:87260658-87260680 CTCTGACAATGTAGTATCCATGG - Intronic
961109683 3:124273250-124273272 CTCTCCCAATTAAGTATCTAGGG + Intronic
963384287 3:144570763-144570785 CTCTGGGAATCAACTATCTAGGG + Intergenic
965913053 3:173805068-173805090 CTCTGACAATGCACTATTAAAGG + Intronic
971682978 4:29725339-29725361 CTCTGCCATTGTATTACCTGTGG - Intergenic
975159909 4:71113354-71113376 CTCTGCTAATGAAGTATCTGGGG - Intergenic
978093020 4:104740956-104740978 CTATGCCTATGAAATATCTATGG - Intergenic
979448894 4:120845452-120845474 CTCTGCCTATGTTTTATCGATGG + Intronic
982192637 4:152873880-152873902 CTCTGCCTCTTTTCTATCTATGG + Intronic
985253402 4:188045071-188045093 CTCTGCCACTGATCTTTCTAGGG - Intergenic
989413554 5:41147912-41147934 CTCTGCCAATTTAATACTTAAGG - Intronic
990206687 5:53437368-53437390 CTTTGCCAATATAATATATAAGG + Intergenic
995396803 5:111695879-111695901 CTCTGTCAACTTTCTATCTAGGG + Intronic
995764812 5:115603099-115603121 CACTCCCAATTTACTATCCATGG - Intronic
1002032474 5:176440632-176440654 CTCTGCCCATGTTCTCACTATGG + Intergenic
1002125256 5:177038607-177038629 CTATGTGAATGTACTCTCTAAGG + Intronic
1012875898 6:104725787-104725809 CTGTACCAATTTACAATCTAAGG + Intergenic
1013943385 6:115692827-115692849 CTCTGCTAATCTACTCTCTAAGG - Intergenic
1014601719 6:123421323-123421345 ATCTGCCAATATACTGTCAAAGG - Intronic
1015156172 6:130098736-130098758 TTCCGCCAATGTACAATCTCAGG - Intronic
1016572302 6:145528491-145528513 CTCTGCCTGTGTTCTATATATGG + Intronic
1024662364 7:51510704-51510726 CTCTGCCAATCTAGATTCTAAGG - Intergenic
1030188527 7:106788011-106788033 CTCTGCCAAGGAACCAGCTATGG - Intergenic
1037322039 8:17653050-17653072 GTCTGGCAATGTGCTTTCTAAGG - Intronic
1038440550 8:27568436-27568458 TTCTGCCAATTTCCTATCTCTGG + Intergenic
1045040173 8:98216110-98216132 CTCTGCAAAGGTTCTCTCTAAGG + Intronic
1045407150 8:101878318-101878340 ATCTACCAATGTAATTTCTATGG - Intronic
1047365725 8:124209483-124209505 CTTTGCCAATGTATTACCCAAGG + Intergenic
1048325831 8:133438102-133438124 CTCTGCCAATGGACAATGGAAGG + Intergenic
1055039365 9:71852301-71852323 CTCTGCCTATGTTCTATCAATGG - Intergenic
1059698715 9:116754590-116754612 CTCTGCCAGTGTAATACCCAAGG - Intronic
1186234261 X:7490212-7490234 CTCTGCCTATGCACTAACTTGGG - Intergenic
1188261887 X:28033023-28033045 CTCTGCTTATGTGCTGTCTAAGG + Intergenic
1196378604 X:115064607-115064629 ATCTCTCAATGTCCTATCTATGG + Intergenic
1198818968 X:140624946-140624968 CTCTGCCTATATACTATAAATGG + Intergenic
1199216157 X:145262581-145262603 CTCTGCCAGTCCACTATCTCTGG - Intergenic
1199317107 X:146394085-146394107 CTCAACCAATGAACTAACTAAGG - Intergenic