ID: 1068326222

View in Genome Browser
Species Human (GRCh38)
Location 10:55491348-55491370
Sequence CCTTACGTGGACAAGCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068326222_1068326227 18 Left 1068326222 10:55491348-55491370 CCACCCAGCTTGTCCACGTAAGG 0: 1
1: 0
2: 0
3: 5
4: 132
Right 1068326227 10:55491389-55491411 ACAGCATGCTGAGAATATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068326222 Original CRISPR CCTTACGTGGACAAGCTGGG TGG (reversed) Intronic
901523560 1:9804530-9804552 TCTTAAGTGGAGAAGCTGGGTGG - Intronic
901660935 1:10797234-10797256 CCTTACATGGAGGGGCTGGGGGG + Intergenic
904137669 1:28326424-28326446 CTTTACGAGGTCAAGATGGGAGG + Intergenic
904718020 1:32483959-32483981 CCTTACGAGGCCAAGGTGGAAGG + Intronic
905519571 1:38587481-38587503 CCTTAGGAGGACAAGGTGAGGGG + Intergenic
906960398 1:50416357-50416379 CCCTACGAGGAGAGGCTGGGAGG + Intergenic
907177474 1:52538417-52538439 CTTTTGGAGGACAAGCTGGGAGG + Intronic
919059496 1:192613810-192613832 CTTTAGGAGGCCAAGCTGGGGGG + Intergenic
922521265 1:226254217-226254239 CTTTAGGTGGCCAAGCTGGGAGG - Intronic
922638166 1:227198205-227198227 CCTTAGGGGGTCAAGCTGAGAGG + Intronic
922987451 1:229876999-229877021 CCTTAGCTGGACAGGCTGGTTGG + Intergenic
1064879591 10:20035823-20035845 ACTTCTGTGGAAAAGCTGGGTGG - Intronic
1065228612 10:23573838-23573860 CTTTAGGAGGCCAAGCTGGGAGG - Intergenic
1065923044 10:30410014-30410036 CCTTAGGAGGCCAAGGTGGGAGG - Intergenic
1068326222 10:55491348-55491370 CCTTACGTGGACAAGCTGGGTGG - Intronic
1069638158 10:69938026-69938048 CTTTACGGGGCCAAGCTTGGAGG + Intronic
1069896389 10:71682761-71682783 CCTTCCCTGGCCAAGCGGGGAGG - Intronic
1072284115 10:93896237-93896259 CCTTGGGAGGACAAGGTGGGAGG - Intronic
1073520568 10:104125044-104125066 CCTTAGGAGGCCAAGGTGGGAGG - Intronic
1080656410 11:34262062-34262084 CCTTGTGTGGAAAAGGTGGGAGG + Intronic
1083127621 11:60587440-60587462 CCTTACGTGGCCATGCTGCAGGG + Intergenic
1083600480 11:63944409-63944431 CCTTCTGGGGACCAGCTGGGTGG + Intronic
1087793148 11:102428548-102428570 CTTTGCGAGGCCAAGCTGGGTGG - Intronic
1090998429 11:131888055-131888077 TTTTACGAGGCCAAGCTGGGTGG + Intronic
1091117349 11:133025976-133025998 CCTTTGGTGGCCAAGGTGGGTGG - Intronic
1091417982 12:306921-306943 AGTTACATGGACAAGCTGTGTGG - Intronic
1092791527 12:12074884-12074906 CCTTAGGAGGCCAAGGTGGGAGG - Intronic
1093955761 12:25216516-25216538 CCTTAGGAGGCCAAGGTGGGCGG - Intronic
1098952410 12:76654681-76654703 CTTTAGGAGGACAAGGTGGGCGG - Intergenic
1101806704 12:108070228-108070250 CCCCATGTGGACAGGCTGGGAGG + Intergenic
1103062123 12:117867070-117867092 CCTTAGGAGGCCAAGGTGGGAGG + Intronic
1103502133 12:121411169-121411191 CTTTAGGTGGCCAAGGTGGGAGG - Intronic
1107927200 13:45274570-45274592 CTTTAGGTGGTCAAGGTGGGCGG - Intronic
1112643552 13:101304679-101304701 CTTTAGGTGGCCAAGGTGGGTGG - Intronic
1122261528 14:100526024-100526046 TCTTACGTGGAAAATCTGGTTGG - Exonic
1122445377 14:101763622-101763644 CCTTAGGAGGCCAAGGTGGGCGG - Intronic
1122552106 14:102555717-102555739 CCTTATGTGGACAACGGGGGCGG + Intergenic
1127627733 15:60796560-60796582 CCTTATGTGTACATGCTGGTTGG + Intronic
1128232489 15:66045392-66045414 CCTTAAGTGGACAGGCAGGCAGG - Intronic
1128268476 15:66288322-66288344 CTTTAGGAGGACAAGGTGGGAGG + Intergenic
1131823373 15:96295403-96295425 CCTTAGGAGGCCAAGGTGGGTGG + Intergenic
