ID: 1068324065

View in Genome Browser
Species Human (GRCh38)
Location 10:55460834-55460856
Sequence GTCCCAGAACAAAGCCCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068324065_1068324066 -6 Left 1068324065 10:55460834-55460856 CCACTTGGGCTTTGTTCTGGGAC No data
Right 1068324066 10:55460851-55460873 TGGGACATAGTTTAGTTACTTGG No data
1068324065_1068324067 0 Left 1068324065 10:55460834-55460856 CCACTTGGGCTTTGTTCTGGGAC No data
Right 1068324067 10:55460857-55460879 ATAGTTTAGTTACTTGGAAATGG No data
1068324065_1068324068 15 Left 1068324065 10:55460834-55460856 CCACTTGGGCTTTGTTCTGGGAC No data
Right 1068324068 10:55460872-55460894 GGAAATGGTTTGATACTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068324065 Original CRISPR GTCCCAGAACAAAGCCCAAG TGG (reversed) Intronic
No off target data available for this crispr