ID: 1068330142

View in Genome Browser
Species Human (GRCh38)
Location 10:55554574-55554596
Sequence ATCGAAAATACAGCTTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068330139_1068330142 7 Left 1068330139 10:55554544-55554566 CCTATGAAGACATTTTTTAATCA 0: 1
1: 0
2: 5
3: 47
4: 494
Right 1068330142 10:55554574-55554596 ATCGAAAATACAGCTTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068330142 Original CRISPR ATCGAAAATACAGCTTTTGT GGG Intronic
No off target data available for this crispr