1133100504 16:3476378-3476400 CCTCAGGTGCAGAAGCTGGGCGG + Intronic
1135116540 16:19728491-19728513 CTTTACGAGGCCAAGGTGGGTGG - Intronic
1135418173 16:22285102-22285124 CCTTACGTGTAAAAGCTTTGAGG - Exonic
1135459627 16:22630305-22630327 CTTTACGAGGCCAAGGTGGGAGG + Intergenic
1135620400 16:23950505-23950527 ACTGCCGTGGACAAGCTGTGTGG + Intronic
1136633757 16:31506130-31506152 CCACACGTGGACAATCTGGTTGG - Intronic
1138261901 16:55629827-55629849 CCTTAGGTGGACAGTCTGGTGGG - Intergenic
1139973600 16:70791627-70791649 ACTTACGAGGCCAAGGTGGGCGG - Intronic
1141519466 16:84568239-84568261 CCTTGGGAGGCCAAGCTGGGCGG - Intronic
1143097917 17:4488298-4488320 CCTGAAGTGGGGAAGCTGGGGGG + Intergenic
1143304169 17:5932936-5932958 CCTTAGGTGGGCTAGTTGGGTGG - Intronic
1146776279 17:35620235-35620257 CCTTAGGAGGCCAAGATGGGAGG + Intronic
1147698921 17:42379329-42379351 TGTTTCATGGACAAGCTGGGTGG + Intronic
1147940727 17:44045814-44045836 CCTTAGGAGGCCAAGGTGGGTGG - Intronic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1149118926 17:53137345-53137367 CCTCACCTGTACAAACTGGGGGG - Intergenic
1149293550 17:55239888-55239910 CCTAACATGGACAAGGTGGGAGG + Intergenic
1150181826 17:63130263-63130285 CCTTATGAGGCCAAGCCGGGTGG + Intronic
1150895752 17:69208791-69208813 CTTTAGGTGGCCAAGGTGGGAGG + Intronic
1152240291 17:79157385-79157407 CCTTACGGGGAGAAGCTTTGTGG - Intronic
1154401842 18:14046223-14046245 CCTTGGGTGGGGAAGCTGGGAGG - Intergenic
1157140251 18:45098640-45098662 ACTTAACTGGACAACCTGGGTGG - Intergenic
1161693282 19:5750203-5750225 CCTTGGGTGGCCAAGGTGGGCGG + Intronic
1162124149 19:8490317-8490339 CGGTACGTGGACACTCTGGGAGG - Exonic
1163227396 19:15974025-15974047 CTTTAGGTGGCCAAGGTGGGTGG + Intergenic
1166392181 19:42414817-42414839 TCTTACGTGGACATGGTTGGTGG - Intronic
929607863 2:43247141-43247163 TCTTCAGTGGAGAAGCTGGGAGG + Intronic
930120305 2:47755337-47755359 CATTAGGAGGCCAAGCTGGGAGG - Intronic
931585499 2:63822640-63822662 CCTTAGGGGGCCAAGGTGGGAGG + Intronic
932084272 2:68744302-68744324 CCTTCCCAGGACAAGCTGGGTGG - Intronic
935055350 2:99561619-99561641 CTTTAGGAGGCCAAGCTGGGAGG - Intronic
935749636 2:106219895-106219917 CCTTACATGGCAATGCTGGGGGG + Intergenic
938043791 2:128098321-128098343 CTTTGGGTGGACAAGGTGGGTGG + Intronic
942337202 2:174901293-174901315 CCTTGCATGGACATGCTGGTCGG + Intronic
944323451 2:198376158-198376180 CCTTGGGAGGCCAAGCTGGGAGG - Intronic
946657808 2:221967278-221967300 CTTTAGGAGGCCAAGCTGGGGGG - Intergenic
947753906 2:232547161-232547183 CCTTGGGAGGACAAGGTGGGTGG + Intergenic
1171438229 20:25140425-25140447 CCTAACGTGGACAGACTAGGGGG - Intergenic
1172297291 20:33822066-33822088 CCTTAGGAGGCCAAGGTGGGTGG - Intronic
1173613530 20:44388195-44388217 CTTTAGGTGGCCAAGGTGGGAGG - Intronic
1173967868 20:47127314-47127336 GCTTATGTGGCCAAGCTCGGTGG + Intronic
1175805342 20:61825162-61825184 CCTTAGGAGGCCAAGGTGGGTGG + Intronic
1176867878 21:14063829-14063851 CCTTCCGAGGAGAAGCAGGGCGG + Intergenic
1178539725 21:33439158-33439180 CCTTAAGTAGACAAGTTTGGAGG + Intronic
1179174727 21:39000220-39000242 CCTCACCTCGACAAGCCGGGGGG + Intergenic
1180604476 22:17046517-17046539 CCTTACCTGGGCAACCTTGGGGG + Intergenic
1182286483 22:29251443-29251465 CTTTAAGTGGCCAAGGTGGGAGG - Intronic
1183226839 22:36556279-36556301 CTTTAGGAGGCCAAGCTGGGTGG - Intergenic
1183241424 22:36660622-36660644 CCTCACCTGGGCAAGGTGGGGGG - Intronic
949372295 3:3348419-3348441 CCTTAGGAGGCCAAGATGGGAGG - Intergenic
949874543 3:8617883-8617905 CTTTTGGTTGACAAGCTGGGGGG - Intergenic
949874549 3:8617910-8617932 CTTTTGGTTGACAAGCTGGGGGG - Intergenic
951036797 3:17941406-17941428 CTTTACTTGGAGAAACTGGGAGG + Intronic
951223284 3:20092471-20092493 CTTTAGGAGGACAAGGTGGGTGG - Intronic
954784549 3:53083266-53083288 CTTTGGGAGGACAAGCTGGGAGG + Intronic
956469062 3:69546086-69546108 CTTTAGGAGGACAAGGTGGGAGG - Intergenic
956524139 3:70139278-70139300 CCTTAGGAGGCCAAGGTGGGAGG - Intergenic
966647698 3:182265006-182265028 CCTGTTGTGTACAAGCTGGGAGG + Intergenic
971328205 4:25661629-25661651 CCTTAGGAGGCCAAGGTGGGTGG - Intronic
973265937 4:48210374-48210396 CCTTAGGAGGCCAAGGTGGGAGG + Intronic
976377423 4:84361644-84361666 CCTTAGGAGGCCAAGGTGGGAGG + Intergenic
977157119 4:93588613-93588635 ACTTCAGTGGAGAAGCTGGGTGG - Intronic
977734060 4:100390802-100390824 CTTTAGGAGGCCAAGCTGGGCGG + Intergenic
980085968 4:128390234-128390256 CCTTAGGGGGACAGGCTTGGGGG + Intergenic
982266907 4:153546132-153546154 CTTTAAGAGGACAAGGTGGGAGG - Intronic
984887713 4:184465356-184465378 CCTTACGTGGACCAGAGGTGAGG + Intronic
986443803 5:7803653-7803675 CTTTAGGTGGCCAAGGTGGGAGG + Intronic
992900560 5:81290914-81290936 CTTTAGGAGGACAAGGTGGGTGG + Intergenic
992929801 5:81631496-81631518 ATTTACATGGACAAGCTAGGTGG - Intronic
997210553 5:132074508-132074530 CCTCACCTGGACCTGCTGGGTGG - Intronic
999352817 5:150892851-150892873 CTTTAAGAGGACAAGGTGGGAGG - Intronic
1001620094 5:173076505-173076527 CTTTAGGAGGACAAGATGGGTGG + Intronic
1002117787 5:176977664-176977686 CTTTAGGAGGCCAAGCTGGGTGG + Intronic
1002523443 5:179803631-179803653 CCTCAGATGGACAGGCTGGGTGG + Intronic
1003090832 6:3101344-3101366 CTTTGGGAGGACAAGCTGGGAGG + Intronic
1004114957 6:12757866-12757888 CCTTAGGAGGCCAAGGTGGGCGG + Intronic
1004737408 6:18421566-18421588 CCCTACGTGGCAAAGCAGGGTGG + Intronic
1009698179 6:67137579-67137601 CCTTGGGTGGCCAAGATGGGTGG + Intergenic
1010564001 6:77385810-77385832 CCTTAGGAGGCCAAGATGGGAGG - Intergenic
1011284868 6:85712531-85712553 CCTTAGGAGGCCAAGGTGGGAGG + Intergenic
1013749575 6:113388032-113388054 CCTTCAGTGGAAATGCTGGGTGG + Intergenic
1015496734 6:133890354-133890376 GCTTACGTGGACAATTTGGGGGG - Intronic
1024433223 7:49315185-49315207 CCTTAGGAGGCCAAGGTGGGCGG - Intergenic
1026303384 7:69118926-69118948 CTTTAAGAGGACAAGGTGGGTGG - Intergenic
1032409857 7:131687006-131687028 CCTGAAGTGGCCAGGCTGGGTGG + Intergenic
1038984030 8:32789533-32789555 CCTTGGGAGGCCAAGCTGGGAGG - Intergenic
1041441645 8:57903560-57903582 CTTTAGGAGGCCAAGCTGGGTGG + Intergenic
1049264491 8:141660195-141660217 CCTAACTTGGACAATCTGGCTGG + Intergenic
1049915272 9:311494-311516 CCTTGGGTAGACAAGGTGGGAGG - Intronic
1051317708 9:15859909-15859931 ACTTCCGTGGCCAAGGTGGGAGG - Intronic
1051815465 9:21100167-21100189 CCTTAGGAGGCCAAGGTGGGAGG - Intergenic
1055644346 9:78348767-78348789 CGTTCCGTGGAGCAGCTGGGTGG - Intergenic
1056510398 9:87299045-87299067 CTTTGGGTGGCCAAGCTGGGTGG + Intergenic
1062399643 9:136366747-136366769 CCTCACTTGGGGAAGCTGGGAGG + Intronic
1062431666 9:136529205-136529227 CCATATGTGGACTGGCTGGGGGG + Intronic
1195550840 X:106168345-106168367 GCTTCCGTGGAGAAGCTTGGAGG + Exonic
1198521754 X:137460274-137460296 CTTTACGAGGCCAAGGTGGGAGG - Intergenic